ID: 1000973243

View in Genome Browser
Species Human (GRCh38)
Location 5:167737592-167737614
Sequence CTGGAGGTCTACAATCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000973232_1000973243 14 Left 1000973232 5:167737555-167737577 CCCGCTGAGGGTCCAGTCCTTTG 0: 1
1: 0
2: 2
3: 16
4: 165
Right 1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1000973237_1000973243 2 Left 1000973237 5:167737567-167737589 CCAGTCCTTTGGGGTATGCAGCC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1000973233_1000973243 13 Left 1000973233 5:167737556-167737578 CCGCTGAGGGTCCAGTCCTTTGG 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 198
1000973238_1000973243 -3 Left 1000973238 5:167737572-167737594 CCTTTGGGGTATGCAGCCCTCTG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000973243 Original CRISPR CTGGAGGTCTACAATCATGC TGG Intronic
900011838 1:119670-119692 CAGGAAATCTACAATCATGGCGG + Intergenic
900027941 1:296240-296262 CAGGAAATCTACAATCATGGCGG + Intergenic
900041896 1:475681-475703 CAGGAAATCTACAATCATGGCGG + Intergenic
900063334 1:710659-710681 CAGGAAATCTACAATCATGGCGG + Intergenic
901976880 1:12952265-12952287 CTGAAGTTCTAGAATGATGCAGG - Intronic
902008290 1:13249505-13249527 CTGAAGTTCTAGAATGATGCAGG + Intergenic
914323631 1:146589513-146589535 CTGGAAGGATACAAGCATGCAGG + Intergenic
916401139 1:164449716-164449738 CAGGAAGTTTACACTCATGCTGG + Intergenic
917004030 1:170391962-170391984 CAGGAAGTTTACAATCATGACGG - Intergenic
919823003 1:201484632-201484654 CTGGAGGTCTCCAAAGCTGCTGG + Exonic
920693215 1:208162577-208162599 CTGGAGATCAAGAAGCATGCAGG - Intronic
921396934 1:214678491-214678513 CTGGAGGGCTACAGTCATTCAGG + Intergenic
922260271 1:223935682-223935704 CAGGAAATCTACAATCATGGCGG + Intergenic
924341440 1:243038231-243038253 CAGGAAATCTACAATCATGGCGG + Intergenic
1063733131 10:8722221-8722243 CTGGAGCTCTAGAATAATCCTGG - Intergenic
1064398368 10:14999796-14999818 CTGGATGTCCACAATCATCTTGG + Intergenic
1064654741 10:17545925-17545947 CTGGAGGTGGACGATCATGATGG + Intergenic
1064688032 10:17884533-17884555 CAGGAAGTTTACAATCATGGTGG + Intronic
1064749159 10:18508609-18508631 CTGGAGGGCTACAATATGGCTGG - Intronic
1065264993 10:23965626-23965648 CTTGAGGTCTACAAGGATGCAGG + Intronic
1066735029 10:38467186-38467208 CAGGAAATCTACAATCATGGCGG - Intergenic
1068654093 10:59556506-59556528 CAGGAAGCCTACAATCATGGTGG - Intergenic
1069767726 10:70875899-70875921 CTGGGGGTCTCTAATCATTCAGG + Intronic
1071664648 10:87542669-87542691 CAGGAGGCTTACAATCATGACGG - Intronic
1076968168 11:111910-111932 CAGGAAATCTACAATCATGGCGG + Intergenic
1076978426 11:192649-192671 CTGGGGGTCTCCAATCAGGCAGG - Intronic
1077576984 11:3391486-3391508 CTGGATGTCCACAATCATCTTGG + Intergenic
1079160095 11:17984307-17984329 CTGGAAGCGTACAATCATGGTGG + Intronic
1080460931 11:32454361-32454383 CTGAAGGCCTACAATATTGCAGG + Intergenic
1080531933 11:33184953-33184975 CTGGAAGTCCACATTCAAGCTGG - Intergenic
1082015115 11:47479883-47479905 CAGGAGGTCTACAAACCTCCAGG + Intronic
1084197546 11:67532604-67532626 CAGGAGACCTACAATCATGGTGG - Intergenic
1084228928 11:67736284-67736306 CTGGATGTCCACAATCATCTTGG + Intergenic
