ID: 1000960643

View in Genome Browser
Species Human (GRCh38)
Location 5:167596977-167596999
Sequence GAGCCTGGCTTTTCTAAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000960641_1000960643 -5 Left 1000960641 5:167596959-167596981 CCTGTAGGGGACAGTTCAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG No data
1000960640_1000960643 4 Left 1000960640 5:167596950-167596972 CCAAGAGCACCTGTAGGGGACAG 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG No data
1000960639_1000960643 5 Left 1000960639 5:167596949-167596971 CCCAAGAGCACCTGTAGGGGACA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000960643 Original CRISPR GAGCCTGGCTTTTCTAAATC CGG Intronic
No off target data available for this crispr