ID: 1000980513

View in Genome Browser
Species Human (GRCh38)
Location 5:167811971-167811993
Sequence CACAAGGACGTCATTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000980512_1000980513 -10 Left 1000980512 5:167811958-167811980 CCTAGAGCACATACACAAGGACG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1000980513 5:167811971-167811993 CACAAGGACGTCATTTCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000980513 Original CRISPR CACAAGGACGTCATTTCAGC TGG Intronic
900204350 1:1425775-1425797 CACAAAGACCTCATTTCAAAGGG - Intergenic
905400913 1:37702595-37702617 CACAAGGACAGAATTCCAGCTGG + Intronic
907815062 1:57910632-57910654 CACAAGGCTGTCATTTCCACTGG + Intronic
912821669 1:112872651-112872673 CATAAGGCCCTCATTTCAGAGGG + Intergenic
913688727 1:121258144-121258166 CACAAGGAGGCAATTTCAGAAGG - Intronic
914148873 1:145022132-145022154 CACAAGGAGGCAATTTCAGAAGG + Intronic
914228899 1:145746433-145746455 CAAAAGGACTTTATATCAGCAGG + Exonic
920476050 1:206276644-206276666 CACAAGGAGGCAATTTCAGAAGG - Intronic
922866911 1:228868216-228868238 CCCAAGGATGTGATTTCTGCAGG + Intergenic
923343292 1:233025671-233025693 CAGAAGAACATCATTTCAGTGGG + Intronic
924300050 1:242627793-242627815 CACAAGTATGACATTTGAGCTGG - Intergenic
1073901305 10:108224349-108224371 CACAAAGAGGTCATTGCAGCTGG - Intergenic
1076903976 10:133353159-133353181 CACATGCACGTCCGTTCAGCTGG - Intergenic
1078257642 11:9673682-9673704 CACAAGACCTTCATTTCAGAAGG - Intronic
1080437948 11:32263524-32263546 CACAAGGAGGTCTGTTCAGTTGG - Intergenic
1082870038 11:57935825-57935847 AACAGGGAAATCATTTCAGCTGG - Intergenic
1083942362 11:65903287-65903309 CACAAGGAGGTCCTTTCAGAGGG + Intergenic
1084801720 11:71548426-71548448 CACAAGGAAATCATCTCAGGAGG + Exonic
1085420481 11:76354096-76354118 AACAAGGAGGGCATTTCAGTTGG + Intronic
1088548397 11:110985233-110985255 CAAAAGGACATCATTTCATTGGG + Intergenic
1096411415 12:51379474-51379496 CAGAAGGGCTTCAGTTCAGCTGG + Exonic
1097226835 12:57481918-57481940 CACATGGAAATCATTTGAGCTGG - Intronic
1100931109 12:99610377-99610399 CACAAGACCCTCATTTCAGAAGG - Intronic
1118101969 14:62616551-62616573 CACAGTGACCTCATTTCAACTGG - Intergenic
1120948204 14:90017491-90017513 CACAAGGACAGCCTTTCAGATGG - Intronic
1131180341 15:90234733-90234755 CAAAAGGACGGCAGGTCAGCTGG - Intronic
1133108238 16:3528167-3528189 AACAAGGCCATCAATTCAGCAGG - Intronic
1138873071 16:60916460-60916482 GACAATGGCCTCATTTCAGCAGG + Intergenic
1139962204 16:70724474-70724496 CACAAGGTCATCTTTTCACCTGG + Intronic
1146122137 17:30204986-30205008 CTCAGGCACGACATTTCAGCAGG + Intronic
1151237960 17:72735281-72735303 CACAGGGGCTCCATTTCAGCTGG + Intronic
1155177008 18:23309763-23309785 CACAAGGTCATCATACCAGCAGG + Intronic
1156982105 18:43301656-43301678 GAAAAGGAAGTCACTTCAGCAGG - Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
925966915 2:9074975-9074997 CACAAGGACAACATATCACCTGG - Intergenic
929049972 2:37828157-37828179 CACAAGGACCTCATTATAACAGG - Intergenic
930831809 2:55752114-55752136 TACAAGGACATCATTTGTGCTGG - Intergenic
934776998 2:96945676-96945698 CAGAAGGAAGTCATTTCCTCAGG - Intronic
