ID: 1000992471

View in Genome Browser
Species Human (GRCh38)
Location 5:167925091-167925113
Sequence GCTTCTCAGTAACCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000992471 Original CRISPR GCTTCTCAGTAACCCCAAGC TGG Intronic
900776956 1:4592765-4592787 GCTTCTCTGTAACTCCCACCTGG + Intergenic
901647845 1:10726322-10726344 GTTGGTCAGTAGCCCCAAGCTGG - Intronic
907207335 1:52784873-52784895 TCATCCCAGTAACCACAAGCTGG - Exonic
907272172 1:53297564-53297586 GCTTCTCAGTCTCCCCAGGTGGG - Intronic
907426166 1:54380569-54380591 GCTTCTCAGGAAGCCGAAGCTGG - Intronic
907716745 1:56933241-56933263 ACTTCTCAGTAAACAGAAGCAGG + Intronic
915528806 1:156491647-156491669 GCTGCTCAGTAACCACAAGCAGG - Intronic
916543164 1:165777004-165777026 GCTTCTCAGGAAGCTGAAGCAGG + Intronic
921282153 1:213577990-213578012 CCTTCACAGCAGCCCCAAGCTGG + Intergenic
922161238 1:223080464-223080486 GCTTCTCAGTACAGCCAAGGTGG - Intergenic
922854001 1:228758393-228758415 GCTTCTCAGAAGCCCTGAGCAGG + Intergenic
1064079221 10:12294796-12294818 GTTTCTCAGTAACAGCATGCTGG + Intergenic
1065123105 10:22546965-22546987 GCTTCTCAGAAACCACCTGCTGG + Intronic
1066393545 10:34998049-34998071 GCTTCCCAGTCTCCCCAGGCTGG + Intergenic
1066972490 10:42324871-42324893 GCTTTTCAGTAAGCCAAAGGGGG + Intergenic
1069812839 10:71175138-71175160 GCTTCACAGTGGCCCCAAGCTGG - Intergenic
1070803696 10:79257986-79258008 TCTTCACAGCAACCCCAAGAAGG + Intronic
1073140985 10:101247578-101247600 GGTCTTCAGTAACCCCATGCTGG + Intergenic
1074737846 10:116454228-116454250 GCTACTCAGTAAGCTGAAGCAGG - Intronic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1078443868 11:11389649-11389671 TCTTCTCAGTACTCCTAAGCTGG - Intronic
1078653802 11:13219822-13219844 GCTTCTTAGCCACCTCAAGCAGG + Intergenic
1079100754 11:17540542-17540564 CCTTCTCAGTCACCTCTAGCAGG + Intronic
1081091303 11:38869037-38869059 GCTACTCAGGAACCTGAAGCAGG - Intergenic
1081334113 11:41842862-41842884 GGGTCTCAGGCACCCCAAGCTGG + Intergenic
1083303925 11:61753142-61753164 GCTTCCCCAGAACCCCAAGCGGG + Intronic
1083653151 11:64215805-64215827 ACTTCTCAGGAAGCCGAAGCGGG - Intronic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG + Intergenic
1087717212 11:101622171-101622193 GCTACTCAGGAAGCCAAAGCAGG + Intronic
1090457624 11:126863801-126863823 GCTTCTGGGGAACCCCAAGTAGG + Intronic
1091178865 11:133585155-133585177 CCTTGCCACTAACCCCAAGCCGG - Intergenic
1091268458 11:134288789-134288811 GTTTCTCAGTACCGCCAGGCAGG + Exonic
1092294705 12:7189171-7189193 GCTTCCAAATAACCCCTAGCGGG - Intronic
1092330634 12:7583803-7583825 GCAGCTCAGTAATGCCAAGCTGG + Intergenic
1092766528 12:11857988-11858010 GCTTCTGAGCAACACCAGGCAGG - Intronic
1095663117 12:44761244-44761266 GCTCCCAAGTAATCCCAAGCTGG - Intronic
1096255119 12:50057951-50057973 GCTCCTCGGTACCCCGAAGCCGG + Intronic
