ID: 1000996863

View in Genome Browser
Species Human (GRCh38)
Location 5:167968212-167968234
Sequence CAGAATGGCCCCAAATTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000996863_1000996865 9 Left 1000996863 5:167968212-167968234 CCAGACAATTTGGGGCCATTCTG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1000996865 5:167968244-167968266 TTTGCAAATACTCCTTTGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 213
1000996863_1000996866 15 Left 1000996863 5:167968212-167968234 CCAGACAATTTGGGGCCATTCTG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1000996866 5:167968250-167968272 AATACTCCTTTGAGAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000996863 Original CRISPR CAGAATGGCCCCAAATTGTC TGG (reversed) Intronic
902118686 1:14143087-14143109 CAGCATGGCCCCATAGTGGCAGG + Intergenic
902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG + Intronic
907909878 1:58816302-58816324 CAGAATCGCCCCCACTTGGCTGG - Intergenic
913064530 1:115238407-115238429 CAGAATGGAAGCAAATTTTCTGG - Intergenic
919680042 1:200425115-200425137 CAGAATGGCCTCCAATTCCCGGG - Intergenic
920569623 1:207006913-207006935 CACAATGACCCCAAGGTGTCTGG + Intronic
921469242 1:215529009-215529031 CAAAATGGTCCCAAAATGTTAGG + Intergenic
924262245 1:242244011-242244033 CTGAAAGCTCCCAAATTGTCTGG + Intronic
1065166824 10:22988037-22988059 TAGAATGCCCCCAAATTATATGG + Intronic
1065261821 10:23931643-23931665 CAGATTGACCCAAAAGTGTCTGG + Intronic
1070089304 10:73269086-73269108 CAGTATGACACCAAATTGGCAGG - Intronic
1071789894 10:88942467-88942489 CAGAATGGCCTCAGATTCTAGGG - Intronic
1072751583 10:97984379-97984401 AAGAGAGGCCCCAAAGTGTCTGG - Intronic
1074435821 10:113433329-113433351 CAGAATTGCCCCAAAGCTTCTGG - Intergenic
1075025783 10:118982136-118982158 GAGACTGGCCCCATTTTGTCTGG - Intergenic
1078256554 11:9663885-9663907 CAAAATGGCCCGAACTGGTCTGG + Intergenic
1078658590 11:13265407-13265429 GAGAATGGCCAAAATTTGTCTGG - Intergenic
1079077006 11:17390262-17390284 CAAAATGGCCGCAGATGGTCAGG - Intergenic
1080420301 11:32103999-32104021 CTGATTGCCCCCAAATTCTCAGG + Intronic
1081455608 11:43219539-43219561 CATAATGGCCCCAAAGTGCAAGG - Intergenic
1083654491 11:64222968-64222990 CAGCACGGCGCCACATTGTCTGG + Intronic
1090943308 11:131407898-131407920 CAGAGTGGTGCTAAATTGTCAGG + Intronic
1095090802 12:38102512-38102534 CAGGCTGGTCTCAAATTGTCAGG + Intergenic
1101424581 12:104577139-104577161 CAGCACGTCCCCAAAGTGTCTGG - Intronic
1103796073 12:123504097-123504119 AATAATGGCCCCAAAATATCAGG - Intronic
1109024380 13:57140797-57140819 CAGAAGGGCCCCCATTTGACTGG + Intergenic
1109025367 13:57147367-57147389 CAGAAGGGCCCCCATTTGACTGG + Intronic
1109026357 13:57153940-57153962 CAGAAGGGCCCCCATTTGACTGG + Intronic
1109027349 13:57160511-57160533 CAGAAGGGCCCCCATTTGACTGG + Intergenic
1109028335 13:57167076-57167098 CAGAAGGGCCCCCATTTGACTGG + Intergenic