1084472857 11:69373348-69373370 CTTGAGGTTTAGAGTCATGCTGG - Intergenic
1084846348 11:71903424-71903446 CTGGATGTCCACAATCATCTTGG - Intronic
1086058091 11:82671955-82671977 CTTGAGGTCTACTGTCATGGTGG - Intergenic
1089692601 11:120196221-120196243 CTGCAGGTCCACAAGAATGCAGG + Intergenic
1098170775 12:67744805-67744827 CAGGAAGCCTACAATCATGGCGG + Intergenic
1100285127 12:93157993-93158015 CTGGAGATGAACGATCATGCCGG - Intergenic
1103883012 12:124180856-124180878 CTGGAAGTCCACAATCAAGATGG - Intronic
1104261981 12:127193084-127193106 TTGGAGGTCTATATTCATGCTGG - Intergenic
1104743093 12:131193244-131193266 CTAGAGGTCTCCAGTCATGCAGG + Intergenic
1105714174 13:23045628-23045650 CAGGAAGCTTACAATCATGCAGG + Intergenic
1106420223 13:29579778-29579800 CTGGTGGACCACAAGCATGCTGG + Intronic
1106940461 13:34772463-34772485 CTGGAGGACTATAATCATTTAGG + Intergenic
1107329207 13:39280039-39280061 CAGGAGGCTTACAATCATGGTGG - Intergenic
1107545730 13:41431948-41431970 CTGGATGTCCACAATCATCTTGG + Intergenic
1107547019 13:41442958-41442980 CTGGATGTCCACAATCATCTTGG - Intergenic
1107949972 13:45452979-45453001 CAGGAAGTTTACAATCATGGTGG + Intergenic
1108769930 13:53687472-53687494 CGGGAAGCCTACAATCATGGCGG + Intergenic
1110916900 13:81031686-81031708 CAGGAGGCTTACAATCATGGTGG + Intergenic
1114878897 14:26759335-26759357 CAGGAAGTTTACAATCATGGTGG + Intergenic
1114881219 14:26788539-26788561 CTGGAAGCTTACAATCATGGCGG - Intergenic
1116715155 14:48417457-48417479 CAGGAAGTTTACAATCATGAAGG - Intergenic
1120346559 14:83298121-83298143 CTGGAGACTTACAATCATGGTGG + Intergenic
1120436870 14:84493539-84493561 CAGGAAGTCTTCAATCATGGCGG - Intergenic
1121187102 14:91983212-91983234 CAGGAGGTTTACAGTCAGGCAGG - Intronic
1122022119 14:98846716-98846738 CAGGAAGTTTACAATCATGGTGG - Intergenic
1124181812 15:27483180-27483202 CTGGAAGTCTAAAATCAAGATGG + Intronic
1127188707 15:56507032-56507054 CTGGAGCTCTCCAATCAGTCAGG - Intergenic
1128467449 15:67924846-67924868 CAGGAGGCTTACAATCATGGTGG + Intergenic
1129978266 15:79841983-79842005 CAGGAGGTCTACAATCATCCAGG + Intronic
1131679392 15:94705696-94705718 CTGGAAACTTACAATCATGCTGG - Intergenic
1132306845 15:100821317-100821339 CTAGAAATCTACAATCTTGCTGG + Intergenic
1133691574 16:8220712-8220734 CAGGAGGCTTACAATCATGGTGG - Intergenic
1135430403 16:22377675-22377697 CTAAAGGGCTAGAATCATGCAGG + Intronic
1135900228 16:26451628-26451650 CTGGAAGCTTACAATCATGGTGG + Intergenic
1140009932 16:71121336-71121358 CTGGAAGGATACAAGCATGCAGG - Intronic
1140256279 16:73338985-73339007 CTGGAAGTTTACAATGATGGTGG - Intergenic
1140711078 16:77678181-77678203 CAGGAAGTCCACAATCATGGTGG + Intergenic
1141492684 16:84385173-84385195 CAGGAGGTTTCCAATCATGGTGG + Intronic
1142129817 16:88427505-88427527 CTGCAGGTCTCCAGTCATGGTGG - Exonic
1142452510 16:90187236-90187258 CAGGAAATCTACAATCATGGCGG - Intergenic
1142465854 17:137140-137162 CTGGGGGTCTCCAATCAGGCAGG - Intergenic
1146459823 17:33037241-33037263 CTGGGGGTCTAAAATGATGCAGG + Intronic
1149392974 17:56210726-56210748 CAGGAAATCTACAATCATGGCGG + Intronic
1151415764 17:73961778-73961800 CAGGAAGTTTACAATCATGGTGG - Intergenic
