ID: 1000977790

View in Genome Browser
Species Human (GRCh38)
Location 5:167783785-167783807
Sequence CACAGATGGTGTGGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977784_1000977790 9 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977790 5:167783785-167783807 CACAGATGGTGTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 29
4: 289
1000977786_1000977790 -8 Left 1000977786 5:167783770-167783792 CCTGCTGAGGAATCACACAGATG 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1000977790 5:167783785-167783807 CACAGATGGTGTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 29
4: 289
1000977783_1000977790 13 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977790 5:167783785-167783807 CACAGATGGTGTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 29
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977790 Original CRISPR CACAGATGGTGTGGGAGCCC TGG Intronic