ID: 1001003016

View in Genome Browser
Species Human (GRCh38)
Location 5:168025573-168025595
Sequence ATGTGGCTACATTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 1, 1: 0, 2: 6, 3: 104, 4: 813}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001003011_1001003016 11 Left 1001003011 5:168025539-168025561 CCAAGTAGCAAGAAGAAGTTTAA 0: 1
1: 0
2: 1
3: 10
4: 217
Right 1001003016 5:168025573-168025595 ATGTGGCTACATTGGGAAATAGG 0: 1
1: 0
2: 6
3: 104
4: 813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001003016 Original CRISPR ATGTGGCTACATTGGGAAAT AGG Intronic
900330642 1:2132927-2132949 ATGTGGCTGTATTTGGAGATGGG - Intronic
902116897 1:14128653-14128675 ATGTGACTAGATTTGGAGATAGG - Intergenic
902371514 1:16010016-16010038 ATGGGGCTGCATTGGTATATAGG + Intergenic
902416251 1:16241490-16241512 ATGTGACCATATTTGGAAATAGG - Intergenic
902705378 1:18200671-18200693 CTGTGGCCTCATTTGGAAATAGG - Intronic
902910015 1:19588910-19588932 GTGTGGCCTCATTTGGAAATAGG - Intergenic
903702558 1:25261191-25261213 AAGTGACTATATTTGGAAATAGG - Intronic
903711797 1:25331357-25331379 AAGTGACTATATTTGGAAATAGG - Intronic
904294958 1:29514163-29514185 ATGTGGCCTCATTTGGAAATAGG - Intergenic
904489358 1:30848772-30848794 ATGTGGCCTTATTTGGAAATAGG - Intergenic
904816132 1:33200816-33200838 ATGTGACTATATTTGGAGATAGG + Intergenic
905253120 1:36662596-36662618 ATGTGGCTGTATTTGGAAATAGG - Intergenic
905507125 1:38488916-38488938 ATGTGGCTGTATTTGGAGATGGG - Intergenic
905509207 1:38505260-38505282 ATGTGGATACATTTGGGAGTCGG + Intergenic
905801478 1:40846701-40846723 ATGTGACTGCATTTGGAGATAGG - Intergenic
905841765 1:41186627-41186649 ATGTGACTACATTTGGAGACAGG + Intronic
906222074 1:44088660-44088682 ATGTGACTGCATTTGGAAATAGG - Intergenic
906748759 1:48240363-48240385 ATGTGACTATATTTGGAGATGGG - Intronic
906860049 1:49349755-49349777 ACGTGGCTATATTTAGAAATAGG + Intronic
907651907 1:56303147-56303169 ATGTGGCTGGATTGTGAAGTGGG - Intergenic
907710591 1:56876951-56876973 ATGTGACTGAATTAGGAAATAGG + Intronic
907855329 1:58297913-58297935 ATGTGTCTATAGTGGGAGATTGG + Intronic
908360288 1:63362623-63362645 ATGTGACTATATTTGGAAATAGG - Intergenic
908444839 1:64190660-64190682 TTGTGGCTACACTGGAAACTGGG + Intergenic
908617769 1:65941684-65941706 ATATGTATACATTGTGAAATAGG + Intronic
908629816 1:66090966-66090988 ATTTGGCTACCTAGGGAAAGGGG - Intronic
908828089 1:68152730-68152752 ATGTGGCTTCAGGGGGAAGTGGG + Intronic
909053927 1:70800479-70800501 ATGTGACTTCATTTGGAAATAGG - Intergenic
909307019 1:74094203-74094225 GTGTGGCTATATTTGGAGATGGG - Intronic
909378221 1:74965291-74965313 ATGTGGGTAAATTGGGAATAAGG - Intergenic
909545776 1:76844866-76844888 ATGTGACTACATTTGGAGACAGG - Intergenic
909706019 1:78585719-78585741 ATGTGACTGCATTTGGAAAGAGG - Intergenic
909942158 1:81623534-81623556 ATGTGGTTATATTTGGAAATAGG + Intronic
910089435 1:83444987-83445009 ATATGACTTCATTTGGAAATAGG + Intergenic
910436077 1:87207517-87207539 ATGTGACCATATTTGGAAATAGG + Intergenic
910793708 1:91076432-91076454 GTGTGGCTGTATTTGGAAATGGG + Intergenic
911372872 1:97015029-97015051 GTGTGGCCACATTTGGAGATGGG - Intergenic
912138872 1:106696814-106696836 ATTTGGCCATATTTGGAAATAGG + Intergenic
912211498 1:107562085-107562107 ATGTGACCTTATTGGGAAATGGG + Intergenic
913066190 1:115257626-115257648 ATGTGACTACATTTGGAGATAGG - Intergenic
913210763 1:116580432-116580454 ATGTGACTACATTTGGAGGTAGG + Intronic
913501282 1:119474895-119474917 ATGTGGCTTCATTGGGTGATTGG - Intergenic
914340245 1:146754060-146754082 ATGTGACTGCATTTGGAGATAGG - Intergenic
915817887 1:158989424-158989446 ATGTGACTTTATTTGGAAATAGG + Intergenic
916348946 1:163826988-163827010 ATGTGGGGAGGTTGGGAAATGGG + Intergenic
916732474 1:167579052-167579074 ATGTGACCTCATTTGGAAATAGG + Intergenic
916953822 1:169810637-169810659 ATGTGGCCTTATTTGGAAATAGG - Intronic
917018463 1:170560730-170560752 ATGTGACTATATTTGGAGATAGG + Intergenic
917161893 1:172066582-172066604 ATGTGGCTATATTGACAAGTGGG - Intronic
917187082 1:172370046-172370068 ATGTGACTATATTGAGAGATGGG - Intronic
917263933 1:173199327-173199349 ATGTGACTTTATTTGGAAATAGG + Intronic
917492102 1:175506438-175506460 ATGTGGCTGTTTTTGGAAATAGG + Intronic
918066219 1:181103779-181103801 ATGTGACTATATCTGGAAATAGG - Intergenic
918173964 1:182026921-182026943 ATGTGGCCTTATTTGGAAATAGG + Intergenic
919764988 1:201121196-201121218 CTGTGGTTCCATTGGGAATTTGG - Intronic
919809825 1:201401650-201401672 ATGTGACCTCATTTGGAAATAGG - Intergenic
920090072 1:203446369-203446391 ATGTGGCTGTATTTGGAAATGGG + Intergenic
920150827 1:203906032-203906054 ATGTGACTATATTTGGAGATAGG - Intergenic
920185464 1:204156564-204156586 AAGTGGCTGCATTTGGAAAGAGG + Intronic
920706771 1:208257015-208257037 ATGTGACTTTATTTGGAAATAGG - Intergenic
920740320 1:208575705-208575727 ATGTGACTTAATTTGGAAATAGG - Intergenic
920745623 1:208625326-208625348 ATGTGACCTCATTTGGAAATAGG - Intergenic
920837042 1:209520570-209520592 ATGTGGCCATACTGGGAGATGGG + Intergenic
920838382 1:209533297-209533319 ATGTGGTTCTATTTGGAAATTGG - Intergenic
920952530 1:210585801-210585823 AAGAGGAAACATTGGGAAATAGG + Intronic
920961968 1:210671482-210671504 ATGTGACTTCATTTGGGAATAGG + Intronic
921830387 1:219722382-219722404 ATGTGACTATATTTGGATATTGG + Intronic
922561702 1:226574562-226574584 ATGTGCCCACCTTGGGAATTGGG + Intronic
923209279 1:231788518-231788540 ATGTGACTGCAGTTGGAAATAGG - Intronic
923312999 1:232754339-232754361 ATGTGACCTCATTTGGAAATAGG + Intergenic
924074505 1:240319291-240319313 ATTTAGCTACATTATGAAATTGG + Intronic
924435681 1:244039294-244039316 ATGTGGCTATTTTGGAAACTGGG - Intergenic
924814563 1:247430480-247430502 ATGTGGCTGTTTTGGGAAATGGG - Intronic
1064168042 10:13003013-13003035 ATGTGACTGTATTTGGAAATAGG - Intronic
1064420495 10:15186581-15186603 GTGTGGCTGCATTGGCAGATAGG - Intergenic
1064582525 10:16808762-16808784 ATGTGACTATATTTGGAGATGGG + Intronic
1064885884 10:20111898-20111920 ATATGGTCACATTGGGAAAGGGG - Intronic
1065207115 10:23367235-23367257 ATGTGGCTATATTTGGAGATAGG - Intergenic
1068027964 10:51671947-51671969 ATGTGACTGTATTTGGAAATAGG - Intronic
1068035094 10:51749555-51749577 ATGTGACTACATTTGGAGACAGG - Intronic
1068308899 10:55253746-55253768 TTGTGGCTACATTTGTAAAATGG + Intronic
1068342550 10:55726540-55726562 ATGTGACTGTATTTGGAAATAGG + Intergenic
1068643039 10:59432503-59432525 ATGGGGCAAAATTGTGAAATAGG - Intergenic
1068939432 10:62666360-62666382 ATGTGGCCATCTTTGGAAATAGG + Intronic
1069764761 10:70846829-70846851 ATATGTATACATTGTGAAATGGG + Intronic
1070210869 10:74319536-74319558 ATGTGACTACATTTGAAGATAGG - Intronic
1071010378 10:80932817-80932839 ATGTGACTATATTTGGAGATAGG + Intergenic
1071093331 10:81945713-81945735 ATGTGACTTTATTTGGAAATAGG + Intronic
1071230772 10:83582055-83582077 ATGTGGCTATATTGAGAGGTGGG + Intergenic
1071413011 10:85415147-85415169 ATGTGGCTATATTTAGAGATGGG - Intergenic
1072015979 10:91346953-91346975 TTGTGACTATATTTGGAAATAGG - Intergenic
1072240752 10:93493452-93493474 TTGTGTTTGCATTGGGAAATAGG + Intergenic
1073672961 10:105612994-105613016 ATGTGACTATATTTGGAGATAGG - Intergenic
