ID: 1000977787

View in Genome Browser
Species Human (GRCh38)
Location 5:167783771-167783793
Sequence CTGCTGAGGAATCACACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977781_1000977787 21 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977780_1000977787 28 Left 1000977780 5:167783720-167783742 CCATCAGCCAGTATCTGAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977783_1000977787 -1 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
1000977784_1000977787 -5 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977787 5:167783771-167783793 CTGCTGAGGAATCACACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977787 Original CRISPR CTGCTGAGGAATCACACAGA TGG Intronic