1156154567 18:34286928-34286950 CTGGAAGCTTACAATCATGGTGG + Intergenic
1156211454 18:34948199-34948221 TTGGAGGTGTACAATCAAGGGGG + Intergenic
1157986793 18:52447699-52447721 CAGGAAGTTTACAATCATGGTGG + Intronic
1160644977 19:181523-181545 CAGGAAATCTACAATCATGGCGG + Intergenic
1162222670 19:9191464-9191486 CTGGATGTCCACAATCATCTTGG - Intergenic
1162224005 19:9204540-9204562 CTGGATGTCCACAATCATCTTGG - Intergenic
1162230457 19:9261642-9261664 CTGGATGTCCACAATCATCTTGG + Intergenic
1164850790 19:31482518-31482540 CAGGAAGTCTAAAATCATGGTGG + Intergenic
1166917982 19:46208783-46208805 CAGGAAATGTACAATCATGCTGG - Intergenic
927740185 2:25561746-25561768 CAGGAAGTTTACAATCATGGTGG - Intronic
936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG + Intronic
936816263 2:116464610-116464632 CAGGAGGCTTACAATCATGGTGG + Intergenic
936861801 2:117028472-117028494 CTGGAAATGTACAATCATGCCGG - Intergenic
937146116 2:119646370-119646392 CTGGAGACTTACAATCATGGCGG + Intronic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
939834510 2:147112172-147112194 CAGGAGGCTTACAATCATGGTGG - Intergenic
940337699 2:152546320-152546342 CTCGGGGTTTACAATCATGGCGG + Intronic
940871286 2:158862576-158862598 CTGGATGTCCACAATCATCTTGG - Intronic
941359091 2:164530188-164530210 CAGGAAGCTTACAATCATGCAGG + Intronic
944679346 2:202062718-202062740 CAGGAGGCTTACAATCATGGTGG - Intergenic
947386000 2:229591015-229591037 CTGGAAGCTTACAATCATGGCGG - Intronic
948966915 2:241389450-241389472 CTGGAAGTCTGCAGTCAAGCTGG - Intronic
949083952 2:242131895-242131917 CAGGAAATCTACAATCATGGCGG - Intergenic
1169313774 20:4571110-4571132 CAGGAAGTTTACAATCATGGTGG + Intergenic
1170480192 20:16757528-16757550 CAGGAAGTTTACAATCATGGTGG + Intronic
1172068665 20:32239934-32239956 CTGGAGATCTACAATGTTTCAGG - Intergenic
1174758408 20:53182339-53182361 CTGAAGCTCTAAAACCATGCTGG - Intronic
1175980661 20:62736993-62737015 CAGGAGACCTACAATCATGGTGG - Intronic
1176280537 20:64304386-64304408 CAGGAAATCTACAATCATGGCGG - Intergenic
1179813819 21:43890296-43890318 CTGGAAGTCTACCATCATGACGG - Intronic
1183488123 22:38100644-38100666 CAGGAGGCTTACAATCATGGCGG - Intronic
950673709 3:14541833-14541855 CTGGACGACTCAAATCATGCAGG + Intronic
950774994 3:15341634-15341656 CAGGAGACTTACAATCATGCTGG - Intergenic
951772524 3:26274544-26274566 CTGGAAGCTTACAATCATGGGGG - Intergenic
952243652 3:31562097-31562119 CTGGAGGCCTAAAATCAGCCTGG - Intronic
954454080 3:50587646-50587668 CTGGAGTTCTGCAGACATGCGGG + Intergenic
954947325 3:54437554-54437576 CTGAAGGCCTACCATAATGCAGG - Intronic
955012078 3:55027485-55027507 CTGGATGCCACCAATCATGCTGG - Intronic
957045514 3:75371100-75371122 CTGGATGTCCACAATCATCTTGG + Intergenic
957831701 3:85530241-85530263 CTGGGAGTTTACAATCATGGCGG - Intronic
959322288 3:104892062-104892084 CAGGAAGTTTACAATCATGGTGG - Intergenic
960403486 3:117231855-117231877 CAGGAAGTTTACAATCATGGTGG - Intergenic
960416378 3:117390005-117390027 CAGGAGGCTTACAATCATGGTGG + Intergenic
961276871 3:125734528-125734550 CTGGATGTCCACAATCATCTTGG - Intergenic
962141341 3:132793828-132793850 CAGGAAGTTTACAATCATGGTGG + Intergenic
963107265 3:141658003-141658025 CTGGAGTTCAACAACCATTCTGG + Intergenic