1073673076 10:105614177-105614199 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1074426155 10:113353315-113353337 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1074492551 10:113952163-113952185 ATGTGACTGCATTTGGAGATAGG - Intergenic
1074914051 10:117938746-117938768 ATGTGCCTTTATTTGGAAATAGG - Intergenic
1074942310 10:118247600-118247622 ATGTGGCTGCATTTGGAGACAGG + Intergenic
1075056598 10:119223306-119223328 ATGTGACTTTATTTGGAAATAGG - Intronic
1075114060 10:119611417-119611439 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1075150701 10:119927666-119927688 ATGTGACTTTATTTGGAAATAGG - Intronic
1075235964 10:120729022-120729044 ATGTGGCTTTATTTGAAAATAGG - Intergenic
1075653230 10:124143733-124143755 ATGTGGCAATATTGAGAGATGGG - Intergenic
1075954464 10:126510154-126510176 ATGTGACTGCATTGGGAGGTAGG - Intronic
1076057907 10:127390434-127390456 ATATGGCTATATTTGGAGATAGG + Intronic
1076246694 10:128952533-128952555 ATGTGGCCTCATTTGGAAATAGG + Intergenic
1076708994 10:132320792-132320814 ATGTGACTATATTTGGAAATAGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077717759 11:4599022-4599044 ATGTGTCCTCATTGGGAAAATGG - Exonic
1078398604 11:11003152-11003174 ATGTGACTTCATTCAGAAATAGG + Intergenic
1078876924 11:15408526-15408548 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1078910349 11:15725220-15725242 ATGTGACTGTATTTGGAAATAGG - Intergenic
1079483001 11:20902574-20902596 ATGTGCATACATTTGGACATAGG + Intronic
1079996170 11:27297247-27297269 ATGTGGCAATATTGAGAAGTAGG - Intergenic
1080057389 11:27920245-27920267 ATGTGACTATATTTGGAGATAGG + Intergenic
1080248244 11:30203812-30203834 ATGTGACTATATTTGGAAATAGG - Intergenic
1080338122 11:31222843-31222865 ATGTGACTATATTTGGGAATAGG - Intronic
1080601774 11:33828146-33828168 ATGTGGCTCCAATGTGAATTGGG - Intergenic
1081562474 11:44230461-44230483 ATGTGACTTTATTTGGAAATGGG + Intronic
1081629307 11:44677818-44677840 ATGTGACTTTATTGAGAAATAGG + Intergenic
1081847379 11:46250653-46250675 CTGTGACTACATTTGGAGATAGG - Intergenic
1083122728 11:60531867-60531889 ATGTGACTGTATTTGGAAATAGG - Intronic
1083482897 11:62961092-62961114 GTGTGACTATATTTGGAAATAGG + Intronic
1083837199 11:65278645-65278667 ATGAGGTTACCTTTGGAAATGGG - Intronic
1084377463 11:68787567-68787589 ATGTGGCCTCATTTGGAGATGGG + Intronic
1084405159 11:68967855-68967877 ATGTGGCCTGATTTGGAAATGGG - Intergenic
1085181881 11:74543141-74543163 TTGTGGCTACACTGGAAACTGGG + Intronic
1085593082 11:77782632-77782654 ATGTTTCTACATTTGAAAATAGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086128763 11:83378796-83378818 ATGTGACTACATTTAGAGATTGG - Intergenic
1086973960 11:93112537-93112559 ATGTGGCTATATTTTGAAAGTGG + Intergenic
1087232956 11:95686564-95686586 ATGAGGCTACTTTGGAAAATGGG + Intergenic
1087420075 11:97911600-97911622 ATGTGGCCATATTTGGAAATAGG - Intergenic
1087922294 11:103880159-103880181 TTGTGGCTATATTTGGAGATTGG - Intergenic
1088432950 11:109778566-109778588 ATGTGACCTCATTTGGAAATAGG - Intergenic
1088710777 11:112506563-112506585 ATGTGACCCCATTTGGAAATAGG - Intergenic
1088734125 11:112712317-112712339 ATGGGGCTTTATTTGGAAATAGG + Intergenic
1088996499 11:115003902-115003924 AATTGGCCATATTGGGAAATGGG - Intergenic
1089799383 11:121012760-121012782 CTGTGGCTATATTTGGACATGGG - Intergenic
1090024485 11:123156037-123156059 ATGTGGCTATATTTGGAGATGGG + Intronic
1090438816 11:126709516-126709538 ATGTGTCTATATTTGGAGATAGG + Intronic
1090705325 11:129330999-129331021 ATGTGACTCTATTTGGAAATAGG + Intergenic
1090705826 11:129335806-129335828 ATGTGGATACACTGGAAAAAGGG - Intergenic
1090809917 11:130228733-130228755 ATGTGGCTAGATTGGCATTTGGG + Exonic
1090882931 11:130850077-130850099 ATGTGGCTATGTTTGGAGATAGG + Intergenic
1090891259 11:130924477-130924499 ATGTGGCTCTATTTGGAGATAGG - Intergenic
1091511897 12:1135524-1135546 ATGTGACCATATTTGGAAATAGG + Intronic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1092516839 12:9223577-9223599 ATGTCGCTTTATTTGGAAATAGG - Intergenic
1093414681 12:18906775-18906797 ATGTGACTTTATTTGGAAATGGG - Intergenic
1093518640 12:20021422-20021444 ATGTGACTGTATTTGGAAATAGG + Intergenic
1094317139 12:29147062-29147084 ATGTGACCTTATTGGGAAATAGG + Intergenic
1094397062 12:30018970-30018992 ATGTGGTTACAGTCAGAAATGGG + Intergenic
1094796975 12:33985792-33985814 ATGTGACTGTATTTGGAAATGGG - Intergenic
1095351601 12:41220410-41220432 ATGTGACTGCATTTGGACATGGG - Intronic
1095401311 12:41817698-41817720 ATGTGACCATATTGGGAGATAGG + Intergenic
1095932868 12:47646703-47646725 ATGTGACTACATTTGGAGATAGG - Intergenic
1097708525 12:62893818-62893840 ATGTGACTATATTTGGAGATAGG - Intronic
1098176689 12:67799431-67799453 ATGTGGCTATATTTGGAGATAGG + Intergenic
1098198112 12:68023907-68023929 ATGTGACTATATTTGGAGATAGG - Intergenic
1098244539 12:68502710-68502732 ATCTGACAAAATTGGGAAATTGG - Intergenic
1098803371 12:74989590-74989612 ATGTGGTTACATTCCCAAATGGG - Intergenic
1098880057 12:75907919-75907941 CTGTGGCTTTATTTGGAAATAGG - Intergenic
1099231088 12:80026789-80026811 ATGTGGCTACTTTGGGTCTTCGG + Intergenic
1099656361 12:85497300-85497322 ATGTGACTATATTTGGAGATAGG - Intergenic
1099690152 12:85941723-85941745 ATGTGACTTTATTTGGAAATAGG - Intergenic
1100447102 12:94670964-94670986 ATGTGACTGCATTTGGAGATAGG - Intergenic
1100825767 12:98472903-98472925 ATGTGACCACATTTGGAAAGAGG + Intergenic
1100893548 12:99154155-99154177 ATGTAACTGCATTGGAAAATTGG - Intronic
1100963317 12:99986474-99986496 AGGTGGCAACATTAGGAAAAAGG - Intergenic
1101712863 12:107284698-107284720 CTGTGGCTATATTTGGACATTGG + Intergenic
1101823374 12:108201444-108201466 ATGTGGCCTTATTTGGAAATAGG - Intronic
1101861367 12:108485076-108485098 ATGTGACTACATTTGGAGATGGG + Intergenic
1101998584 12:109542530-109542552 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1102234057 12:111283231-111283253 ATGTGACTACATTTGGGGATAGG - Intronic
1102720870 12:115014778-115014800 ATGTGGCTTTATTTGGAAATAGG - Intergenic
1102773634 12:115499972-115499994 ATGTGACTTTATTTGGAAATCGG + Intergenic
1102921834 12:116797243-116797265 ATTTGGCTATATTTGGAAATAGG + Intronic
1103029520 12:117601369-117601391 ATGTGACTTTATTTGGAAATAGG + Intronic
1103140285 12:118542146-118542168 ATGTGCCTACATCTGGAACTGGG + Intergenic
1103218241 12:119220350-119220372 ATGTGGCTGTATTTGGAGATGGG - Intronic
1103972716 12:124682140-124682162 ATGTGACTTTATTTGGAAATAGG - Intergenic
1104005086 12:124886155-124886177 ATGTGACTTCATTTGGAAGTAGG - Intergenic
1104381560 12:128312198-128312220 ATGTGACCTCATTTGGAAATAGG + Intronic
1104469817 12:129020535-129020557 ATGTGAATGCATTTGGAAATAGG - Intergenic
1105031119 12:132884549-132884571 ATGTGACTGTATTTGGAAATGGG + Intronic
1106333846 13:28764917-28764939 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1106531493 13:30597137-30597159 ATGTGACTTTATTTGGAAATAGG + Intronic
1106551866 13:30778971-30778993 ATGTGGCAATGTTGGGAAAGGGG + Intergenic
1106851197 13:33794596-33794618 ATGTGACTATATTGGGAGATAGG + Intergenic
1107112827 13:36716427-36716449 ATGTGGCAACAATGGGAATGGGG - Intergenic
1107180761 13:37456223-37456245 ATGTGACCTCATTTGGAAATAGG + Intergenic
1107809455 13:44186335-44186357 ATGTGACTGCATTTGGAGATAGG - Intergenic
1108076237 13:46682401-46682423 ATGTGACTGTATTTGGAAATAGG - Intronic
