ID: 1000970518

View in Genome Browser
Species Human (GRCh38)
Location 5:167709206-167709228
Sequence GAACTCAGCTTGGAAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000970518_1000970521 3 Left 1000970518 5:167709206-167709228 CCTGTCTTTTCCAAGCTGAGTTC 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1000970521 5:167709232-167709254 GCGTGGTCTTCTCTTATCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 77
1000970518_1000970522 4 Left 1000970518 5:167709206-167709228 CCTGTCTTTTCCAAGCTGAGTTC 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1000970522 5:167709233-167709255 CGTGGTCTTCTCTTATCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000970518 Original CRISPR GAACTCAGCTTGGAAAAGAC AGG (reversed) Intronic
903587209 1:24425115-24425137 TACCTCAGCTGGGAAAAGTCAGG + Intronic
903588720 1:24438129-24438151 GAACTCAGCTGGGGAAACCCTGG + Intronic
903966298 1:27092254-27092276 GAACTCAGCCTGGACAACATGGG + Intergenic
904492843 1:30871141-30871163 GAGCCCAGCCTGGAAAAGACAGG + Intronic
905401892 1:37709735-37709757 GAGCACAGCTTGGAGAGGACAGG - Intergenic
905638756 1:39574592-39574614 GAACTCAGCTTGGAGCACACTGG + Intronic
909827267 1:80142285-80142307 GAGCTCAGCCTTTAAAAGACTGG + Intergenic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
911437348 1:97878129-97878151 GAACGTAGCATGGAAAAGGCAGG - Intronic
911714175 1:101111412-101111434 GAAATAAGGTTGGAAAAGATAGG - Intergenic
913448656 1:118976568-118976590 GAGCTCAGCTCTGAGAAGACAGG - Intronic
914957223 1:152173621-152173643 GAACACAGTTTGAAAAATACTGG - Intergenic
915306081 1:154979826-154979848 GAACTAAGCTTTGAGAAAACAGG + Intergenic
916070789 1:161168514-161168536 TTGCTCAGCTTGGAAGAGACTGG - Exonic
917901303 1:179545971-179545993 GAACTAGGCTGGGAACAGACAGG + Intronic
921216109 1:212937911-212937933 GAGCCCAGATAGGAAAAGACTGG - Intergenic
1065207444 10:23370527-23370549 TAACTCAGCTTGGGAGAGAAAGG + Intergenic
1070336536 10:75460423-75460445 GAACACAGTTTGAAAAACACTGG + Intronic
1072419555 10:95278398-95278420 GAACTCAGCTGTGAAAAGGGTGG + Intronic
1072902842 10:99424784-99424806 GAACTCAACCTGGGAAAAACTGG - Intronic
1073053276 10:100683450-100683472 AAACTCAGCTTGGAGAAGGGAGG - Intergenic
1073798292 10:107012927-107012949 CAACTCAACCTGGAAGAGACAGG - Intronic
1075383058 10:122034466-122034488 CAACCCAGTTTGGAAATGACTGG - Intronic
1076981689 11:208203-208225 GAAGTGAGCCGGGAAAAGACTGG - Intronic
1078017581 11:7628368-7628390 GATGTAAGCATGGAAAAGACAGG - Intronic
1078108869 11:8375971-8375993 AAACTCAGCTTGGAGAATACAGG + Intergenic
1078443567 11:11387283-11387305 GAAGGCAGCTGGGAAATGACAGG - Intronic
1079615843 11:22491970-22491992 GAAACCAGCCTGGAAAAGCCTGG + Intergenic
1080803811 11:35633617-35633639 GTACGTAGCTTGGAATAGACAGG - Intergenic
1081474288 11:43410334-43410356 GAAATCAACATTGAAAAGACTGG - Intronic
1081823571 11:46024038-46024060 GAACACAGTTTGGGAAATACTGG + Intronic
1084837807 11:71816650-71816672 GAACTCACCTTGGAGAAAAGTGG - Intergenic
1085133007 11:74058011-74058033 GAACTGAGCCTTAAAAAGACAGG - Intronic
1086534368 11:87826524-87826546 TAACTCTCCTTGGAAAAGACAGG + Intergenic
1087160143 11:94940821-94940843 GAATTCAGTCTGGAAAAGATTGG - Intergenic
