ID: 1000977780

View in Genome Browser
Species Human (GRCh38)
Location 5:167783720-167783742
Sequence ACCCTTCAGATACTGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977780_1000977782 3 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977782 5:167783746-167783768 TTGCCTACCAGCAAATCGCTTGG No data
1000977780_1000977787 28 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977780_1000977785 14 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977785 5:167783757-167783779 CAAATCGCTTGGTCCTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977780 Original CRISPR ACCCTTCAGATACTGGCTGA TGG (reversed) Intronic