ID: 1000977793 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:167783799-167783821 |
Sequence | GAGCCCTGGGCTCCCTCCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 485 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 45, 4: 434} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1000977783_1000977793 | 27 | Left | 1000977783 | 5:167783749-167783771 | CCTACCAGCAAATCGCTTGGTCC | 0: 1 1: 0 2: 0 3: 4 4: 35 |
||
Right | 1000977793 | 5:167783799-167783821 | GAGCCCTGGGCTCCCTCCCAGGG | 0: 1 1: 0 2: 5 3: 45 4: 434 |
||||
1000977784_1000977793 | 23 | Left | 1000977784 | 5:167783753-167783775 | CCAGCAAATCGCTTGGTCCTGCT | 0: 1 1: 0 2: 1 3: 4 4: 85 |
||
Right | 1000977793 | 5:167783799-167783821 | GAGCCCTGGGCTCCCTCCCAGGG | 0: 1 1: 0 2: 5 3: 45 4: 434 |
||||
1000977786_1000977793 | 6 | Left | 1000977786 | 5:167783770-167783792 | CCTGCTGAGGAATCACACAGATG | 0: 1 1: 0 2: 2 3: 10 4: 171 |
||
Right | 1000977793 | 5:167783799-167783821 | GAGCCCTGGGCTCCCTCCCAGGG | 0: 1 1: 0 2: 5 3: 45 4: 434 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1000977793 | Original CRISPR | GAGCCCTGGGCTCCCTCCCA GGG | Intronic | ||