1109474365 13:62859073-62859095 CTGTATGCCTCCAAATTGTCAGG - Intergenic
1110362383 13:74642360-74642382 GAGAATGGACCCAAAGTGTAGGG + Intergenic
1110584517 13:77172702-77172724 CAGAATGACTCCAAGGTGTCTGG + Intronic
1113511273 13:110856645-110856667 CAGAATGGCACCACACTGTACGG - Intergenic
1121431851 14:93893336-93893358 CAGAAGAGCCCCAACTTGCCTGG - Intergenic
1122054201 14:99081517-99081539 CAGCGTGGCCCCAAAATGCCTGG - Intergenic
1122363197 14:101179650-101179672 CAGTAGGGCCCCAAAATGCCAGG + Intergenic
1122532285 14:102436864-102436886 CAGCATGGCCCCCTAATGTCTGG + Intronic
1127024565 15:54789435-54789457 CAGGATTGCCTCAAATTCTCAGG + Intergenic
1131632659 15:94195711-94195733 GAGAAAGACCCCAAATAGTCTGG - Intergenic
1133501887 16:6374299-6374321 CAAAATGATCCCAAATTGTGTGG - Intronic
1134537721 16:15040174-15040196 CAGAATGGCTCCTAAGTATCTGG + Intronic
1142893128 17:2957933-2957955 CAAAATGGCCTCAGGTTGTCTGG - Intronic
1143150168 17:4802652-4802674 CAGCCTGGCGCCAAGTTGTCGGG - Intergenic
1147452759 17:40516049-40516071 CAGTAGGGCCCCAACTGGTCTGG - Intergenic
1148731542 17:49839781-49839803 CAGACTGGCAGCAAAGTGTCTGG + Intronic
1148882603 17:50741872-50741894 CAGACTGGTCTCAAATTCTCCGG - Intronic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1151252903 17:72851291-72851313 CATAATGGAGCCAAATTGTGTGG + Intronic
1156390638 18:36647667-36647689 CAAAATAGCCCCAAATTGAAGGG + Intronic
1157852631 18:51070850-51070872 CATAATGGCCCCAAAGTGCAAGG + Intronic
1158639671 18:59193127-59193149 AAGAATGTCCCCAAATTGCTTGG + Intergenic
1159292693 18:66442330-66442352 AATAATGGCCCCAAAGTGTAAGG + Intergenic
1164294661 19:23899275-23899297 CAGAAGAGTCACAAATTGTCAGG - Intergenic
1164700018 19:30278525-30278547 CAGCAAGGCCCCAAGATGTCAGG + Intronic
925343889 2:3156216-3156238 GAAAAGGTCCCCAAATTGTCAGG - Intergenic
927688765 2:25192404-25192426 AAGAATGGCCCCCAAGTGTCTGG + Intergenic
929890279 2:45912917-45912939 CAGAATGGCCCCATAAGGTATGG - Intronic
935123396 2:100201563-100201585 CAGATTGGCCCTTAATTTTCTGG - Intergenic
940560985 2:155296475-155296497 CAGACTGGCCTCAAATTCCCGGG - Intergenic
942403168 2:175624813-175624835 CAGAAATTCCCCAAATTGTAGGG - Intergenic
943272269 2:185821711-185821733 CAGGCTGGTCTCAAATTGTCGGG - Intronic
1169221692 20:3826844-3826866 CAGAATGACCCCAAAGTTCCAGG + Exonic
1171051346 20:21862251-21862273 CTGCATGGCCCCAAAGTATCTGG - Intergenic
1171227636 20:23454633-23454655 CAGGACGGCCTCAATTTGTCTGG + Intergenic
1172505147 20:35455843-35455865 CGGAATGATCACAAATTGTCAGG + Intronic
1177446241 21:21200016-21200038 AAGACTGCCCCCGAATTGTCAGG + Intronic
1178591003 21:33909994-33910016 CAGAGCGGCCCCAAAGAGTCTGG + Intronic
1182398733 22:30057464-30057486 CAGAATGAACCCAAATGGGCCGG + Intergenic
950096427 3:10333369-10333391 CAGAAGGGCCCCAATTTGATGGG - Intronic
950450350 3:13061720-13061742 CAGACTTGCCCCAAACTGCCAGG + Intronic