1108427680 13:50320303-50320325 ATGTGACTATATTTGGAGATGGG - Intronic
1108958438 13:56189501-56189523 CAGTAGCTACATTGGGCAATAGG - Intergenic
1109073368 13:57799590-57799612 ATGTCACTACATTGGGAAAGGGG + Intergenic
1109948686 13:69472430-69472452 ATGTGACTACATTTGGAGAAAGG - Intergenic
1110121277 13:71884782-71884804 ATGTGACTGTATTGAGAAATAGG + Intergenic
1110403482 13:75121649-75121671 GTTAGGCTACATTGGGTAATAGG + Intergenic
1110509141 13:76328460-76328482 ATGTGACTGTATTTGGAAATAGG - Intergenic
1110535549 13:76646963-76646985 ATGTGACTTCATTTGGTAATTGG + Intergenic
1110921872 13:81098325-81098347 ATGTGACTTTATTTGGAAATAGG + Intergenic
1111179885 13:84650690-84650712 ATATGGATACATTGTGGAATGGG + Intergenic
1111299886 13:86334854-86334876 ATGTGACTGTATTTGGAAATAGG - Intergenic
1111666805 13:91279576-91279598 GTGTGACTATATTTGGAAATTGG - Intergenic
1111707764 13:91772354-91772376 ATGTGATGACATTTGGAAATTGG + Intronic
1111938553 13:94584249-94584271 ATGTGACTATATTTGGAGATAGG + Intronic
1112052734 13:95659520-95659542 ATGTGGCTTTATCTGGAAATAGG + Intergenic
1112220372 13:97483278-97483300 ATGTGATTACATTTGGAAATAGG + Intergenic
1112248212 13:97753900-97753922 ATGTGACTGCATTTGGAGATAGG - Intergenic
1112344949 13:98581397-98581419 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1112542319 13:100327232-100327254 ATGTGGTTACACTGGGAAAGGGG - Intronic
1112601379 13:100858846-100858868 ATGTGACTTCATCTGGAAATAGG + Intergenic
1112626120 13:101106270-101106292 ATGTGACTGTATTTGGAAATAGG - Intronic
1113074943 13:106458955-106458977 ATGTGACCTCATTTGGAAATAGG - Intergenic
1113279526 13:108773658-108773680 ATGTGGCTTTATTTGGAAATAGG - Intronic
1113411496 13:110094252-110094274 ATGTGACTATATTTAGAAATAGG + Intergenic
1113469743 13:110535956-110535978 ATGTGGCCTCATTTGGAAACAGG + Intronic
1113518215 13:110919337-110919359 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1113645595 13:111992937-111992959 ATGTGGCTTTATTTGGAAATAGG - Intergenic
1113654783 13:112061325-112061347 CTGTGGCTGCATCAGGAAATTGG - Intergenic
1113658094 13:112082681-112082703 ATGTGCCTTTATTTGGAAATAGG - Intergenic
1113731451 13:112644514-112644536 ATGTGACTTTATTTGGAAATAGG + Intergenic
1114209630 14:20603951-20603973 TTGTGGCTACATAGGAAATTGGG + Intronic
1114821967 14:26031691-26031713 ATTTGGCTAGCTTGAGAAATAGG + Intergenic
1115070693 14:29318581-29318603 CTGTGTCTACCTTGGCAAATAGG + Intergenic
1115797092 14:36950305-36950327 ATGTGACTACATTTGGAGATAGG + Intronic
1115815626 14:37161536-37161558 ATGTGACTTTATTTGGAAATAGG + Intronic
1116189964 14:41652028-41652050 ATGTGACTGTATTTGGAAATGGG - Intronic
1116619594 14:47182343-47182365 ATGTGGCTTTATTTGGAAATAGG + Intronic
1116674381 14:47886962-47886984 CTGTGGCTATATTTGGACATGGG - Intergenic
1116750326 14:48875078-48875100 ATGTGACTGCAGTGGGAAAAAGG - Intergenic
1116853535 14:49931713-49931735 ATGTGACCATATTTGGAAATAGG - Intergenic
1117823932 14:59680514-59680536 ATTTGGGTTCATTGGGAAATTGG - Intronic
1118073184 14:62268675-62268697 ATGTGACTGTATTTGGAAATAGG - Intergenic
1118415281 14:65528786-65528808 ATATGGCTTCATTGGAAACTTGG + Intronic
1119724141 14:76911869-76911891 ATGTGACTATATTTGGAGATAGG + Intergenic
1119974694 14:79012480-79012502 ATGTGGAAAGAGTGGGAAATTGG + Intronic
1120179488 14:81329059-81329081 ATGTGACTTTATTTGGAAATAGG + Intronic
1120382349 14:83796910-83796932 ATGTGGCTTTATTAGGAAATAGG + Intergenic
1120387103 14:83860504-83860526 ATGTGGATTAATAGGGAAATAGG + Intergenic
1120487954 14:85138411-85138433 ATGTAACTATATTTGGAAATAGG - Intergenic
1120923891 14:89779220-89779242 ATGTGACTATATTTGGAGATAGG + Intergenic
1121148768 14:91610783-91610805 ATGTGGCTGTATTTGGAGATAGG + Intronic
1121211537 14:92211084-92211106 ATGTGACCTCATTTGGAAATAGG + Intergenic
1121249390 14:92488466-92488488 ATGTGACTTTATTTGGAAATAGG - Intronic
1121249412 14:92488618-92488640 ATGTGACTTTATTTGGAAATAGG - Intronic
1121249846 14:92491398-92491420 ATGTGGCTTTATTTGGAGATAGG - Intronic
1121378543 14:93437909-93437931 ATGTGACCTCATTTGGAAATAGG - Intronic
1121566242 14:94911904-94911926 ATGTGACTATATTCGGAGATAGG - Intergenic
1121577454 14:94999960-94999982 ATGTGACCTCATTTGGAAATAGG + Intergenic
1121585659 14:95061378-95061400 ATGTGGCCACATTTGGAAATAGG - Intergenic
1121754845 14:96393721-96393743 ATGTGGCCTTATTTGGAAATAGG - Intronic
1121929906 14:97963030-97963052 ATGTGACTTTATTTGGAAATAGG - Intronic
1121941272 14:98073316-98073338 ATATGACTATATTTGGAAATGGG - Intergenic
1122057377 14:99111614-99111636 ATGTGACTATATTTGGAGATAGG + Intergenic
1122439005 14:101717394-101717416 ATGTGGCTGCATTTGGAGACTGG + Intergenic
1122733935 14:103823951-103823973 ATGTGGCCTCATTGTGAAAAAGG - Intronic
1123178040 14:106440560-106440582 AAGGGACTACATGGGGAAATGGG + Intergenic
1123626693 15:22232034-22232056 ATGTTGCCTCATTTGGAAATAGG + Intergenic
1124015953 15:25875888-25875910 ATGTGACTTTATTTGGAAATAGG - Intergenic
1124438032 15:29667118-29667140 ATGTGACTTTATTTGGAAATAGG - Intergenic
1125400408 15:39296190-39296212 ATGTGACCTCATTTGGAAATAGG - Intergenic
1125473933 15:40031518-40031540 ATGAAGCTAAATTGGGAAAAAGG - Intronic
1126228151 15:46295405-46295427 ATGTGGCTACCTGGGGAAGGTGG - Intergenic
1127096027 15:55513107-55513129 ATGTGGCTCTTTTGGGAAAAAGG - Intergenic
1128194200 15:65736129-65736151 ATGTGTCTACATTTGGAAGATGG + Intronic
1128259105 15:66219960-66219982 ATGTGACTTTATTTGGAAATAGG + Intronic
1129886772 15:79043681-79043703 AAGTGGCTACCTGGGGAGATGGG + Intronic
1129942098 15:79507172-79507194 ATGTGGCTATATTTGGAGATAGG - Intergenic
1130057340 15:80537851-80537873 ATGTGACCATATTTGGAAATAGG + Intronic
1130581560 15:85141751-85141773 ATGTGACTTCATGTGGAAATAGG - Intergenic
1130671711 15:85918704-85918726 ATGTGACCTCATTTGGAAATAGG - Intergenic
1131433238 15:92403084-92403106 ATGTGGTTACAGTAGGAAAGGGG - Intronic
1131553262 15:93375886-93375908 GTGTGGCTTTATTTGGAAATAGG + Intergenic
1131705940 15:94996247-94996269 ATGTGGCTGCATTTGCAGATAGG + Intergenic
1133113273 16:3562240-3562262 ATGTGGCTTTATTGAGAAATGGG + Intronic
1133133810 16:3695156-3695178 ATGTGACCATATTTGGAAATAGG - Intronic
1133189308 16:4121761-4121783 ATGTGGCCTTATTTGGAAATGGG + Intergenic
1133846828 16:9462427-9462449 ATGTGACTATATTTGGATATAGG - Intergenic
1134115907 16:11548605-11548627 GTGAGACTACATTGGCAAATGGG + Exonic
1134429993 16:14194460-14194482 ATGTGACTGCATTTGGAAAAAGG - Intronic
1134563905 16:15234601-15234623 ATGTATCCACATTGGGAACTTGG - Intergenic
1134692867 16:16202484-16202506 ATGTGACTGTATTTGGAAATAGG + Intronic
1134738589 16:16522095-16522117 ATGTATCCACATTGGGAACTTGG + Intergenic
1134819704 16:17236896-17236918 ATGTGGCCTTATTTGGAAATAGG - Intronic
1134978980 16:18592211-18592233 ATGTGACTGTATTTGGAAATAGG - Intergenic
1135687189 16:24507311-24507333 ACGTGACTGCATTTGGAAATAGG - Intergenic
1137488614 16:48912309-48912331 ATGTGCCTTTATTTGGAAATCGG + Intergenic
1138425350 16:56928476-56928498 ATGTGGCAGCATTGGGAAATAGG + Intergenic
1138584125 16:57959752-57959774 ATGTGGCTGCCTTGGGAAGGAGG + Intronic
1139294372 16:65887395-65887417 AAGTGACTATATTTGGAAATGGG + Intergenic
1139345415 16:66300066-66300088 ATGTGGCAGCATTGAGAGATGGG - Intergenic
1139994043 16:70963348-70963370 ATGTGACTGCATTTGGAGATAGG + Intronic
