ID: 1000968227

View in Genome Browser
Species Human (GRCh38)
Location 5:167684971-167684993
Sequence CTAGACCACCAGCTCTCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000968227 Original CRISPR CTAGACCACCAGCTCTCAAT TGG Intronic
901484300 1:9547763-9547785 CTAAACCAGTAGTTCTCAATTGG - Intronic
902813051 1:18900423-18900445 CTAGAGCACTGGCTCTCAACCGG + Intronic
903425976 1:23254541-23254563 CTGTACCACCAGCTCTCTGTCGG - Intergenic
905890460 1:41515583-41515605 CTCAGCCACCAGCTCTCACTGGG - Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
909071624 1:71001066-71001088 CTAGACCACCTGCTTTCCAGTGG - Intronic
909630513 1:77765421-77765443 CTAGAGCACCAATTCTCAACTGG - Intergenic
910781588 1:90942152-90942174 CTAGACCACCAGATCATAAGTGG - Intronic
912735056 1:112143156-112143178 CTAGAACACCTGCTCTTAGTGGG - Intergenic
1064115948 10:12577640-12577662 CTAAGCCACCAGTTCTCGATTGG + Intronic
1065130888 10:22619094-22619116 CTTGAGCACCAGCTCTCATTTGG + Intronic
1065432923 10:25677470-25677492 TTAGATGACCAGCTCTCAAATGG - Intergenic
1069283443 10:66684120-66684142 CTAAACCAGCAGTTCTCAGTTGG + Intronic
1071293490 10:84203300-84203322 CTAGACCATGAGCTCCCCATGGG + Intronic
1071933302 10:90498134-90498156 TTAGACCACCAGCCCCCAACAGG + Intergenic
1073123467 10:101135530-101135552 CTAGGCCAGCAGCCCTCAGTAGG - Intronic
1074216148 10:111386272-111386294 CTAGCCCCCCAGCCCCCAATAGG + Intergenic
1075912419 10:126136152-126136174 ATAGACTTTCAGCTCTCAATTGG - Intronic
1076448598 10:130538137-130538159 CTAGACCCCCACCTCCCAACAGG - Intergenic
1076529689 10:131136115-131136137 CTAGACCAGTGGCTCTCAACTGG - Intronic
1079525174 11:21378198-21378220 CTAGACCACGAGTTCTTAATGGG - Intronic
1085047961 11:73364204-73364226 GTAGACCACAAGCTCTCCATTGG - Exonic
1085919851 11:80940035-80940057 CTACACACCCAGCTCTCAAGAGG + Intergenic
1090027067 11:123176986-123177008 CTAGACCATAAGCTCTCTGTAGG - Intronic
1093905268 12:24684020-24684042 CTAGCCCGCCAGCCCTCAACAGG + Intergenic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1094669785 12:32558381-32558403 CTAGCCCAGGAGATCTCAATGGG - Intronic
1095860058 12:46906798-46906820 CTAGTCTAGTAGCTCTCAATTGG - Intergenic
1098679859 12:73338889-73338911 CAAGACCCCCACCCCTCAATAGG - Intergenic
1103026918 12:117581317-117581339 CTAGACCACGAGCTCCCCAAGGG + Intronic
1103158092 12:118704722-118704744 CTAAAGCAAAAGCTCTCAATGGG - Intergenic
1103208777 12:119151344-119151366 CAAGGCCACCAGCTCGAAATGGG - Intronic
1112186468 13:97132622-97132644 CAAGACCACAAGCTCTAAAGTGG - Intergenic
1114517765 14:23310929-23310951 CTAGACCATCGGCTCCAAATTGG + Exonic
1115368821 14:32589108-32589130 CAAGACCAGCAGCTGTCATTTGG + Intronic
1119840695 14:77790696-77790718 CCATACCCCCAGCTGTCAATGGG - Intergenic
1119874500 14:78045972-78045994 ATGGACCCCCACCTCTCAATTGG - Intergenic
1121296932 14:92834878-92834900 CTAGACTACCATCTCTCACATGG - Intronic
1122187133 14:100008082-100008104 CTACACCAGCAGTTCTCAACTGG - Intronic
1125507947 15:40277851-40277873 CCAGACCTCCAGCTGTCCATAGG + Intergenic
1126569311 15:50132953-50132975 CTAGCCCACCACCCCTCAACAGG - Intronic
