ID: 1000977782

View in Genome Browser
Species Human (GRCh38)
Location 5:167783746-167783768
Sequence TTGCCTACCAGCAAATCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977780_1000977782 3 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977782 5:167783746-167783768 TTGCCTACCAGCAAATCGCTTGG No data
1000977781_1000977782 -4 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977782 5:167783746-167783768 TTGCCTACCAGCAAATCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977782 Original CRISPR TTGCCTACCAGCAAATCGCT TGG Intronic