1140995643 16:80256840-80256862 ATGTGACTATATTTGGAGATAGG + Intergenic
1141086584 16:81100074-81100096 ATGTGACCATATTGGGAAACAGG + Intergenic
1141256214 16:82404630-82404652 ATGTGACTGCATTTGGAAATAGG + Intergenic
1141276589 16:82593954-82593976 GTGTGGCTGCATTTGGAAATAGG - Intergenic
1141486263 16:84342294-84342316 ATGTGACCTCATTTGGAAATAGG - Intergenic
1141809877 16:86368701-86368723 ATGTGACTTCATTCGGAAACAGG - Intergenic
1141977294 16:87525387-87525409 ATGTTGCCTCATTTGGAAATAGG - Intergenic
1142218929 16:88843477-88843499 GTGTGGCCACATTTGGAAGTAGG + Intronic
1143181304 17:4986156-4986178 CTGTGGCCACATTGGGAACCTGG + Intronic
1143665188 17:8353787-8353809 ATGTGGCTGTATTTGGAGATAGG + Intergenic
1143868014 17:9938114-9938136 ATGTGGCTGCATTTGGCAATGGG + Intronic
1143993051 17:10983119-10983141 ATGTGACTTCATTCAGAAATAGG - Intergenic
1144109492 17:12018536-12018558 ATGGGACTATATTTGGAAATAGG - Intergenic
1144154991 17:12491632-12491654 ATGTGACTGTATTTGGAAATGGG + Intergenic
1144160600 17:12553878-12553900 ATGTGACTTTATTTGGAAATAGG - Intergenic
1144212022 17:13023744-13023766 ATGTCACTACATTTGGAGATAGG - Intergenic
1144315531 17:14057343-14057365 ATGAGGTTAGATTGGGAAAATGG - Intergenic
1144421807 17:15105576-15105598 TTGTGTCTGCATTGTGAAATTGG + Intergenic
1145768744 17:27477577-27477599 ATCTGTCTACATAGGGAAAACGG + Intronic
1146570296 17:33946740-33946762 ATGTGGGTCCATTGGGAAGGTGG + Intronic
1147433283 17:40387676-40387698 ATTTTGCAAAATTGGGAAATGGG - Intergenic
1147709724 17:42454254-42454276 AGGTGGCCTCATTTGGAAATAGG + Intergenic
1148965255 17:51429557-51429579 GTGTGACTACATTTGGAGATAGG - Intergenic
1149261840 17:54888572-54888594 GTGAGGCTACATGTGGAAATAGG + Intergenic
1149324409 17:55515462-55515484 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1149756758 17:59192757-59192779 ATGTGACTATATTTGGAGATAGG - Intronic
1149987768 17:61360733-61360755 ATGTGGCCTTATTTGGAAATGGG - Intronic
1150162053 17:62906781-62906803 ATGTGACTATAATTGGAAATAGG - Intergenic
1150453408 17:65288088-65288110 ATGTGACCTCATTTGGAAATAGG + Intergenic
1150476985 17:65483147-65483169 ATGTGACTTTATTTGGAAATAGG - Intergenic
1151514442 17:74583230-74583252 ATGTGACTATATTTGGAGATAGG + Intronic
1152064624 17:78103909-78103931 ATGTGACTACGTTTGGAGATGGG - Intronic
1152261360 17:79268999-79269021 ATGTGACCTCATTTGGAAATAGG + Intronic
1152387765 17:79985330-79985352 ATGTGACTTTATTTGGAAATAGG - Intronic
1153181353 18:2438363-2438385 TTGTGGCTACTGTGGGAAAAAGG + Intergenic
1153259204 18:3206700-3206722 GTGTGTCAAGATTGGGAAATGGG - Intronic
1153637350 18:7124212-7124234 GTGTGGCTGAATTTGGAAATGGG - Intergenic
1153663731 18:7349689-7349711 CTGTGTCTATATTTGGAAATAGG - Intergenic
1153677967 18:7472484-7472506 ATGTGACTATATTTGGAGATAGG + Intergenic
1154030580 18:10750157-10750179 ATGTGGATACATTGGAACATTGG - Exonic
1154129594 18:11725189-11725211 ATGTGACTGCATTTGGAGATTGG + Intronic
1155361405 18:25006865-25006887 ATGTGGCTATATTTGGAGACAGG + Intergenic
1155369704 18:25084752-25084774 ATGTGGACACATTGGGAGAGAGG + Intronic
1155810037 18:30220869-30220891 ATGTAACTATATTTGGAAATAGG + Intergenic
1156201983 18:34843673-34843695 ATGTGACTATATTTGGAGATAGG - Intronic
1156686336 18:39651543-39651565 ATGTGACTATATTTGGAAATAGG - Intergenic
1156791419 18:40979334-40979356 ATGTGACTGCATTTGGAGATAGG + Intergenic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1157552186 18:48589498-48589520 ATGTGGCCTTATTTGGAAATAGG - Intronic
1158018734 18:52815262-52815284 ATGTGGCTGTATTTGGAAATAGG + Intronic
1158274657 18:55754360-55754382 ATGTGACTGCATTTGGACATAGG + Intergenic
1158726335 18:59976233-59976255 ATGTTGCTACATGTGGAAAATGG - Intergenic
1158788734 18:60748606-60748628 ATAAGGCTGCATTGGGAATTAGG - Intergenic
1158869419 18:61670236-61670258 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1159060903 18:63512831-63512853 TTGTGTCTACACTGGGAAAATGG - Intergenic
1159150577 18:64518247-64518269 ATGTGACTGCATTTGGAGATAGG - Intergenic
1159232671 18:65629346-65629368 ATGTGACTATATTTGGAAAAGGG + Intergenic
1159462857 18:68742403-68742425 ATGTGACTTTATTTGGAAATGGG - Intronic
1160795392 19:942893-942915 ATGGGACTGCATTTGGAAATAGG + Intronic
1161899048 19:7104188-7104210 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1161932212 19:7348686-7348708 ACGTGGCTACATTGTTACATGGG - Intergenic
1162984017 19:14257833-14257855 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1162994488 19:14325549-14325571 ATGTGACTATATTTGGACATAGG - Intergenic
1163279019 19:16303844-16303866 AAGTGTCCACATTGGGAAACTGG + Intergenic
1164516084 19:28936782-28936804 ATGTGACTGCATTGGGAGACAGG + Intergenic
1164525829 19:29012859-29012881 ATGTGAACACATTTGGAAATAGG - Intergenic
1164772559 19:30821621-30821643 ATGTGGCTCCATTTGGCAACTGG + Intergenic
1165085434 19:33342909-33342931 ATGTGACTATATGTGGAAATAGG - Intergenic
1165643899 19:37416940-37416962 ATGAGGCTTCATTTAGAAATAGG + Intronic
1165704774 19:37967637-37967659 ATGTGGCCTCATTTGGAGATAGG - Intronic
1166403367 19:42500921-42500943 ATGTGACTTTATTTGGAAATAGG + Intergenic
1166880034 19:45923348-45923370 ATGTGACTATATTTGGATATAGG + Intergenic
1167663411 19:50810007-50810029 ATGAGGTTAGAATGGGAAATAGG + Intergenic
1167857675 19:52255989-52256011 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1168325028 19:55534162-55534184 ATGTGGCTGTATTTGGAGATGGG + Intronic
1168329889 19:55561806-55561828 ATGTGGCCTTATTTGGAAATCGG + Intergenic
924992304 2:322716-322738 GTGTTGCTACTTTGGGAAACTGG + Intergenic
925239782 2:2314427-2314449 ATTTGGATACATGGGGAAAAAGG - Intronic
925503682 2:4535968-4535990 ATGTGACTTTATTTGGAAATAGG + Intergenic
925719008 2:6810384-6810406 ATGTGGCCTTATTTGGAAATAGG - Intergenic
925898898 2:8494602-8494624 ATGTGGCCTCATTTAGAAATAGG - Intergenic
926457919 2:13091743-13091765 ATGTGACTTTATTTGGAAATGGG - Intergenic
926742562 2:16124953-16124975 ATGTGGCTTTATTTGGAAATAGG + Intergenic
926778290 2:16443883-16443905 ATGTGACTATATTTGGAGATAGG - Intergenic
926870979 2:17416843-17416865 ATGTGACTATATTTGGAAATAGG - Intergenic
926934265 2:18071590-18071612 ATGTGGCTATATTTGGAGATGGG + Intronic
927138954 2:20117099-20117121 ATGTGACTGCATTTGGAGATGGG + Intergenic
927327372 2:21820640-21820662 ATGTGACTATATTTGGAGATTGG - Intergenic
927481220 2:23455861-23455883 ATGTGGCTGTATTTGGACATAGG + Intronic
928329888 2:30349633-30349655 ATGTGACTTTATTTGGAAATAGG - Intergenic
929111466 2:38408560-38408582 CTGTGGCTAAAAGGGGAAATCGG + Intergenic
929568189 2:43003354-43003376 GTGTGGCTGTATTTGGAAATGGG + Intergenic
929999771 2:46853290-46853312 ATGTGACTTTATTTGGAAATAGG - Intronic
930132869 2:47870387-47870409 ACGTGGCCATATTTGGAAATAGG + Intronic
930274018 2:49290571-49290593 ATGTGGCTTTAGTTGGAAATAGG + Intergenic
930841380 2:55850625-55850647 TTGTGTCTACATAGTGAAATAGG - Intergenic
931157489 2:59652064-59652086 ATGTGACTATATTTGGAGATAGG + Intergenic
931382628 2:61767557-61767579 ATGTGACTGTATTTGGAAATAGG - Intergenic
932020313 2:68077932-68077954 ATGTGACTGCATTTGGAGATAGG - Intronic
932379002 2:71264860-71264882 ATGTGACTACATTTGAATATTGG - Intergenic
932385320 2:71327099-71327121 ATGTGGCTGTATTTGGAGATTGG + Intronic
932572960 2:72947541-72947563 ATGTGGCAACCCTGGGAAGTGGG + Intronic