1128766944 15:70256999-70257021 CTAGACCAGCGGTTCTCAACTGG - Intergenic
1129557822 15:76531784-76531806 GTAGACCACTAACTCTCCATAGG - Intronic
1129619209 15:77128463-77128485 CTAGCCTACCAGATCTCAAGAGG - Intronic
1129769341 15:78193586-78193608 CTACACCACCAGCTCCCCAGAGG - Exonic
1130569359 15:85026605-85026627 CTATATCCCCATCTCTCAATGGG + Intronic
1131699395 15:94917894-94917916 CTAGACCTCCACATCTCCATAGG - Intergenic
1131936768 15:97514986-97515008 CTAGAGCCCCAGCTCTCCTTTGG + Intergenic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135382950 16:22008869-22008891 CTCGCCCACCAGCTCTCTAGTGG - Intronic
1135465687 16:22682857-22682879 TTTAACAACCAGCTCTCAATGGG - Intergenic
1139329801 16:66178438-66178460 CCAGATGACCAGCTTTCAATTGG + Intergenic
1143351332 17:6290425-6290447 CTCGACCAGCAGTTCTCAAATGG - Intergenic
1143832007 17:9660046-9660068 CTAGAGCAGTAGCTCTCAACTGG - Intronic
1144141698 17:12355725-12355747 CTGTACCACCAGCTCTTTATGGG + Intergenic
1147267418 17:39243288-39243310 CTAGACCACCTGCACTCAGCTGG + Intergenic
1148601579 17:48898420-48898442 GTAGACCAGTAGCTCTCAACTGG - Intergenic
1150820231 17:68428779-68428801 CTACACGACCAGCTCTCGAAAGG + Intronic
1150919857 17:69471201-69471223 CTCAACCACCAGCTTTCAGTGGG + Intronic
1151849656 17:76682904-76682926 CTAGACCACCAACCCACACTTGG - Intronic
1153444712 18:5158096-5158118 CTAGAGCATCTGCTCTCAAGGGG + Intronic
1155067582 18:22281032-22281054 CTAGAGCACCCGCTCTCCAGAGG - Intergenic
1155465865 18:26134445-26134467 CTGGACCACGAGCGTTCAATAGG - Intronic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1156919124 18:42498408-42498430 CTAGACCAGCAGCTCTCATCTGG + Intergenic
1156919269 18:42500596-42500618 CTAGACCAGCAGCTCTCATCTGG - Intergenic
1158641556 18:59207991-59208013 CTAGAACATCAGCTCCCTATGGG + Intergenic
1160101456 18:75923344-75923366 CTATAGCAGCAGCTATCAATGGG - Intergenic
1161360985 19:3849570-3849592 CTAGACCATCAGTTCTTAACTGG - Intronic
1163411643 19:17158651-17158673 AGAGACCACCAGCTCTGAAAGGG + Intronic
926606545 2:14904100-14904122 CTAGACCACCAGCTCTAAGAGGG + Intergenic
928634989 2:33235896-33235918 CTAGCCCACCACCTCCCAACAGG - Intronic
932707782 2:74039975-74039997 ATAGACCCCCACCTCTCCATGGG + Intronic
936684508 2:114811899-114811921 CAAGAACAAAAGCTCTCAATAGG + Intronic
941863185 2:170306327-170306349 ATAGACCCCCACCTCTTAATGGG + Intronic
942613828 2:177769207-177769229 CTAGTCCTCCAGCTCCCAATGGG + Intronic
947322801 2:228940966-228940988 CCAGACCACCAGTTCAAAATTGG + Intronic
1170747406 20:19112831-19112853 ATAGATCCCCATCTCTCAATGGG - Intergenic
1173832982 20:46104598-46104620 GTAGAACCCCATCTCTCAATGGG + Intergenic
1173925481 20:46778267-46778289 CTAGACCAGCAGCTCTCAGCCGG - Intergenic
1174018698 20:47511330-47511352 CTTGACCACCAGGGCTCAAGCGG + Intronic
1178339255 21:31772106-31772128 CTAGACCTCCAGGACTCAAGAGG + Intergenic
949336849 3:2984331-2984353 TTAGACCAGCAGTTCTCAAATGG + Intronic
950105602 3:10386385-10386407 CTAGACCACCAGCACACAGCTGG - Intronic
951610406 3:24486038-24486060 CTACACCAGCTGTTCTCAATAGG + Intronic
952764646 3:36944246-36944268 CCAGCCCAGCAGCCCTCAATCGG + Intronic
954105619 3:48408366-48408388 CTAGACCCCCAGGTCTCAGTTGG - Intronic
