ID: 1000977782 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:167783746-167783768 |
Sequence | TTGCCTACCAGCAAATCGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1000977780_1000977782 | 3 | Left | 1000977780 | 5:167783720-167783742 | CCATCAGCCAGTATCTGAAGGGT | 0: 1 1: 0 2: 0 3: 10 4: 161 |
||
Right | 1000977782 | 5:167783746-167783768 | TTGCCTACCAGCAAATCGCTTGG | No data | ||||
1000977781_1000977782 | -4 | Left | 1000977781 | 5:167783727-167783749 | CCAGTATCTGAAGGGTTCTTTGC | 0: 1 1: 0 2: 0 3: 11 4: 163 |
||
Right | 1000977782 | 5:167783746-167783768 | TTGCCTACCAGCAAATCGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1000977782 | Original CRISPR | TTGCCTACCAGCAAATCGCT TGG | Intronic | ||