932672312 2:73748879-73748901 ATGTGACTGTATTTGGAAATGGG + Intergenic
932989200 2:76765458-76765480 GTATGGCTACATTTGGAGATAGG + Intronic
933493633 2:83020056-83020078 ATGTGGCTATATTTGGAGTTAGG - Intergenic
933683331 2:85122814-85122836 ATGTGAGTACATTTGGAGATAGG - Intergenic
934122642 2:88855109-88855131 ATGTGACTTTATTTGGAAATAGG - Intergenic
934546217 2:95218894-95218916 ATGTGACTATATTTGGAGATAGG - Intronic
934697759 2:96412387-96412409 ATGTGACTACATTGGGAGATAGG + Intergenic
934971642 2:98769112-98769134 ATGTGACTGCATTTGGAAATAGG - Intergenic
935127364 2:100236153-100236175 ATGTGACCACATTTGGAAATAGG + Intergenic
935325432 2:101931634-101931656 ATGTGACTTCATTTGGAAATAGG + Intergenic
936346706 2:111680933-111680955 ATGTGTCCTCATTTGGAAATAGG + Intergenic
936558355 2:113515265-113515287 ATGTGACTTTATTTGGAAATAGG - Intergenic
936616723 2:114055599-114055621 ATGTGACTGCATTTGGAGATAGG + Intergenic
936822015 2:116533423-116533445 ATGTGACTGCATTTGGAGATAGG - Intergenic
936899294 2:117466141-117466163 CTGTAGCTCCTTTGGGAAATGGG + Intergenic
937269487 2:120639278-120639300 ATTTGGCTACATTGTGATACAGG - Intergenic
937383136 2:121399970-121399992 TTGTGGCCACATTGGGACATGGG - Intronic
937510543 2:122590079-122590101 ATGTGACTGAATTTGGAAATAGG + Intergenic
938197474 2:129341922-129341944 ATGTGACTGTATTTGGAAATGGG + Intergenic
938229053 2:129642166-129642188 ATGTTGCTAGAGTAGGAAATTGG - Intergenic
938586219 2:132693251-132693273 ATGTGACTTTATTTGGAAATAGG + Intronic
938657664 2:133451028-133451050 ATGTGACTTTATTTGGAAATAGG + Intronic
938679958 2:133679323-133679345 ATGTGACTATATTTGGAGATAGG - Intergenic
938719440 2:134053003-134053025 ATGTGACTACATTTGTAGATAGG - Intergenic
939114552 2:138045334-138045356 ATGTGACTGCATTTGGATATAGG - Intergenic
939932965 2:148256278-148256300 TTGTGGCTACACTGGAAATTGGG - Intronic
939951227 2:148476187-148476209 ATCAGGCTACATTGAGAAAGGGG - Intronic
940179370 2:150914767-150914789 ATGTGGCCTTATTTGGAAATAGG - Intergenic
940197851 2:151115314-151115336 ATGTGACTTTATTTGGAAATAGG - Intergenic
940259029 2:151761347-151761369 ATGTGACCTCATTTGGAAATAGG + Intergenic
940387518 2:153090791-153090813 CTGTGGCTACTGTGGGGAATGGG + Intergenic
940605184 2:155914204-155914226 ATATGACTGCATTTGGAAATAGG - Intergenic
940948233 2:159643444-159643466 ATGTGGCTGTTTTTGGAAATGGG - Intergenic
941082521 2:161078383-161078405 ATATGACTATATTTGGAAATGGG - Intergenic
941393324 2:164943602-164943624 ATTTGACTACAAAGGGAAATGGG + Intronic
941975316 2:171398001-171398023 ATGTGGAGAAATTAGGAAATTGG + Intronic
942602278 2:177653501-177653523 ATGTGGCCATGTTTGGAAATAGG + Intronic
942907663 2:181203245-181203267 ATGTGACTATATTTGGAGATAGG + Intergenic
943260190 2:185649733-185649755 ATGTGACTGTATTGGGAGATGGG + Intergenic
943275201 2:185857957-185857979 ATGTGGCTTTATTGGGAAATAGG - Intergenic
943296189 2:186142805-186142827 ATGTGGCTATATTTGGAGCTAGG + Intergenic
943572986 2:189596095-189596117 ATGTGACCCCATTTGGAAATAGG + Intergenic
943674983 2:190707648-190707670 ATGTGACTATATTTGGAGATAGG + Intergenic
944348660 2:198700802-198700824 ATGTGACTTTATTTGGAAATAGG + Intergenic
944391829 2:199226392-199226414 TTGTGGCTACATTGGAAACTGGG - Intergenic
944754862 2:202750556-202750578 ATGTGGCTGTATTTGGACATGGG - Intronic
944784271 2:203052342-203052364 ATGTGGCTAAATTGAGACACAGG - Intronic
945198593 2:207259844-207259866 ATGTGGTTGCATTTAGAAATAGG - Intergenic
946041068 2:216783331-216783353 ATGTGACTTTATTTGGAAATAGG - Intergenic
946247126 2:218394278-218394300 CTGTGGCTTCATTGGGATAATGG - Intronic
946493240 2:220170547-220170569 ATGTGGCCTTATTTGGAAATAGG + Intergenic
947055694 2:226099355-226099377 ATGTGGCTCTATTTGGAGATAGG - Intergenic
947216410 2:227754087-227754109 ATGTGACTATATTTGGAGATGGG - Intergenic
947973574 2:234344829-234344851 ATGTGACTTTATTTGGAAATAGG - Intergenic
949063148 2:241973223-241973245 ATGTGACCTCATTTGGAAATAGG - Intergenic
1169288714 20:4330909-4330931 ATGTGGCAGTATTGGGAAGTAGG - Intergenic
1170162595 20:13329230-13329252 ATGTGACTATATTTGGAGATAGG + Intergenic
1170419695 20:16180607-16180629 GTGTGGCTGCATTTGGAGATAGG - Intergenic
1170740963 20:19056155-19056177 ATGTGGGTCCATCTGGAAATTGG + Intergenic
1171368736 20:24646354-24646376 GTGTGGCAATATTGGGAGATGGG + Intronic
1171847614 20:30286592-30286614 ATGTGTTTACATTGGGACTTAGG - Intergenic
1172174619 20:32964773-32964795 ATGTGGCCTGATTTGGAAATAGG - Intergenic
1172298437 20:33830697-33830719 GTGTGGCTGCATTTGGAGATGGG - Intronic
1172430810 20:34889944-34889966 ATCTGGATACATATGGAAATGGG + Intronic
1172959600 20:38789278-38789300 ATGTGACTGCATTTGGAGATAGG + Intergenic
1173325155 20:42026491-42026513 ATGTTGCTGCTGTGGGAAATGGG + Intergenic
1173402406 20:42737106-42737128 ATGTGGCCTTATTTGGAAATAGG + Intronic
1173801204 20:45895612-45895634 ATGTGGCTACGTAATGAAATGGG - Intronic
1173941539 20:46915087-46915109 ATGTGGCTCCTTTGGGAGATGGG - Intronic
1174104450 20:48152433-48152455 ATGTGGCCTTATTTGGAAATGGG + Intergenic
1174267976 20:49345711-49345733 ATGCGGCTACATTTAGTAATTGG + Intergenic
1174788392 20:53454675-53454697 ATGGGGCTACTTTGAGAAAGGGG - Intronic
1174978421 20:55361946-55361968 ATGTGACTTTATTTGGAAATAGG + Intergenic
1175849959 20:62084933-62084955 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1175938970 20:62529053-62529075 ATGTGGCTTTCTTTGGAAATAGG + Intergenic
1177094560 21:16816780-16816802 ATGAGGCTACATTGCAAAATTGG + Intergenic
1177361729 21:20081562-20081584 ATGTGATTATATTTGGAAATAGG - Intergenic
1177583202 21:23054634-23054656 ATGTGACTTTATTTGGAAATAGG - Intergenic
1177695996 21:24571841-24571863 ATGTGACTATATTTGGAGATAGG + Intergenic
1178066817 21:28913579-28913601 ATGTGTCTATATTTGGAGATGGG + Intergenic
1178137919 21:29649108-29649130 ATGTGGCTACTTTGGGAATGTGG - Intronic
1178252209 21:31014412-31014434 ATGTGACTGCATTTGCAAATAGG - Intergenic
1178392877 21:32213899-32213921 TTGTGGTTACATTGGGATCTTGG + Intergenic
1178510366 21:33200297-33200319 ATGTGGCTGCATTTGGAGAAAGG - Intergenic
1178748886 21:35281733-35281755 ATGTGATTATATTTGGAAATAGG + Intronic
1178895023 21:36550885-36550907 ATGTGGCCTTATTTGGAAATAGG + Intronic
1178898879 21:36583386-36583408 ATGTGACTTCATTTGGAAATAGG - Intergenic
1179268880 21:39832647-39832669 ATGTGACTTTATTTGGAAATAGG + Intergenic
1179328634 21:40376942-40376964 ATGTGACTTTATTTGGAAATAGG + Intronic
1179652173 21:42818607-42818629 ATGTGACTACATTTGGAGATGGG + Intergenic
1181015664 22:20067020-20067042 ATGTGACTGCATTTGGAGATAGG + Intergenic
1181446439 22:22978843-22978865 ATGAGGCTCCTGTGGGAAATGGG + Intergenic
1181518700 22:23433124-23433146 ATGTGACTGTATTTGGAAATAGG - Intergenic
1181719484 22:24762909-24762931 ATGTGGCAGCATTGGGAAGTGGG - Intronic
1181964970 22:26650098-26650120 ATGTGACTACATTGGAAGATAGG + Intergenic
1182104185 22:27677432-27677454 ATGTGGCTCTATTTGGAAATAGG + Intergenic
1182670782 22:31994064-31994086 ATGTGACTTCATTTGGAAATAGG - Intergenic
1183010351 22:34941337-34941359 ATGTGACTTTATTTGGAAATAGG + Intergenic
1183312132 22:37115986-37116008 ATGTGACCTCATTTGGAAATAGG - Intergenic
1184416714 22:44356070-44356092 ATGTGACTTTATTTGGAAATAGG + Intergenic
1184605237 22:45569251-45569273 ATGTGACTGCATTTGGAGATAGG - Intronic
