ID: 1000977784

View in Genome Browser
Species Human (GRCh38)
Location 5:167783753-167783775
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977784_1000977789 1 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
1000977784_1000977791 10 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977791 5:167783786-167783808 ACAGATGGTGTGGGAGCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 229
1000977784_1000977788 0 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977788 5:167783776-167783798 GAGGAATCACACAGATGGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 184
1000977784_1000977792 22 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977792 5:167783798-167783820 GGAGCCCTGGGCTCCCTCCCAGG 0: 1
1: 1
2: 5
3: 89
4: 617
1000977784_1000977790 9 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977790 5:167783785-167783807 CACAGATGGTGTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 29
4: 289
1000977784_1000977793 23 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977793 5:167783799-167783821 GAGCCCTGGGCTCCCTCCCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434
1000977784_1000977787 -5 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977784 Original CRISPR AGCAGGACCAAGCGATTTGC TGG (reversed) Intronic