1096568339 12:52500058-52500080 TATTCACAGTAACCCCAAACTGG - Intergenic
1109654757 13:65374906-65374928 GCTTCTGATTACACCCAAGCAGG - Intergenic
1110936320 13:81294180-81294202 ACTTGTCAGTAACCCCAAAAAGG - Intergenic
1114579989 14:23748529-23748551 GCTTCCCCTAAACCCCAAGCAGG + Intergenic
1114849958 14:26371930-26371952 ACTTCTCAGTAACCACGAACGGG - Intergenic
1118922639 14:70163952-70163974 TCTTCATAGTAACCCCAAACTGG + Intronic
1119074151 14:71619196-71619218 GCTTTCCAGTAGCCCTAAGCAGG - Intronic
1121119073 14:91364596-91364618 TCTTATCAGTCACCCCAAGGGGG + Intronic
1123416458 15:20099224-20099246 GCTACTCAGGAGGCCCAAGCAGG - Intergenic
1123525796 15:21106329-21106351 GCTACTCAGGAGGCCCAAGCAGG - Intergenic
1124250324 15:28102709-28102731 GCTTCTCAGTAAGCTGAGGCAGG - Intergenic
1124459595 15:29877326-29877348 GCTACTCAGGACCCCGAAGCAGG - Intronic
1125629853 15:41138403-41138425 GCTACTCAGGAAGCCGAAGCAGG - Intergenic
1126614730 15:50565933-50565955 GCTACTCAGTAAGCCAAGGCAGG - Intronic
1126881351 15:53101672-53101694 TATTCACAATAACCCCAAGCTGG + Intergenic
1127882624 15:63171573-63171595 GCTCCTCAAAAACCCCAAGAGGG - Intergenic
1133215656 16:4290726-4290748 GCTTCTCAGTGTCCACAAGGAGG + Intergenic
1134097486 16:11428281-11428303 GCTACTCAGGAAGCTCAAGCAGG - Intronic
1139399803 16:66672291-66672313 GCTTCTCAGTAGGCTGAAGCAGG + Intronic
1139605073 16:68012522-68012544 GCTACTCAGGAACCTCAGGCAGG - Intronic
1146013112 17:29211713-29211735 GCTTTGCAGTACCCCTAAGCAGG - Intergenic
1148061227 17:44837942-44837964 GCTACTCAGGAGCCCGAAGCAGG - Intergenic
1148817696 17:50342279-50342301 GCTTCTCAGGAAGCTGAAGCGGG + Intergenic
1151940375 17:77288130-77288152 CCTTCTCTGAAACCCCAGGCCGG - Intronic
1153177548 18:2395415-2395437 GCATATCAGTAAAACCAAGCTGG + Intergenic
1153582724 18:6591217-6591239 TCTTCTCAGTAACCCTATGAAGG + Intergenic
1158467752 18:57706366-57706388 GATTATCAGTAGCCCCAGGCAGG + Intronic
1160003955 18:75054308-75054330 GCTTCTCAGTAACCGCACAGAGG - Intronic
1160832440 19:1110082-1110104 GATCCTAGGTAACCCCAAGCAGG + Intronic
1163301396 19:16449160-16449182 GCTACTCAGGAAGCCAAAGCAGG + Intronic
1163612542 19:18308848-18308870 GCCTCGCAGTAACCCCCACCAGG - Intronic
1164019115 19:21281599-21281621 GCTTTTCAGTAAACCCAATGGGG + Intronic
1164223227 19:23216303-23216325 GCTTTTCAGTAAACCCAATGGGG + Intergenic
1166052664 19:40269656-40269678 TATTCACAGTAACCCCAAACTGG + Intronic
1166419085 19:42620762-42620784 GCTTCTCAGGGACTCCCAGCAGG + Intronic
1167275405 19:48535547-48535569 GAGTCTCTGTCACCCCAAGCTGG + Intergenic
1168392063 19:56017331-56017353 GCTACTCACTAACCCCAAAAGGG + Intronic
925058681 2:874435-874457 GCTGCTCAGTGACCCAGAGCTGG - Intergenic
925076932 2:1024479-1024501 GCTACTCAGGAAGCCGAAGCAGG - Intronic