1184931485 22:47684435-47684457 ATGTGACTACATTTGGAGATAGG + Intergenic
1185230051 22:49674781-49674803 ATGTAGCTACATTGCGAATGTGG - Intergenic
1203294221 22_KI270736v1_random:25138-25160 ATGTGACTACATTTGAAGATAGG - Intergenic
949582077 3:5398571-5398593 ATGTGGCTATGTTTGGAGATAGG - Intergenic
949588379 3:5466243-5466265 AAATGAGTACATTGGGAAATAGG - Intergenic
949767376 3:7542150-7542172 ATGTGACTTTATTTGGAAATAGG - Intronic
949852202 3:8430566-8430588 ATGGGACTACATTTGGAGATAGG + Intergenic
950339662 3:12231489-12231511 ATGTGGCTGTATTTGGAGATAGG - Intergenic
950689802 3:14646693-14646715 ATGTGGCCTTATTTGGAAATAGG + Intergenic
950810881 3:15648713-15648735 ATGTGGCCTTATTTGGAAATAGG + Intergenic
951220721 3:20066352-20066374 ATGGGGCCATATTTGGAAATAGG - Intronic
951332548 3:21384007-21384029 ATGTGACTATATTTGGAGATAGG + Intergenic
951334898 3:21408587-21408609 ATGTGGCTTTACTTGGAAATAGG + Intergenic
951515248 3:23551871-23551893 ATGTGACTATATTTGGAGATAGG + Intronic
951618969 3:24579921-24579943 ATGTGACTTTATTTGGAAATAGG + Intergenic
951756699 3:26098669-26098691 ATGTGGCCTGATTTGGAAATAGG - Intergenic
952722590 3:36548644-36548666 TTGTGGCTATATTGGGAGGTGGG - Intergenic
953180389 3:40589442-40589464 AAGTGGCTACTGTTGGAAATAGG - Intergenic
953855446 3:46496260-46496282 ATGTGACCACATTTGGAAAAAGG - Intergenic
954028026 3:47798543-47798565 CTGTGACTGCATTTGGAAATAGG + Intergenic
954584423 3:51721090-51721112 AAGTGGTTACATTGGGCAAAGGG + Intergenic
955882480 3:63562604-63562626 TTGAGGCTAGATGGGGAAATAGG - Intronic
956012103 3:64842893-64842915 CTTTGGCTACAGTGGCAAATAGG - Intergenic
956174528 3:66460456-66460478 ATGTGACTGCATTTGGAGATGGG + Intronic
956237873 3:67094991-67095013 ATCTGGCTTCATTTGGAAACAGG + Intergenic
956687181 3:71840840-71840862 ATGTTCCTATATTTGGAAATAGG + Intergenic
956983433 3:74667881-74667903 ATGTGGTTACACTGGCAGATAGG + Intergenic
957310332 3:78510461-78510483 ATGTGTCTACCTTGGGTATTAGG + Intergenic
957683495 3:83469955-83469977 ATGGGGCTGTATTTGGAAATAGG + Intergenic
957922788 3:86768313-86768335 ATGTGCCTAGATTTGGAATTAGG - Intergenic
957997393 3:87707749-87707771 ATATGGTTACATTGGGAGTTAGG + Intergenic
958415176 3:93865394-93865416 AAGTGACTACATTTGGAGATAGG - Intergenic
958432299 3:94056678-94056700 ATGTGACTATATTTGGAGATGGG - Intronic
958863687 3:99474751-99474773 ATGTGGCAGTATTGGGAGATGGG + Intergenic
958916228 3:100053574-100053596 ATGTGACTATATTTGGAAATAGG - Intronic
959019936 3:101177828-101177850 ATGTGACCTCATTTGGAAATAGG - Intergenic
959084405 3:101835706-101835728 ATGTGGCTATGTTTGGAGATGGG - Intronic
959192681 3:103135154-103135176 ATGTGAATACATTGGGAACAAGG + Intergenic
959286006 3:104412197-104412219 GTGTGGCTGAATTTGGAAATAGG + Intergenic
959497985 3:107073389-107073411 ATGTGACCATATTTGGAAATAGG - Intergenic
961153987 3:124663339-124663361 ATGTGACCTTATTGGGAAATGGG - Intronic
961502156 3:127344043-127344065 ATGTGGTTATATTTGGAGATAGG - Intergenic
962043336 3:131730523-131730545 ATGTGACTTCATATGGAAATAGG + Intronic
962197543 3:133377161-133377183 ATGTGACTATATTTGGAGATAGG - Intronic
962288985 3:134114581-134114603 ATGTGGCAGCATTGGGAAGTTGG - Intronic
962608946 3:137056805-137056827 ATGTGACCTCATTTGGAAATAGG + Intergenic
963182610 3:142374820-142374842 ATGTGACTTTATTTGGAAATAGG + Intronic
963474081 3:145781043-145781065 ATGTGACTACATTTAGAAATGGG - Intergenic
963727032 3:148934376-148934398 ATGTGACTATATTTGGAGATAGG + Intergenic
963943544 3:151119559-151119581 ATGTGACTATATTTGGAGATAGG - Intronic
964034282 3:152177218-152177240 ATGTGACTATATTTGGAGATAGG - Intergenic
964432842 3:156623912-156623934 TTGTGGCTACACTGGAAACTGGG + Intergenic
965192819 3:165553282-165553304 ATGTGACCATATTTGGAAATAGG + Intergenic
965192941 3:165554959-165554981 ATGTGACTATATTTGGAGATAGG - Intergenic
965327886 3:167330498-167330520 ATGTGACTACATTTTGAGATAGG + Intronic
965489825 3:169322311-169322333 ATTTGGCCAGATTGGGAATTAGG + Intronic
965561914 3:170070029-170070051 ATGTGACTATATTTGGAGATAGG - Intronic
965635669 3:170777781-170777803 ATGTGGCCTTATTTGGAAATAGG + Intronic
965836619 3:172860369-172860391 ATGTGGCTGCATTTGGAGCTAGG + Intergenic
965836892 3:172862757-172862779 ATCTGACTATATTTGGAAATGGG + Intergenic
966028274 3:175313223-175313245 ATGTGACTATATTTGGAAATAGG - Intronic
966224643 3:177584823-177584845 ATGTGACTGCATTTGGAGATAGG - Intergenic
966543099 3:181114116-181114138 ATGTGGCCTTATTTGGAAATAGG - Intergenic
966587095 3:181638446-181638468 ATGTGACTTTATTTGGAAATAGG - Intergenic
966622418 3:181980315-181980337 ATGTGACTACATTTGGAGATAGG + Intergenic
966733177 3:183167640-183167662 ATGTGACTATATTCGGAGATAGG - Intergenic
967755103 3:193159903-193159925 ATGTGACTATATTTGGAGATAGG + Intergenic
967821232 3:193841374-193841396 ATGTGACTTTATTTGGAAATTGG - Intergenic
968216625 3:196897262-196897284 TTGTGTCTACATGGGGGAATGGG - Intronic
969529464 4:7722696-7722718 ATGTGACCTCATTTGGAAATAGG - Intronic
970009005 4:11438066-11438088 ATGTGACTAAATTTGGAGATAGG + Intergenic
970207812 4:13673070-13673092 ATGTGACTTTATTTGGAAATAGG + Intergenic
970443376 4:16104181-16104203 ATGTGACTTTATTTGGAAATAGG - Intergenic
970582154 4:17483306-17483328 ATGTGGCTGTATTTGGAGATGGG - Intronic
970739106 4:19212061-19212083 ATGTGACTATATTTGGAGATCGG - Intergenic
970892368 4:21061776-21061798 ATGTGACTGTATTTGGAAATGGG + Intronic
971087769 4:23298961-23298983 ATGTGACAATATTTGGAAATGGG - Intergenic
971243635 4:24910382-24910404 ATGTGACTTTATTTGGAAATAGG - Intronic
971353266 4:25871674-25871696 ATGTGACTTTATTTGGAAATAGG + Intronic
971361085 4:25939258-25939280 ATGTGACTATATTTGGAGATAGG + Intergenic
971637443 4:29079605-29079627 ATGTGACTATATTTGGAAACTGG - Intergenic
972958719 4:44424913-44424935 ATGGGACTGCATTTGGAAATAGG + Intronic
973006108 4:45008664-45008686 ATGTGACTATATTTGGAGATAGG + Intergenic
973302559 4:48604392-48604414 AGGTGACTTCATTAGGAAATAGG + Intronic
974095755 4:57362087-57362109 ATGTGGCTGCATTTGGAGATAGG - Intergenic
974372810 4:61040010-61040032 TTGAGGCTACATTTGGAGATGGG + Intergenic
974853116 4:67427517-67427539 ATGTGACTTCATTTGCAAATAGG - Intergenic
975172016 4:71243136-71243158 ATGTTGCTTCATTTGGAAAATGG + Intronic
975385974 4:73760808-73760830 ATGTGGCAATATTGAGAAGTGGG + Intergenic
975811940 4:78178760-78178782 ATGTGCCCTCATTTGGAAATAGG - Intronic
975923497 4:79421368-79421390 ATGTGACTATATTGGGAGGTAGG - Intergenic
975953206 4:79800591-79800613 ATGTGGCTATATTTGGAAACTGG + Intergenic
975958934 4:79877473-79877495 ATGTGGCTATATTTGGAGAGAGG + Intergenic
976505035 4:85836601-85836623 ATGTGGTCATATTTGGAAATAGG - Intronic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
976737162 4:88322114-88322136 TTGAGGCTACCTTGGGGAATGGG - Intergenic
977440804 4:97064935-97064957 ATGTGACTATATTTGGAGATAGG - Intergenic
977456083 4:97261301-97261323 GTGTGGCTATATTTGGAGATGGG + Intronic
977715754 4:100181751-100181773 ATGTGACTGCATTTGGAGATAGG + Intergenic
977910261 4:102526176-102526198 ATGTGACTTTATTTGGAAATAGG - Intronic
978148018 4:105399960-105399982 ATGTGGCCACACTGGGCAAAGGG - Intronic
979027029 4:115590123-115590145 ATGTGGCAACATATGTAAATTGG - Intergenic
979203630 4:118008666-118008688 ATGTGACTTTATTTGGAAATAGG + Intergenic