1087354779 11:97078530-97078552 CAACTTAGCTAGGAAAAGAGAGG - Intergenic
1087836920 11:102884772-102884794 GGACTCAGCATGGTAAAGGCAGG + Intergenic
1088139583 11:106599548-106599570 CAACCCAGCTTGAAAAAGAGGGG + Intergenic
1089031396 11:115333105-115333127 GCAGTCAGATTGGAAAAGAGGGG - Intronic
1089637368 11:119823994-119824016 GAACTCAGATTGGCAAGGAAAGG - Intergenic
1090296565 11:125593131-125593153 GAACAGAGCGTGGGAAAGACTGG + Intronic
1092042388 12:5395978-5396000 GGACTCAGCCTGGAAATGGCGGG - Intergenic
1092171884 12:6378703-6378725 GAACTGGGCTTGGAAAGGAGTGG - Intronic
1092253289 12:6913310-6913332 GAAGTCGGCTAGGAAAGGACAGG + Intronic
1093019327 12:14188550-14188572 GAACTCAGCTTTTAAAAAGCAGG + Intergenic
1093423574 12:19001904-19001926 GACCCCAGCTTGGAAAGCACAGG + Intergenic
1096330321 12:50706353-50706375 GAAATCAGCTGGGAAAAGAGTGG - Intronic
1096562350 12:52445649-52445671 GAACTTATCTTGGGAAAGGCTGG - Intergenic
1096996436 12:55841079-55841101 GAACAGAGCCTGGAAAAGAGAGG - Intronic
1097719788 12:63008119-63008141 CAACTAAGCTTAGAAAACACAGG - Intergenic
1097978756 12:65715475-65715497 GAGCTCACCTTGGAAAGAACTGG - Intergenic
1098265267 12:68711745-68711767 GAACACAGCAAGGAAAAGAATGG + Intronic
1100330418 12:93576495-93576517 CTACTCAACTTGTAAAAGACTGG - Exonic
1100593760 12:96053997-96054019 CAACTCAACTTGGAACAGGCAGG + Intergenic
1101581883 12:106049125-106049147 AAACTCAGAGTGGAAAGGACAGG + Intergenic
1101598719 12:106189802-106189824 GCCCTCAGCTTGGAAGAGCCAGG - Intergenic
1101849618 12:108391845-108391867 GAACTAAGGTTGGAAAGGTCAGG + Intergenic
1103375633 12:120453504-120453526 GAACCCTGATTGGGAAAGACAGG + Intronic
1104865186 12:131949622-131949644 GAACTGCGCGTGGAAAAGCCGGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1112013594 13:95312695-95312717 GAACTCATTTTAGAAAAGAAAGG - Intergenic
1112446310 13:99467642-99467664 GAAATGAGCTTTGAAAAGAGAGG - Intergenic
1113549186 13:111178690-111178712 CCACCCAGCTTGGAAAAGGCAGG + Intronic
1116624361 14:47246054-47246076 GAAGTGAGCTTGGAGAAAACTGG - Intronic
1118895930 14:69945455-69945477 GAAGTCATCATGGATAAGACAGG + Intronic
1119867702 14:77987896-77987918 GGGCTCATGTTGGAAAAGACAGG - Intergenic
1121164965 14:91785916-91785938 GAAGTCAACTGGTAAAAGACGGG + Intronic
1121170372 14:91848772-91848794 GTAGTCATCTTGGAAAAGATAGG - Intronic
1125844665 15:42840893-42840915 GAACTCAGGTTGAAAATCACTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128013782 15:64323831-64323853 AAAATCAGCTGGGAAAAGAGAGG - Intronic
1128658271 15:69478491-69478513 GAGCTCAGCCTGAAATAGACAGG + Intergenic
1131191146 15:90317812-90317834 AAAATCAACTTGGAAAAGACAGG + Intergenic
1132039439 15:98512652-98512674 AAAATCATCTTGGAAAACACTGG + Intronic
1135761759 16:25143637-25143659 GAACTTATCTGGGAGAAGACTGG - Intronic
1137975428 16:53027289-53027311 GAATTAACCTTGGGAAAGACAGG - Intergenic
1139915043 16:70422847-70422869 TGACTCAGCTTGGCAAAGCCAGG - Intronic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1143227045 17:5314468-5314490 GAAGTCGGCTTGGAAAAGAAGGG - Intronic
1146072773 17:29699445-29699467 AAACTCAGCTTGTAAAAGCCAGG - Intronic
1147038174 17:37697520-37697542 AAAGTCAACTTGGGAAAGACAGG + Intronic