926139829 2:10361826-10361848 GCTACTCAGGAAGCCGAAGCAGG - Intronic
926714493 2:15913480-15913502 GCTTCTCAAGAACCCCACGTTGG - Intergenic
928257743 2:29739125-29739147 GCTTCTCAGGAGCCTGAAGCAGG + Intronic
930116966 2:47726344-47726366 GCTACTCAGTAGGCCAAAGCAGG - Intronic
930120939 2:47760198-47760220 GCTTTTCAGTAAACACAAGGAGG + Intronic
932006952 2:67936910-67936932 GCTACTCAGGAAGCCGAAGCAGG + Intergenic
934459144 2:94201882-94201904 CCTGCTCAGCAACCCCAGGCAGG + Intergenic
934517238 2:94996389-94996411 GCCTTTGAGTAAGCCCAAGCAGG + Intergenic
934581253 2:95441740-95441762 GAGTGTCAGTAACCACAAGCTGG + Intergenic
934598197 2:95634974-95634996 GAGTGTCAGTAACCACAAGCTGG - Intergenic
934922593 2:98357992-98358014 AATCCTCAGTAACCCCAAGAGGG - Intronic
936402259 2:112174298-112174320 GTTTCTCAGTAACCTCAGCCTGG - Intronic
941054868 2:160776486-160776508 GTTGCTCAGCAACCCCATGCAGG - Intergenic
946646894 2:221846962-221846984 GCTTCCCAGGGAACCCAAGCTGG + Intergenic
948300053 2:236898915-236898937 GCTGCTCAGTCTCCGCAAGCTGG - Intergenic
1173332927 20:42090326-42090348 TCTTCACAGCTACCCCAAGCTGG - Intronic
1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG + Intergenic
1176021027 20:62962542-62962564 GCCTCTCAGAAACCCCACCCTGG - Intronic
1179091274 21:38268033-38268055 GCTTCTCAGAAAACTGAAGCGGG - Intronic
1179875869 21:44267095-44267117 GCTTCTCAGAAACTTCACGCAGG - Intergenic
1179907762 21:44433094-44433116 GCTTCTCAGTCAGCCTGAGCGGG - Intronic
1183698226 22:39435332-39435354 GCTTCACAGGAAACCCCAGCAGG + Intronic
1184685208 22:46093673-46093695 GCCTCAAAGGAACCCCAAGCAGG - Intronic
950172529 3:10848986-10849008 TCTGCACAGTAACTCCAAGCTGG - Intronic
951421376 3:22489789-22489811 GCTTCTCAGTTTCTCCAAACTGG - Intergenic
952385820 3:32840873-32840895 CCTTCTCAGTCACCCCGGGCTGG + Intronic
952859435 3:37800717-37800739 TCTTTTTAATAACCCCAAGCTGG + Intronic
952977453 3:38708297-38708319 GTTTCTCAGTGACCCCAGCCTGG + Intronic
953326894 3:42019385-42019407 GCTACTCAGGAAGCCAAAGCGGG - Intronic
953946839 3:47156644-47156666 GCATCTCAGTAGCCCAAAGAAGG + Intronic
954257570 3:49417261-49417283 GCTTCTCATTACCCTCCAGCAGG + Exonic
955407209 3:58633095-58633117 CCTTCTCAGAAACCTCAGGCAGG + Intergenic
957154250 3:76527506-76527528 GCTCCTCAGTGACCCAAACCAGG + Intronic
963162039 3:142160828-142160850 GCTACTCAGGAAACCGAAGCAGG - Intergenic
967775688 3:193383665-193383687 AGTTCTCTGTGACCCCAAGCAGG - Intergenic
968235436 3:197028186-197028208 GCTTCTCAGCTACCCCCACCTGG + Intronic
973646511 4:52956073-52956095 GCATCTCAGAGACCTCAAGCTGG - Intronic
975864316 4:78710501-78710523 GCTTTACAGTAACCCCAAAATGG - Intergenic
976517428 4:85984931-85984953 GCTACTCAGGAAGCCCAGGCAGG - Intronic
977660068 4:99574855-99574877 ACTTCTCAGTGACTCCTAGCTGG + Exonic