979480496 4:121210814-121210836 ATGTGACTGCATTTGGAGATAGG - Intronic
979568958 4:122193169-122193191 ATGTGACTATATTTGGAGATGGG - Intronic
980434212 4:132748000-132748022 ATGTGACTTAATTGGGAGATAGG - Intergenic
981009666 4:139912541-139912563 ATGTGACTTCATTTGGAAATAGG + Intronic
981116629 4:140998394-140998416 ATGAGGCCACAGTGGGAAAGTGG + Intronic
981156261 4:141440476-141440498 ATTTGGCTACATGGGAAAAAAGG - Intergenic
981361042 4:143845929-143845951 ATGTGGCAGTATTGAGAAATAGG - Intergenic
981371781 4:143966931-143966953 ATGTGGCAGTATTGAGAAATAGG - Intergenic
981452895 4:144919895-144919917 ATGTGGCCTGATTTGGAAATAGG + Intergenic
981652496 4:147075763-147075785 ATGTGGCCTCATTTGGAAATAGG + Intergenic
981686623 4:147461929-147461951 ATGTGACCATATTTGGAAATAGG + Intergenic
982123345 4:152162762-152162784 ATGTGGCTGCATTTGGAGATAGG + Intergenic
982214446 4:153068217-153068239 ATGTGTTTATATTTGGAAATAGG - Intergenic
982365498 4:154573559-154573581 TTGTGGCTTTATTGGAAAATGGG - Intergenic
982954964 4:161752765-161752787 ATGTGACTATATTTGGAGATAGG + Intronic
982991565 4:162283037-162283059 ATGTGATTTCATTTGGAAATTGG - Intergenic
983142222 4:164165234-164165256 ATGTGACTATATTTGGAGATAGG + Intronic
983804237 4:171973623-171973645 ATGTAGCTTTATTTGGAAATGGG - Intronic
984253280 4:177360169-177360191 AAGTGGCTACAGTGTGATATTGG + Intronic
984383693 4:179029075-179029097 ATTTTGCTCTATTGGGAAATTGG - Intergenic
984720352 4:182966593-182966615 GTGTGACTTTATTGGGAAATCGG - Intergenic
984896377 4:184544919-184544941 ATGTGGCCTTATTTGGAAATAGG + Intergenic
985090957 4:186362310-186362332 GTGTGGCTACATTTGGAGGTGGG + Intergenic
985107175 4:186510674-186510696 ATGTGACTATATTTGGAGATAGG - Intronic
985277703 4:188254609-188254631 ATGTGACTTTATTTGGAAATAGG - Intergenic
986284321 5:6348543-6348565 ATGTGGCCTTATTTGGAAATGGG - Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986519480 5:8598695-8598717 ATGTGACTTCATTTGAAAATAGG + Intergenic
986661599 5:10064853-10064875 ATGTGACCTCATTTGGAAATAGG + Intergenic
986717115 5:10532802-10532824 ATGTGGCCTTATTTGGAAATAGG + Intergenic
987107705 5:14656769-14656791 ATGTGACTATATTTGGAGATAGG - Intergenic
987253392 5:16123205-16123227 ATGTGGCTGCATTTGGAGATAGG + Intronic
987782616 5:22458393-22458415 ATATGGCCTTATTGGGAAATAGG - Intronic
988488693 5:31689016-31689038 ATGTGGCTTCATCTGGAAATAGG - Intronic
988594139 5:32575530-32575552 TTGTGACTACATTTGAAAATAGG - Intronic
988846204 5:35130735-35130757 ATGTGACCTCATTTGGAAATAGG + Intronic
989270264 5:39524980-39525002 ATGTGGCTTAAATGGGAACTTGG + Intergenic
989512010 5:42299193-42299215 ATGTGACTATATTTGGAGATAGG + Intergenic
989644843 5:43620071-43620093 ATGTGGCAATATTGGGAGGTGGG - Intronic
990086404 5:51983526-51983548 ATGTGACTATATTTGGAAATAGG - Intergenic
990447207 5:55904135-55904157 ATGTGACTGTATTTGGAAATAGG - Intronic
990558238 5:56957667-56957689 GTGTGGCTATATTTGGAGATGGG + Intronic
990605709 5:57407785-57407807 ATGTGACTATATTTGGAGATGGG + Intergenic
991125846 5:63068785-63068807 ATGTGACTATATTTGGAGATAGG + Intergenic
991173224 5:63653239-63653261 ATGTGACTACATTTGGAGATAGG - Intergenic
991355975 5:65768894-65768916 ATGTGGCTGTATTTGTAAATAGG - Intronic
991419082 5:66422502-66422524 ATGTGACTACATTTGAAGATAGG + Intergenic
991574628 5:68090172-68090194 ATGTGACTTTATTTGGAAATAGG - Intergenic
992186140 5:74246459-74246481 ATGTGACTACATTTGGATATAGG + Intergenic
993004626 5:82417062-82417084 ATGTGGCTGTATTTGGAGATAGG - Intergenic
993153295 5:84188609-84188631 ATGTGACTATATTCGGAGATAGG + Intronic
993195419 5:84736620-84736642 ATGTGACTATATTTGGAGATAGG - Intergenic
993289842 5:86052994-86053016 ATGTGGCAACACTGGCAGATAGG + Intergenic
993562509 5:89428397-89428419 ATGTGACATCATTTGGAAATAGG - Intergenic
993629122 5:90262691-90262713 AGGTGGCTTCACTGGGAAACAGG + Intergenic
993810965 5:92475064-92475086 ATGTGGCAGTATTGGGAAGTGGG + Intergenic
993815415 5:92538727-92538749 ATGTGTCTATATTTGGATATAGG + Intergenic
993876715 5:93316087-93316109 ATGTGGCTGCATTTGGAGATAGG - Intergenic
994045432 5:95303995-95304017 ATGTATATACATTGTGAAATGGG - Intergenic
994426027 5:99588027-99588049 ATGTGACTTTATTTGGAAATAGG + Intergenic
994801103 5:104377769-104377791 ATGTGACTTTATTTGGAAATAGG + Intergenic
995012757 5:107276282-107276304 ATGTGACTATATTTGGAGATAGG - Intergenic
995140989 5:108734974-108734996 ATGTGACTATATTGGGATATAGG - Intergenic
996500209 5:124208196-124208218 ATGTGACTGCATTTGGAAAAAGG + Intergenic
996511822 5:124325032-124325054 ATGTGACCTCATTTGGAAATAGG - Intergenic
996523660 5:124453941-124453963 ATGTGACTATATTTGGAGATAGG - Intergenic
996886660 5:128363585-128363607 ATGTGACTTTATTTGGAAATAGG + Intronic
996985037 5:129550664-129550686 ATGTGACTTCATTGGTGAATAGG + Intronic
998527628 5:142857219-142857241 ATGTGACTTTATTTGGAAATGGG - Intronic
998733879 5:145112445-145112467 ATGTGACTATATTTGGATATAGG - Intergenic
998986394 5:147762674-147762696 ATGTGACTGCATTTGGAGATAGG - Intronic
999114660 5:149152044-149152066 ATTTGCCAACAATGGGAAATTGG + Intronic
999680107 5:154049712-154049734 ATGTAGCTTCATGGGAAAATGGG - Exonic
999717260 5:154371319-154371341 ATGTGGCTTTATTTGGAAACAGG - Intronic
1000410968 5:160934800-160934822 TTGTGGCTACACTGGAAACTGGG - Intergenic
1000421624 5:161044597-161044619 ATGTGACCTCATTTGGAAATAGG - Intergenic
1001003016 5:168025573-168025595 ATGTGGCTACATTGGGAAATAGG + Intronic
1001742302 5:174063864-174063886 ATTTGTTTACATTGGAAAATTGG + Intronic
1002484809 5:179527581-179527603 ATGTGTGTCCATGGGGAAATGGG - Intergenic
1003024516 6:2542369-2542391 ACGTGGCTGTATTTGGAAATGGG + Intergenic
1003214349 6:4095391-4095413 ATGTGACTAGATTTGGAAATAGG + Intronic
1003495942 6:6663258-6663280 ATGTGACTGTATTTGGAAATAGG - Intergenic
1003862510 6:10335417-10335439 ATGTGACTATATTTGGAGATCGG + Intergenic
1004288262 6:14342965-14342987 ATGTGACTTTATTTGGAAATAGG + Intergenic
1004358531 6:14950779-14950801 ATGTGGCTATATTTGGAGCTAGG + Intergenic
1004491035 6:16116548-16116570 ATGTGGCTACCTTGTGAGACAGG + Intergenic
1004604267 6:17179109-17179131 ATGTGACTATATTTGGAGATAGG + Intergenic
1004787669 6:18987224-18987246 ATGTGACTATATTCGGATATGGG + Intergenic
1005008612 6:21314314-21314336 ATGTGGCTGTATTTGGAAATAGG + Intergenic
1005304073 6:24496847-24496869 ATGTGAGTGCATTTGGAAATAGG - Intronic
1005455113 6:26012187-26012209 ATGTGCCTATATTTGGAGATAGG + Intergenic
1005461101 6:26071169-26071191 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1005888917 6:30120332-30120354 ATGTGACTATATTTGGAAATAGG + Intergenic
1006101667 6:31689544-31689566 ATGTGTCTACAGTGGGGGATGGG + Intronic
1006527306 6:34617962-34617984 ATGTGGAAAAATTGTGAAATAGG - Intronic
1008131704 6:47726527-47726549 ATGTGCCTACATTTGCAGATGGG + Intergenic
1008960818 6:57263599-57263621 ATGTGACTTCATTTGGAAACAGG - Intergenic
1009164685 6:60326735-60326757 ATGTGACCACATTTGGAGATAGG + Intergenic
1009215757 6:60917941-60917963 ATGTGACTGTATTGGGAGATAGG - Intergenic
1009485020 6:64210542-64210564 ATGTGACTATATTTGGAGATAGG - Intronic
1009496841 6:64359818-64359840 ATGTGACTGTATTTGGAAATGGG - Intronic
1009502567 6:64434024-64434046 ATGTGACTATATTTGGAAATAGG + Intronic
1009555054 6:65152363-65152385 ATGTGACTTTATTTGGAAATAGG + Intronic