1148989869 17:51656436-51656458 CAACTCACCTTGGAACAGAGAGG - Intronic
1149974300 17:61250720-61250742 GAGCTCAGCTTAAAAAAGCCTGG - Intronic
1150019881 17:61600920-61600942 GAACTAGGCTTAGAAATGACAGG - Intergenic
1150330000 17:64286865-64286887 GAACTCAGCTTGAGGAAGATGGG - Intergenic
1150496140 17:65609269-65609291 GAATCAAGCTTGGAAAAGAGGGG + Intronic
1150604931 17:66682621-66682643 CAACTCAACTTTCAAAAGACAGG - Intronic
1151511427 17:74562932-74562954 GTACTCAGCTGGGAAGAGTCAGG - Intergenic
1152816218 17:82409619-82409641 TGACTCAGCTTAGAAACGACTGG + Intronic
1153321575 18:3778954-3778976 GAGCTCAGGTTGGGATAGACTGG - Intronic
1153965576 18:10178493-10178515 GAAATTAGCATGGGAAAGACTGG + Intergenic
1154945564 18:21158308-21158330 GAATTCAGCAGGGAAATGACAGG - Intergenic
1155345848 18:24855872-24855894 GAAAACAGCATGGAAAAGATTGG + Intergenic
1158551576 18:58440494-58440516 GAACTCCTCTTGGAAAAGTGAGG + Intergenic
1159613687 18:70554600-70554622 GAAAACATCTTTGAAAAGACTGG + Intergenic
1159819815 18:73126765-73126787 GAACTATCATTGGAAAAGACTGG + Intergenic
1161402973 19:4077086-4077108 GAACTGGGCTTGGTAAAAACGGG - Intergenic
1163523932 19:17808793-17808815 CAACTCAACTTGGCAATGACGGG + Intronic
1166845666 19:45726680-45726702 GAAATCAGCTTGGGCAACACAGG - Intronic
1167539198 19:50074547-50074569 GATTTGAGATTGGAAAAGACGGG + Intergenic
1167630509 19:50623311-50623333 GATTTGAGATTGGAAAAGACGGG - Intronic
925294553 2:2768588-2768610 GAACCCTGCTTGGGACAGACGGG - Intergenic
927630951 2:24773643-24773665 TAAAACAGCTTTGAAAAGACAGG + Intergenic
929121770 2:38489519-38489541 ACTCTCAGCTTGGGAAAGACAGG - Intergenic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
930226606 2:48800540-48800562 CAACAAAGCTGGGAAAAGACTGG + Intergenic
930884933 2:56314673-56314695 GGATATAGCTTGGAAAAGACTGG + Intronic
931628264 2:64276515-64276537 GGAAACAGCTTGGAAAGGACTGG - Intergenic
931967638 2:67551014-67551036 GAAATCACCAAGGAAAAGACCGG + Intergenic
932275254 2:70446689-70446711 GAAACCAGCCTGGAAAACACAGG + Intergenic
933463940 2:82626211-82626233 GAAGTCAGCATGGAAATGAAAGG + Intergenic
933756879 2:85646687-85646709 GAACTTTGGTTGGATAAGACAGG + Intronic
937170936 2:119868130-119868152 CAACTAAACTTGGAAAAGAAAGG + Intronic
937989520 2:127654537-127654559 GAACTCACCTGGAAGAAGACAGG + Exonic
938723630 2:134087906-134087928 AAATTCAGCTTTGAAAAGAGAGG - Intergenic
938803474 2:134784963-134784985 GAACTGAGCCTGGAAAGGAAAGG + Intergenic
942141434 2:172981097-172981119 AAGCTCAGCTGGGAAAAGAAAGG - Intronic
944450667 2:199838901-199838923 CAACTCAGCTTCTAAAACACTGG + Intronic
944615769 2:201458605-201458627 GAACTCAGCATGGGAGAGAAGGG - Intronic
946470253 2:219953172-219953194 GAAAACAGCATGGGAAAGACCGG - Intergenic
946482180 2:220067877-220067899 TAACTCAGCTAGGAAGAGAAAGG + Intergenic
946982877 2:225237226-225237248 GAAATTAGATTGGAAAAGAAAGG - Intergenic
1169247877 20:4038185-4038207 GACAGCAGCTTGGAGAAGACAGG + Intergenic
1170446680 20:16435348-16435370 GCATTCAGCTTTGAAAAGAGTGG - Intronic
1170512618 20:17094427-17094449 GAAATAAACTGGGAAAAGACAGG - Intergenic
1172681867 20:36722540-36722562 AAACTATGCTTGGAACAGACTGG + Intronic