983199883 4:164849887-164849909 GCTACTCAGTAACCTGAGGCAGG + Intergenic
991291838 5:65040850-65040872 GCTTCTAGGAAACCCCAAGATGG - Intergenic
993656801 5:90587667-90587689 GCTTCTCAGGAAGCTGAAGCAGG - Intronic
996265480 5:121534691-121534713 GGTGCTCACTAACCCCATGCAGG - Intergenic
997250445 5:132384840-132384862 GCTTCTCAGTGACAACAGGCTGG - Intronic
1000212070 5:159116551-159116573 GCTACTCAGTAGCCCGAGGCAGG - Intergenic
1000992471 5:167925091-167925113 GCTTCTCAGTAACCCCAAGCTGG + Intronic
1001125344 5:169014043-169014065 GCTTCTCTGTAATACCAGGCAGG - Intronic
1005813123 6:29531122-29531144 GCTTCTCAGTTCCCCCATGGAGG - Intergenic
1005816945 6:29561164-29561186 CCCTCACAGTAACCCCATGCTGG - Intronic
1006900278 6:37495912-37495934 GCTTCTCAGTTGCCCCCAGCGGG - Intronic
1007389832 6:41544762-41544784 TCTTCACAGTAACCCCAGGAGGG - Intergenic
1008595368 6:53036525-53036547 GCTACTCAGGAAGCCGAAGCAGG - Intronic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1016388261 6:143549553-143549575 GCTGCTGAGTACCCCCCAGCAGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019651876 7:2164070-2164092 GCTTCTCAGTGAGTCCATGCTGG - Intronic
1022041913 7:26589551-26589573 GCTTCTCCATAACCCCTAGATGG + Intergenic
1023884627 7:44344560-44344582 GATACTCAGTAACCCCAAGCAGG - Intergenic
1026631871 7:72044721-72044743 GCTACTCAGGAACCTGAAGCAGG - Intronic
1026915510 7:74117696-74117718 GCTACTCAGGAAGCCAAAGCGGG + Intronic
1028725308 7:94080425-94080447 TAGTCTCAGTAACCCCAAACAGG - Intergenic
1033710152 7:143934552-143934574 GCTTCTCAGAAATCCCACTCTGG - Intergenic
1034465333 7:151224824-151224846 GCTGCTCAGTGACACCAAACTGG - Exonic
1035570074 8:666932-666954 GGTCCTCAGCAACCCCAACCTGG + Intronic
1035660602 8:1344686-1344708 GCTCCTCCGTAACCCCACACTGG + Intergenic
1038813672 8:30878769-30878791 GCTACTCAGGAAGCCAAAGCAGG - Intronic
1040945524 8:52881143-52881165 GCCTCTCAGTTTCCCCCAGCTGG + Intergenic
1045126550 8:99097017-99097039 GCTTCTTAATATCCCCAGGCTGG + Intronic
1047295425 8:123566604-123566626 GCTTCTTAGTAACCTGAACCTGG + Intergenic
1048277460 8:133077660-133077682 TGTTTTCAGTAACCCCAAGCGGG + Intronic
1051762922 9:20488245-20488267 GCTTTTTTGTTACCCCAAGCTGG - Intronic
1053365953 9:37522748-37522770 CCTTCTCAGGACCCACAAGCTGG + Intronic
1055114899 9:72595786-72595808 GCTACTCAGGAAGCTCAAGCAGG - Intronic
1055320018 9:75074167-75074189 GCTACTCAGGAAGCCGAAGCGGG - Intronic
1057932303 9:99205147-99205169 GCTACTCGGTAAGCCAAAGCAGG - Intergenic
1062442808 9:136578730-136578752 GCTTCTCAGGAAGCCCAGCCGGG + Intergenic
1187448369 X:19376555-19376577 GCTACTCAGGAACCTGAAGCAGG - Intronic
1192919333 X:75689951-75689973 TGTGCTCAGTAACCCCATGCAGG - Intergenic
1198671541 X:139086256-139086278 GCTTCCCAGTAAGCACAGGCAGG + Intronic
1200924590 Y:8643007-8643029 GTTTCTCAGTAAGCCCCAACTGG - Intergenic