ID: 1000977781

View in Genome Browser
Species Human (GRCh38)
Location 5:167783727-167783749
Sequence GCAAAGAACCCTTCAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977781_1000977788 26 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977788 5:167783776-167783798 GAGGAATCACACAGATGGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 184
1000977781_1000977787 21 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977781_1000977782 -4 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977782 5:167783746-167783768 TTGCCTACCAGCAAATCGCTTGG No data
1000977781_1000977785 7 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977785 5:167783757-167783779 CAAATCGCTTGGTCCTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 72
1000977781_1000977789 27 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977781 Original CRISPR GCAAAGAACCCTTCAGATAC TGG (reversed) Intronic