1175651316 20:60726562-60726584 GACCTGAGCTTGGAACATACTGG + Intergenic
1177931508 21:27290574-27290596 TAAATCAAATTGGAAAAGACAGG + Intergenic
1181569479 22:23760372-23760394 GAACTCTGCCTGTAAAAGGCAGG + Intergenic
1182987119 22:34730549-34730571 GAACTCAGTTTGGAAAATCTGGG + Intergenic
1183231611 22:36585755-36585777 GGACTCAGATTGGCAACGACAGG - Intronic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
950989027 3:17411598-17411620 GAGCTGATTTTGGAAAAGACTGG - Intronic
951261732 3:20517575-20517597 GAACTTAGCGTCGTAAAGACAGG - Intergenic
952219849 3:31314094-31314116 GAACACAGTTTGGAAAATCCTGG + Intergenic
953136103 3:40183083-40183105 GAAGGCAGCATGGAAAAGGCAGG + Intronic
955969238 3:64420471-64420493 GAACCCAGTTTGGAAATGACAGG - Intronic
957048320 3:75393498-75393520 GACCTCTGCCTGGAAAAGCCAGG + Intergenic
957498325 3:81020150-81020172 GAAATCAGCTTGGCATAAACAGG - Intergenic
958303855 3:92038204-92038226 GAACTCATCTATGAAAAGAAAGG - Intergenic
958739884 3:98056465-98056487 GACCTCAGCCTGGAGATGACCGG - Intergenic
958907039 3:99953597-99953619 AAAGTCATCTTAGAAAAGACTGG - Intronic
959162027 3:102735520-102735542 GCTCTCAGCTTGGAAAACCCTGG - Intergenic
963164777 3:142190178-142190200 GAAGACAGGTTGGAATAGACTGG + Intronic
964224390 3:154380944-154380966 GAACCTAGGTTGGAAAACACTGG - Intronic
964653979 3:159045667-159045689 AAACACAGCTTGGAAATGACTGG + Intronic
965481846 3:169228301-169228323 GCACTGAGCTTAGAAAAAACAGG - Intronic
967413993 3:189196592-189196614 GAGAACAGCATGGAAAAGACTGG + Intronic
968239911 3:197069948-197069970 AAACTCTGCTTTGATAAGACTGG + Intronic
970323556 4:14899587-14899609 AAAGTCAGCTTAGAAAATACAGG + Intergenic
970464678 4:16310680-16310702 CAACTGAGATTGGAAAAGACTGG + Intergenic
970647925 4:18144627-18144649 GAAATCAGTTTAGAAAAGATGGG + Intergenic
971104225 4:23504517-23504539 GAAAGCAGCTAGGTAAAGACAGG - Intergenic
971928433 4:33046179-33046201 GAAATCTGCATGGAAAAAACAGG - Intergenic
974245943 4:59317811-59317833 GCTCTCAGATTGGAAGAGACAGG - Intergenic
974699500 4:65422112-65422134 GAACTGAGTTTGGAAAACACTGG - Intronic
977349903 4:95870109-95870131 CAACTCAGTATGGAAAAGAGGGG + Intergenic
979727224 4:123976912-123976934 GAATTCATCTTGGAAAAGACTGG - Intergenic
984584142 4:181543588-181543610 GAATTTAGCTGGGAAAAGGCAGG - Intergenic
985392274 4:189502660-189502682 GAACACAGAATGGAAAAGAGGGG - Intergenic
986783002 5:11084402-11084424 GTCCCCAGCTTGGAAAAGCCTGG + Intronic
988626017 5:32875571-32875593 GAAGACAACTTGGAAAAGATTGG + Intergenic
988948752 5:36236346-36236368 GAACACAACTTGGAAAACAGAGG - Intronic
989510607 5:42283079-42283101 GAACTCAGCATGGAACATAGAGG + Intergenic
991987503 5:72304955-72304977 GAACTGATCTTGAAAAATACAGG + Intronic
992663360 5:78983436-78983458 GAACTCAGATTGCAAAAGAATGG - Intronic
998013863 5:138716864-138716886 GGAATCTGCTTGTAAAAGACAGG - Intronic
998806524 5:145922290-145922312 GGAGTCAGCTTGGTAAAGAAAGG - Intergenic
999280370 5:150361258-150361280 CAACTCAGCTTGGAATAAGCTGG + Intronic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1003859550 6:10309679-10309701 GAACTCATCTCAGAAAACACAGG - Intergenic
1004042941 6:11999454-11999476 GACATCAACTTGGAAAAGATAGG - Intergenic
1007353923 6:41296338-41296360 GGACTCAGAATGGAAAAGAGTGG - Intergenic