964519273 3:157545422-157545444 CTAGAGCCGAAGCTCTCAATAGG - Intronic
967682186 3:192377181-192377203 CTAGATCACCATCTCTCAGAAGG + Intronic
968722608 4:2218797-2218819 CCAGCCCACCAGCTGTCATTAGG + Intronic
976829257 4:89295465-89295487 CTAGTCCATAAGCTCTCCATAGG + Intronic
976998095 4:91461573-91461595 CCTGACCACCAGCCCTCATTTGG + Intronic
977649467 4:99453630-99453652 ATCAACCACCAGCACTCAATGGG - Intergenic
979096675 4:116559587-116559609 CCAGCCCACCAGCCCCCAATAGG - Intergenic
981134227 4:141191794-141191816 CTGGACCATCAGCCTTCAATGGG - Intronic
982520245 4:156407465-156407487 CAAAACCACCAGTTCTGAATGGG + Intergenic
983975556 4:173929343-173929365 CTGGACTGCCAGCTCACAATGGG + Intergenic
990032464 5:51278361-51278383 CTAGTCCACCACCCCTCAACAGG + Intergenic
994122756 5:96135080-96135102 CTGTACCACCCACTCTCAATAGG - Intergenic
997845731 5:137284263-137284285 CTAGACCATCATCTCCCAAAGGG + Intronic
998097899 5:139407427-139407449 CTACCCCACCACCTTTCAATGGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000968227 5:167684971-167684993 CTAGACCACCAGCTCTCAATTGG + Intronic
1008259538 6:49347806-49347828 TTAGACCACCACTTCTCTATTGG - Intergenic
1017777486 6:157691456-157691478 CTAGACCAGAAGCTCTCTCTGGG + Intergenic
1018985837 6:168636758-168636780 CTCGGCCACCAGCTCTCTTTAGG - Intronic
1023899246 7:44462578-44462600 CTTGATCAGCAGCTCTCAAAGGG + Intronic
1024041420 7:45559047-45559069 CTAGACCACCCACTCCCATTTGG - Intergenic
1024872043 7:53975183-53975205 CTTGACAACCTGATCTCAATGGG - Intergenic
1041739589 8:61144198-61144220 CTAGACCTCCAGCCCCCAACAGG + Intronic
1042484645 8:69336823-69336845 CTAGAACAGCAGCTCCCCATGGG - Intergenic
1043838291 8:85069421-85069443 CTAGACCAGCAGTTCTCAAAGGG + Intergenic
1043908920 8:85837743-85837765 TTAGACCAACAGTTCTCAACTGG - Intergenic
1044021941 8:87115652-87115674 CTACACCACAAGCTCTCTAGTGG - Intronic
1045146912 8:99355678-99355700 CTAGAACAACAGCCCTAAATAGG - Intronic
1046781418 8:118219509-118219531 ATAGACCCCCATCTCTCACTGGG - Intronic
1048585912 8:135773699-135773721 CTAGACCCCTATCTCTCACTAGG - Intergenic
1049439894 8:142604524-142604546 CTCGACCACCACCTCTCTCTGGG - Intergenic
1050668598 9:7969812-7969834 CTTGACCAGCACTTCTCAATGGG + Intergenic
1056665210 9:88576393-88576415 CTAGACCCCCAGCTCCCACGTGG + Intronic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1189229044 X:39437725-39437747 ATAGACCCCCACCTCTCAATGGG + Intergenic
1191668250 X:63725149-63725171 ATGTACCACCAACTCTCAATTGG - Intronic
1194069612 X:89305080-89305102 CTAGCCCCCCAGCTCCCAAAAGG + Intergenic
1195145535 X:102011716-102011738 CTAGACAACCAGCTATCACCAGG - Intergenic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1196192922 X:112813246-112813268 CAAGTCCCACAGCTCTCAATAGG + Intronic
1197833017 X:130665459-130665481 CCAGACCACCTGCTGTCAAAAGG - Intronic
1199671773 X:150153792-150153814 CAAAAAGACCAGCTCTCAATTGG - Intergenic
1200292212 X:154885358-154885380 CACGACCACCATCTCTCAAGTGG + Exonic
1200339049 X:155381095-155381117 CACGACCACCATCTCTCAAGTGG + Exonic
1200347420 X:155459597-155459619 CACGACCACCATCTCTCAAGTGG - Exonic