936662000 2:114553178-114553200 CACAAGGACATCCTTTATGCCGG + Intronic
939858214 2:147386510-147386532 CATAATGAGGTCATTTCAGTGGG + Intergenic
949001778 2:241618941-241618963 CACCAGGACCTCATCTCAGCTGG + Intronic
1170123169 20:12933720-12933742 CACAAAGAGGTCATTCCAGCTGG - Intergenic
1174379178 20:50145858-50145880 CAAAAGGACATCACTTCAGCAGG - Intronic
1176365279 21:6029085-6029107 CCCAAGGAGGTCATGCCAGCTGG + Intergenic
1179758239 21:43509460-43509482 CCCAAGGAGGTCATGCCAGCTGG - Intergenic
1180028385 21:45182300-45182322 CTCAAGGAAGTCATTTCCTCTGG - Intronic
949800651 3:7900490-7900512 CACAAGGAAGTCAACTCACCAGG + Intergenic
953818552 3:46183625-46183647 CACACACACGTAATTTCAGCGGG - Intronic
955050441 3:55405564-55405586 CCCAAGGACATCACTGCAGCTGG + Intergenic
961562473 3:127740293-127740315 AACAAGGACCGCGTTTCAGCTGG - Intronic
962956936 3:140275197-140275219 AACAAGGATGTGATTTCAGGTGG - Intronic
967350056 3:188504826-188504848 CCCATGGAAGTCACTTCAGCTGG + Intronic
969279881 4:6162567-6162589 CACAAGGCAGTCATGTCAACAGG + Intronic
969688976 4:8693724-8693746 CAGAAGGAAGGCATATCAGCCGG - Intergenic
971248705 4:24953338-24953360 CTCCTGGAAGTCATTTCAGCTGG - Intronic
976705928 4:88018978-88019000 AACAAGGACTTCTTTTCATCAGG + Intronic
977145946 4:93440026-93440048 CACAAGGAGGCCATTTCCTCTGG - Intronic
983258653 4:165431367-165431389 CAAAAGGACGTCAGTTCTGCCGG - Intronic
992531537 5:77656730-77656752 GACAAAGAGGTCAATTCAGCAGG - Intergenic
994792798 5:104252463-104252485 CATAAAGAGGTCAATTCAGCTGG - Intergenic
999852488 5:155557716-155557738 CATAAGTACGTCATGTCAGTGGG + Intergenic
1000980513 5:167811971-167811993 CACAAGGACGTCATTTCAGCTGG + Intronic
1002913991 6:1514271-1514293 CCCAATGACGTCATTACAACAGG + Intergenic
1012228621 6:96734490-96734512 CACAATGTAATCATTTCAGCAGG + Intergenic
1014551103 6:122790040-122790062 CACGGGGACTTCATTTCACCTGG + Intronic
1016154899 6:140793405-140793427 CACAAGGACATCACATGAGCAGG - Intergenic
1019651021 7:2158661-2158683 CAACAGGGCGTCATGTCAGCCGG + Intronic
1021990982 7:26141407-26141429 CACAAGCAAGTCATTTTAGAAGG - Intergenic
1026688437 7:72532534-72532556 CACAAGGACCTCGTGACAGCTGG + Intergenic
1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG + Intergenic
1044538956 8:93389163-93389185 CAGAAAGACATCATTTTAGCTGG + Intergenic
1047710736 8:127549866-127549888 CTCAAAGACGTCATTTCCTCAGG - Intergenic
1050058010 9:1676059-1676081 CAGAAGGATGACATTGCAGCTGG + Intergenic
1050615694 9:7399642-7399664 CACAGGGCCACCATTTCAGCAGG - Intergenic
1052634327 9:31082036-31082058 CATAGGGAGGTCTTTTCAGCTGG - Intergenic
1059815500 9:117908395-117908417 CCCCAGGAAGTCACTTCAGCTGG - Intergenic
1188559718 X:31453912-31453934 CACAAATAAGTCATTTAAGCAGG + Intronic
1190313969 X:49137647-49137669 CACAATGACCTCATTCCACCAGG - Intergenic
1192221005 X:69197328-69197350 CACAAGTACACCATTACAGCTGG + Intergenic
1192268119 X:69554422-69554444 CACAAGGAAGTGAATTCTGCCGG + Intergenic
1193294859 X:79822145-79822167 CACCAGGGTGTCATTTCATCTGG + Intergenic
1200979979 Y:9254738-9254760 CACAAATAGATCATTTCAGCTGG - Intergenic