1010206804 6:73329853-73329875 GCAATCAACTTGGAAAAGGCTGG - Intergenic
1010247116 6:73671819-73671841 GAACTCAGCATGGAAAAAGCAGG - Intergenic
1012370224 6:98496265-98496287 GCAGTAAGCTTGGAAAATACAGG - Intergenic
1013033362 6:106357808-106357830 AAATTCTGCTTGGAAAAGCCAGG + Intergenic
1013707808 6:112859514-112859536 GGACTCAGCATGGACAAGACTGG - Intergenic
1016406283 6:143734453-143734475 TAACTCCCCCTGGAAAAGACGGG - Intronic
1017528397 6:155263368-155263390 GGACTGAGTTTGGAAAAGGCTGG - Intronic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1020907060 7:14076404-14076426 GAAATAAAATTGGAAAAGACGGG + Intergenic
1022029400 7:26478798-26478820 GAACCCATCTTGGAAAATAATGG + Intergenic
1025025855 7:55515454-55515476 ACACTGAGCTTGGAGAAGACCGG - Intronic
1026262739 7:68769819-68769841 CCACTCATCTTGGAAAAGAAGGG - Intergenic
1027138595 7:75640928-75640950 GAACTCAGCTTTGACAGGAAGGG - Intronic
1027693461 7:81377440-81377462 TACCTAAGCTTGGAAAAGGCCGG + Intergenic
1027761361 7:82283204-82283226 GAACACAGAATGGAAAAGATAGG - Intronic
1028103614 7:86851190-86851212 GAACACACCTTGGAAAATGCTGG + Intronic
1028476552 7:91260157-91260179 GAACACAGTTTGGAAAATGCTGG + Intergenic
1029012972 7:97282157-97282179 GAATTCATGTGGGAAAAGACAGG - Intergenic
1032257923 7:130311746-130311768 GTACTCAGATTGGAAGAGATGGG - Intronic
1033223116 7:139541929-139541951 AACCTCAGCTTGGAAGATACTGG - Intronic
1035893493 8:3372017-3372039 GAATTCCAGTTGGAAAAGACAGG + Intronic
1041552128 8:59114937-59114959 GAACTCTGCTTGAAAATGTCAGG - Intronic
1042313304 8:67399800-67399822 CATCTGAGCTTAGAAAAGACTGG + Intergenic
1044392996 8:91674556-91674578 GAATTGCACTTGGAAAAGACTGG + Intergenic
1044625305 8:94230780-94230802 AAACTCAACTTGGAAAAGAAAGG + Intergenic
1049371688 8:142271018-142271040 GGACTCAGCAGGGGAAAGACTGG + Intronic
1050741261 9:8823421-8823443 GAAATCAGCTTGGAAACTATTGG - Intronic
1051503717 9:17805478-17805500 GAACTCACTTTGGGCAAGACTGG + Intergenic
1052304697 9:26994074-26994096 GAACGTAGTTTGGAAAACACTGG - Exonic
1053150499 9:35740011-35740033 GATCTCAGCTTGGCAGAGCCCGG - Exonic
1053236686 9:36461455-36461477 GAAAACAGCCTGGAAGAGACAGG + Intronic
1054999253 9:71429806-71429828 GCAGTCAGCATGGAAAAGAGGGG - Intronic
1055299987 9:74872667-74872689 GAAATCAGCCTGGCCAAGACAGG - Intronic
1057743132 9:97729981-97730003 GAACTCAGATAGGAGAAGACAGG + Intergenic
1057918621 9:99077105-99077127 GAAATAAGCTGGGAAAAGGCTGG + Intergenic
1058010804 9:99974733-99974755 AAATTCTGCTTGGAAAAGAAGGG + Intergenic
1059687916 9:116655589-116655611 GAAGTTAGCCTGGAAAAGGCAGG - Intronic
1185804043 X:3040605-3040627 CTCCTCAGCTTGGAAAAGAAAGG + Intergenic
1186699155 X:12070806-12070828 GAGCTCATCTTTGAAAAGACTGG - Intergenic
1187217693 X:17292947-17292969 GAATTATGCTTGGAAAGGACTGG - Intergenic
1192020833 X:67388866-67388888 GAACTCAGCTTGGAACCAAGCGG + Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1194377431 X:93152955-93152977 GAAAATAGCATGGAAAAGACTGG + Intergenic
1196804431 X:119571950-119571972 GACCTCAGCTAGGAAAAGTGAGG - Intergenic
1199023180 X:142906546-142906568 GAACACAGCTTGGGACAGAGAGG + Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic