ID: 1000977783

View in Genome Browser
Species Human (GRCh38)
Location 5:167783749-167783771
Sequence GGACCAAGCGATTTGCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977783_1000977793 27 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977793 5:167783799-167783821 GAGCCCTGGGCTCCCTCCCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434
1000977783_1000977792 26 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977792 5:167783798-167783820 GGAGCCCTGGGCTCCCTCCCAGG 0: 1
1: 1
2: 5
3: 89
4: 617
1000977783_1000977787 -1 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977783_1000977790 13 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977790 5:167783785-167783807 CACAGATGGTGTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 29
4: 289
1000977783_1000977791 14 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977791 5:167783786-167783808 ACAGATGGTGTGGGAGCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 229
1000977783_1000977788 4 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977788 5:167783776-167783798 GAGGAATCACACAGATGGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 184
1000977783_1000977789 5 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977783 Original CRISPR GGACCAAGCGATTTGCTGGT AGG (reversed) Intronic