953240363 3:41143301-41143323 CAGAATGGGGACAAAATGTCAGG - Intergenic
953733153 3:45467049-45467071 CAGAATGGGCACAAATGGCCAGG + Intronic
957539881 3:81554093-81554115 CAAAATGGCCTCAAAATGACTGG - Intronic
959964749 3:112340652-112340674 GAGCAAGGCCCCAAATTGCCAGG + Intronic
960354848 3:116638596-116638618 AAGAATGGCTCCAAGTTTTCAGG - Intronic
962925745 3:139991889-139991911 CAGGATGACCTCAAGTTGTCAGG - Intronic
963645351 3:147906821-147906843 CAGCCTAGCCCCTAATTGTCTGG - Intergenic
965842283 3:172920226-172920248 CACAATGTCACCAAATTGTGAGG + Intronic
969156879 4:5218997-5219019 CAGACCAGCCCCAAATTGTGGGG + Intronic
972797968 4:42441067-42441089 CAGAACGGCCTCAAGTTCTCGGG + Intronic
979288201 4:118950545-118950567 AAGAATGGTCCCCAACTGTCTGG + Intronic
980207738 4:129743178-129743200 CAGAATGGCTCTCCATTGTCTGG + Intergenic
980402368 4:132308103-132308125 CAGAATGTCCCCAGTCTGTCTGG + Intergenic
981215110 4:142155824-142155846 CAGAATGGCCACAGATTTTTAGG + Intronic
982997060 4:162362586-162362608 CAGCATTCCCCCATATTGTCAGG - Intergenic
988044177 5:25927744-25927766 GAGAACTGCCACAAATTGTCAGG + Intergenic
993603224 5:89954469-89954491 CTGAATGGCACCAGATTGACAGG - Intergenic
994798040 5:104331749-104331771 CAGAATGGCACCAAATGGGACGG + Intergenic
998953902 5:147418613-147418635 CAGATTGTCTCCAATTTGTCTGG + Exonic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1006446754 6:34084069-34084091 CAGGATGGGTCCAAATTGTGGGG + Intronic
1009850255 6:69187927-69187949 CAGAATGACCCCAAATTAAAGGG - Intronic
1012761322 6:103306168-103306190 CAGAAGGGCGCCAAAAGGTCTGG + Intergenic
1016218360 6:141631653-141631675 TACAAGGGCTCCAAATTGTCTGG - Intergenic
1021919846 7:25473935-25473957 CAAACTGGCCCCAAATTCACAGG + Intergenic
1022649259 7:32259750-32259772 CAAAATGGACCCAATTAGTCTGG + Intronic
1024638301 7:51309006-51309028 CAGAAAGGCCAGAAACTGTCAGG + Intronic
1024724248 7:52174905-52174927 AAGCATGCCCCCAAATTGTGAGG - Intergenic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1045867160 8:106880959-106880981 CAGAATGGCACAAAACTCTCAGG - Intergenic
1049109396 8:140634315-140634337 CAGACCGGCCCCAAATTGTGGGG - Intronic
1050847305 9:10238145-10238167 CAAAATGACCCCAATTTGTATGG - Intronic
1053279079 9:36805811-36805833 CACAATGGCCCCAGATCCTCTGG + Intergenic
1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG + Intronic
1058693547 9:107539623-107539645 AAGAATGTCCCCAAACTGGCCGG + Intergenic
1186084945 X:5977430-5977452 CAGACTGGCCTCAAATTCCCAGG + Intronic
1186542990 X:10420043-10420065 CTTATTGGCCCCAAACTGTCAGG + Intergenic
1192370715 X:70510714-70510736 CACACTGGAACCAAATTGTCTGG - Intergenic
1199297630 X:146177009-146177031 CTGAATGGGACCAAACTGTCAGG + Intergenic
1199564728 X:149203515-149203537 CTGAATGGCCCCAGATTGTATGG - Intergenic
1201214672 Y:11711885-11711907 TAGAATGGACCTAAATTTTCTGG + Intergenic
1201516767 Y:14826264-14826286 CAGAATGGCACCACACTGACTGG + Intronic