964664751 3:159159891-159159913 CAGGAAGTTTACAATCATGGTGG - Intronic
965077179 3:163993852-163993874 CAGGAGGCTTACAATCATGGTGG - Intergenic
966200455 3:177355980-177356002 CAGGAAGCCTACAATCATGGAGG + Intergenic
967430635 3:189381236-189381258 CAGGAAGTTTACAATCATGGTGG - Intergenic
968989792 4:3902277-3902299 CTGGATGTCCACAATCATCTTGG + Intergenic
969787341 4:9469263-9469285 CTGGATGTCCACAATCATCTTGG - Intergenic
969825522 4:9755108-9755130 CTGGATGTCCACAATCATCTTGG - Intergenic
970121516 4:12758322-12758344 AGGGAGGCCTACAATCATGGCGG + Intergenic
970237847 4:13976641-13976663 CAGGAGGCTTACAATCATGGTGG + Intergenic
971696190 4:29907032-29907054 CAGGAAGCCTACAATCATGGTGG + Intergenic
974510565 4:62834870-62834892 CAGGAAGCTTACAATCATGCTGG - Intergenic
975059133 4:69975752-69975774 CTGGAAGCTTACAATCATGGAGG + Intergenic
976013102 4:80516447-80516469 CAGGAAGTTTACAATCATGATGG + Intronic
976082185 4:81368093-81368115 GAGGAGGTTTACAATCATGGCGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979261388 4:118650135-118650157 CAGGAAATCTACAATCATGGCGG - Intergenic
980655710 4:135782190-135782212 TTGTATGTCTACAATCATGAGGG - Intergenic
982096062 4:151924563-151924585 CTGGAGGTGTACCATCAGGGAGG + Intergenic
983150449 4:164273197-164273219 CAGGAAATCTACAATCATGGCGG + Intronic
985427892 4:189847859-189847881 CTGGGGGTCCACAGTCATGCAGG + Intergenic
986691986 5:10320822-10320844 CAGGAGACCTACAATCATGGTGG + Intergenic
988042359 5:25905768-25905790 CTGGAGGTCTGAAATCAAGGTGG + Intergenic
988425507 5:31058807-31058829 CAGGAAGTTTACAATCATGGTGG - Intergenic
991352646 5:65734461-65734483 CTGAAGTTCTAGAATGATGCAGG + Intronic
994941828 5:106333670-106333692 CAGGAAGTTTACAATCATGGTGG + Intergenic
996783868 5:127217275-127217297 CTGGTGGTCTGCAAACATACTGG - Intergenic
997592893 5:135086502-135086524 CTTCAGGTCTACTTTCATGCAGG - Intronic
998605814 5:143633427-143633449 CTGGTGGTCTACAATGATTCTGG + Intergenic
998673557 5:144381518-144381540 CAGGAAGTTTACAATCATGATGG + Intronic
998756306 5:145384708-145384730 CTAGAAGTTTACAATCATGGCGG + Intergenic
999738005 5:154527094-154527116 CAGGAAATCTACAATCATGGAGG - Intergenic
1000973243 5:167737592-167737614 CTGGAGGTCTACAATCATGCTGG + Intronic
1001676644 5:173523565-173523587 CTGGAGGTCTTCATTCATCAAGG + Intergenic
1002713130 5:181206995-181207017 TTGGAGCTCTTCAAACATGCTGG - Intergenic
1002731947 5:181343248-181343270 CAGGAAATCTACAATCATGGCGG - Intergenic
1002752584 6:130856-130878 CAGGAAATCTACAATCATGGCGG + Intergenic
1003323618 6:5075090-5075112 CAGGAAGCCTACAATCATGGCGG - Intergenic
1003977922 6:11361375-11361397 CAGGAGGCTTACAATCATGGCGG + Intronic
1004024839 6:11808192-11808214 CTGGAAGCTTACAATCATGGTGG - Intergenic
1004096140 6:12556366-12556388 CAGGAAGCCTACAATCATGGTGG - Intergenic
1004762119 6:18678609-18678631 CAGGAAGTTTACAATCATGGTGG - Intergenic
1005228644 6:23672764-23672786 CAGGAGGCTTACAATCATGGTGG + Intergenic
1012235126 6:96805231-96805253 CAGGAGGCTTACAATCATGGTGG + Intronic
1012397684 6:98818769-98818791 CAGGAAGTTTACAATCATGGTGG + Intergenic
1013714150 6:112937609-112937631 CTGGAAGCTTACAATCATGGTGG - Intergenic
