ID: 1000977789

View in Genome Browser
Species Human (GRCh38)
Location 5:167783777-167783799
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977783_1000977789 5 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
1000977784_1000977789 1 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
1000977781_1000977789 27 Left 1000977781 5:167783727-167783749 CCAGTATCTGAAGGGTTCTTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1000977789 5:167783777-167783799 AGGAATCACACAGATGGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type