ID: 1000977793

View in Genome Browser
Species Human (GRCh38)
Location 5:167783799-167783821
Sequence GAGCCCTGGGCTCCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000977783_1000977793 27 Left 1000977783 5:167783749-167783771 CCTACCAGCAAATCGCTTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1000977793 5:167783799-167783821 GAGCCCTGGGCTCCCTCCCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434
1000977784_1000977793 23 Left 1000977784 5:167783753-167783775 CCAGCAAATCGCTTGGTCCTGCT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1000977793 5:167783799-167783821 GAGCCCTGGGCTCCCTCCCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434
1000977786_1000977793 6 Left 1000977786 5:167783770-167783792 CCTGCTGAGGAATCACACAGATG 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1000977793 5:167783799-167783821 GAGCCCTGGGCTCCCTCCCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000977793 Original CRISPR GAGCCCTGGGCTCCCTCCCA GGG Intronic