1014241071 6:119017961-119017983 CAGGAAGCTTACAATCATGCTGG - Intronic
1014415728 6:121181453-121181475 CAGGAAATCTACAATCATGGCGG - Intronic
1014935830 6:127383715-127383737 CAGGAAGTTTACAATCATGGTGG + Intergenic
1016421728 6:143892192-143892214 CAGGAAGTCTCCAATCATGATGG + Intronic
1017018904 6:150124372-150124394 CTGGAAACTTACAATCATGCTGG + Intergenic
1017539177 6:155382637-155382659 CAGAGGGTTTACAATCATGCAGG - Intergenic
1019236198 6:170615565-170615587 CAGGAAATCTACAATCATGGCGG - Intergenic
1020312608 7:6880317-6880339 CTGGATGTCCACAATCATCTTGG + Intergenic
1028032559 7:85933900-85933922 CAGGAAGTTTACAATCATGGTGG - Intergenic
1028398001 7:90393216-90393238 CGGGAAGCTTACAATCATGCTGG - Intronic
1028535345 7:91885728-91885750 CAGGAAGTTTACAATCATGGTGG + Intergenic
1029080151 7:97966766-97966788 CTGGATGTCCACAATCATCTTGG + Intergenic
1031228890 7:119078931-119078953 CTACAGATCTACAATAATGCAGG + Intergenic
1031575887 7:123415359-123415381 CGGGAGGTCTACATTCATATTGG + Intergenic
1032192698 7:129773672-129773694 CTGGTGGTCAGCAATCAAGCAGG - Intergenic
1032252423 7:130269781-130269803 CTGCACGTCTTCAATCATGATGG - Exonic
1035511572 8:191036-191058 CAGGAAATCTACAATCATGGCGG + Intergenic
1040665300 8:49624289-49624311 CAGGAAACCTACAATCATGCTGG - Intergenic
1042515822 8:69657804-69657826 CTGCAGGGCTACAGTCATCCTGG + Intronic
1043362455 8:79491204-79491226 CTGGAAGCTTACAATCATGGCGG + Intergenic
1045770130 8:105727268-105727290 CTGTAGGACTATGATCATGCCGG + Intronic
1045996129 8:108364374-108364396 CAGGAAGTTTACAATCATGGTGG + Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1046822056 8:118644462-118644484 CAGGAGGCTTACAATCATGGTGG - Intergenic
1046876341 8:119258957-119258979 CAGGAGGCTTACAATCATGGTGG + Intergenic
1047041302 8:120999105-120999127 CAGGAAGTCTCCAATCATGGTGG - Intergenic
1049024107 8:139976938-139976960 CTGGAAGTTTCCAATCCTGCAGG + Intronic
1050932205 9:11343994-11344016 CTATAGGTCTACACTAATGCTGG + Intergenic
1051144575 9:14013000-14013022 CTGGGGATCTACAATGAAGCAGG + Intergenic
1056148821 9:83764382-83764404 CAGGAGGCTTACAATCATGGTGG - Intronic
1059917437 9:119118929-119118951 CAGGAAGTTTACAATCATGGCGG - Intergenic
1060104985 9:120868040-120868062 CTGGAGATGTGCAATCAGGCAGG - Intronic
1062756349 9:138295583-138295605 CAGGAAATCTACAATCATGGCGG - Intergenic
1188009436 X:25040896-25040918 CAGGAAGCCTACAATCATGGTGG + Intergenic
1192404812 X:70874137-70874159 CTGGAAGTTTCCAATCATGTTGG - Intronic
1194280079 X:91940194-91940216 CTGGAGGCTTACAATCATGGCGG - Intronic
1194451221 X:94046578-94046600 CTGGAGCTGTTCATTCATGCCGG - Intergenic
1194568252 X:95520828-95520850 CAGGAAATCTACAATCATGGTGG + Intergenic
1194680234 X:96843242-96843264 CTGGAAGCTTACAATCATGGTGG - Intronic
1195585969 X:106566021-106566043 CTGAAAGTCTACAGTCCTGCAGG - Intergenic
1197061211 X:122184057-122184079 GGGGAGGTCCACAATCATGGTGG + Intergenic
1200315367 X:155127036-155127058 CAGGAGGCTTACAATCATGGTGG - Intronic
1200597554 Y:5163695-5163717 CTGGAGGCTTACAATCATGGCGG - Intronic
1201505458 Y:14694631-14694653 CTGGAACTCCACAAGCATGCTGG - Intronic
1201569440 Y:15398497-15398519 CAGGAGGCTTACAATCATGGTGG - Intergenic