ID: 1000977785

View in Genome Browser
Species Human (GRCh38)
Location 5:167783757-167783779
Sequence CAAATCGCTTGGTCCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977780_1000977785 14 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977785 5:167783757-167783779 CAAATCGCTTGGTCCTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 72
1000977781_1000977785 7 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977785 5:167783757-167783779 CAAATCGCTTGGTCCTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977785 Original CRISPR CAAATCGCTTGGTCCTGCTG AGG Intronic