1009619363 6:66052718-66052740 ATGTTTCTACTTTGGGAAAATGG + Intergenic
1010082706 6:71882986-71883008 ATGTGACTGCATTTGGAGATAGG + Intergenic
1010548557 6:77190462-77190484 ATGTGACCCCATTTGGAAATAGG + Intergenic
1011118743 6:83926603-83926625 ATGTGACGACATTTGGAAATGGG - Intronic
1011507386 6:88061297-88061319 ATGTGACTCTATTTGGAAATAGG + Intronic
1011790452 6:90893249-90893271 ATGTGACTGCATTTGGAGATAGG - Intergenic
1012012069 6:93801442-93801464 GTGTGGCTGCATTTGGAGATAGG - Intergenic
1012212139 6:96532456-96532478 ATGTGGCAGTATTGGGAAGTAGG + Intronic
1012416974 6:99022386-99022408 ATGTGGCTACACTGGAAACTGGG - Intergenic
1012779577 6:103540538-103540560 ATGTGACTATATTTGGAAACAGG + Intergenic
1013740313 6:113276067-113276089 ATGTGGCTACATGAGGAAGACGG + Intergenic
1013790783 6:113834292-113834314 ATGTGACCTTATTGGGAAATAGG + Intergenic
1013916254 6:115340665-115340687 ATGTGACTTCATTTGGAAAATGG + Intergenic
1014129863 6:117818375-117818397 ATGTGGCTGAATTTGGCAATGGG + Intergenic
1014220198 6:118792103-118792125 ATGTGACTGCATTTGGAGATAGG - Intergenic
1015031648 6:128602599-128602621 ATGTGACTATATTTGGAGATAGG + Intergenic
1015294015 6:131569866-131569888 ATGTGGCTGTATTTGGAAACAGG + Intergenic
1016004622 6:139076914-139076936 ATGTGGCATTATTTGGAAATAGG + Intergenic
1016225283 6:141727721-141727743 ATGTGGCTGAATTTGGAAATAGG - Intergenic
1016273437 6:142318832-142318854 ATGAGGCTAGATGGGGAAGTGGG + Intronic
1016372853 6:143392627-143392649 ATGTGGCCTGATTTGGAAATAGG - Intergenic
1016595048 6:145789461-145789483 ATGTGACTGCTTTGGAAAATGGG + Intergenic
1016631112 6:146232768-146232790 ATGTGACTACATTTAGAGATAGG - Intronic
1016760300 6:147729248-147729270 ATGTGACTTTATTTGGAAATGGG - Intronic
1016852619 6:148636433-148636455 ATGTGACTATATTTGGAGATTGG + Intergenic
1017019755 6:150130724-150130746 ATGTGGCTTCATGTGGAAAGAGG - Intergenic
1017283910 6:152652579-152652601 ATGTGACTATATTTGGAGATAGG - Intergenic
1017411075 6:154168524-154168546 ATGTGACCTTATTGGGAAATGGG - Intronic
1017550082 6:155496381-155496403 CTGTGGCTGCATTTGGAAACAGG + Intergenic
1019065984 6:169298167-169298189 AGGTGACTGCATTTGGAAATAGG + Intergenic
1019599862 7:1875819-1875841 ATGTGACTGTATTTGGAAATAGG + Intronic
1019800009 7:3081362-3081384 ATGTGACTACATTTCGATATAGG + Intergenic
1020383909 7:7576821-7576843 ATGTGGATACATTAGAGAATAGG + Intronic
1020578795 7:9968789-9968811 ATGTGGCTGTATTTGGAGATGGG + Intergenic
1021538144 7:21728070-21728092 ATGTGGCTGTATTTGGGAATAGG - Intronic
1021551140 7:21872194-21872216 ATGTGACTGTATTTGGAAATAGG - Intronic
1021602086 7:22374199-22374221 ATGTGACTGTATTTGGAAATGGG - Intergenic
1021667736 7:23003071-23003093 ATGTAGCATCATTTGGAAATAGG - Intronic
1021767493 7:23964486-23964508 ATGTGGCTGTATTTGGAGATGGG - Intergenic
1022945934 7:35283706-35283728 ATGTGGCTGTATTTGGAGATAGG + Intergenic
1023624217 7:42100345-42100367 ATGTGACCATATTTGGAAATAGG + Intronic
1024281479 7:47722907-47722929 ATGTGGCTGTATTTGGAGATAGG - Intronic
1025070109 7:55890485-55890507 ATGTGACTTTATTTGGAAATAGG - Intronic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026694627 7:72580040-72580062 GTGTGGCTATATTTGGAGATGGG - Intronic
1027306297 7:76901425-76901447 ATATGACTTCATTTGGAAATAGG + Intergenic
1027457294 7:78408619-78408641 ATGTGGCTAGACTGCCAAATTGG - Intronic
1027534073 7:79374202-79374224 ATGTGGCTTTTTTTGGAAATAGG + Intronic
1027684756 7:81266744-81266766 TTGTGGCTACACTGGAAACTGGG - Intergenic
1028403914 7:90455991-90456013 ATGTGGCTATATTTGGAGATAGG + Intronic
1028634775 7:92975669-92975691 ATGTGGCTGTATTTGGAGATAGG + Intergenic
1028892283 7:96001798-96001820 ATGTGACTGTATTTGGAAATAGG - Intronic
1028913948 7:96238053-96238075 ATGTGACTTTATTTGGAAATAGG + Intronic
1028965361 7:96796014-96796036 ATGTGACTGTATTTGGAAATAGG + Intergenic
1029152315 7:98489679-98489701 ATGTGACCTCATTTGGAAATAGG + Intergenic
1029519259 7:101049781-101049803 ATGTGACTATATTTGGAGATAGG - Intronic
1029554928 7:101262334-101262356 ATGTGACTATATTTGGAGATGGG + Intergenic
1029916822 7:104218736-104218758 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1030150434 7:106399006-106399028 ATGTGGTCATATTTGGAAATAGG + Intergenic
1030152468 7:106420928-106420950 ATGTGGCTAATTGGGGTAATGGG + Intergenic
1030646234 7:112064728-112064750 ATGTGACTATATTTGGAGATGGG + Intronic
1030899536 7:115105229-115105251 ATGTGACTTTATTTGGAAATAGG + Intergenic
1031171664 7:118299345-118299367 ATGTGGCTATATTTGGAAATGGG - Intergenic
1031243270 7:119272319-119272341 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1031323093 7:120357895-120357917 ATGTGGCTGTATTGAGAGATAGG - Intronic
1032397161 7:131598896-131598918 ATGTGACTTTATTTGGAAATAGG - Intergenic
1032900013 7:136296499-136296521 ATGTGACCATATTTGGAAATAGG + Intergenic
1033135712 7:138782415-138782437 ATGTGGCTGTATTTGGAAACAGG - Intronic
1033450730 7:141460432-141460454 ATGTGACTACATTTGGAGATTGG - Intronic
1033667830 7:143459650-143459672 ATGTGGTTGCATTGGCAATTAGG + Intergenic
1033992549 7:147306087-147306109 ATGTGGCCTTATTGGGAAATAGG - Intronic
1034122466 7:148640087-148640109 ATGAGACTGCATTGGGAGATGGG - Intergenic
1034396953 7:150833637-150833659 ATGTGACTATATTTGGAAATAGG - Intronic
1034502434 7:151459527-151459549 ATGTGACTCTATTTGGAAATAGG - Intergenic
1034675812 7:152891762-152891784 ATGTGACTGCTTTTGGAAATAGG + Intergenic
1034937058 7:155207029-155207051 ATGTGGCTGTATTTGGAAACAGG - Intergenic
1035075767 7:156176305-156176327 AGGTGGCTGCATTTGGAAATGGG + Intergenic
1035086045 7:156258804-156258826 ATGTGGCCTCATTTGGAAGTAGG - Intergenic
1035522985 8:290377-290399 ATGTGGCTGTCTTTGGAAATGGG + Intergenic
1035714928 8:1746805-1746827 ATGTGACTTTATTTGGAAATAGG + Intergenic
1036081035 8:5555615-5555637 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1036504323 8:9341643-9341665 ATGTGGCTTTGTTTGGAAATAGG + Intergenic
1036982140 8:13481747-13481769 ATGTGACTTTATTTGGAAATAGG + Intronic
1037150820 8:15633469-15633491 CTGTGGCCTCATTTGGAAATAGG + Intronic
1038063928 8:23941672-23941694 ATGTGACTGTATTTGGAAATAGG + Intergenic
1038161468 8:25043378-25043400 ATGTGACTATATTTGGAGATAGG - Intergenic
1038362936 8:26901202-26901224 ATGTGGCTGTATTTGGAAATGGG - Intergenic
1038867729 8:31458009-31458031 GTGTGGCTACATTTAGAGATGGG + Intergenic
1039033886 8:33338139-33338161 ATGTGACTATATTTGGAGATAGG - Intergenic
1039105863 8:33988798-33988820 ATGTGGCTGTATTTGGAGATTGG - Intergenic
1039610551 8:38915591-38915613 ATGTGGCTATATTTGGAGACAGG - Intronic
1039631697 8:39119823-39119845 ATGTGACTATATTTGGAGATAGG + Intronic
1039795388 8:40908652-40908674 ACGTGACTATATTTGGAAATAGG - Intergenic
1040679707 8:49793831-49793853 ATGTGACTATATTTGGAAATAGG - Intergenic
1040914061 8:52550897-52550919 GTGTGGCCCTATTGGGAAATAGG - Intronic
1041003898 8:53480955-53480977 ATGTGACTGCACTTGGAAATGGG + Intergenic
1041214462 8:55585978-55586000 ATGTGACTTTATTTGGAAATAGG - Intergenic
1041260974 8:56020285-56020307 ATGTGACTGCATTTGGAGATAGG - Intergenic
1041435141 8:57831146-57831168 ATGAGACTGCATTTGGAAATAGG + Intergenic
1041644118 8:60234144-60234166 TTGTGGCTAGATTGGGTTATGGG - Intronic
1042054037 8:64743725-64743747 ATGTGACTGCATTTGGAGATAGG - Intronic
1042653108 8:71065217-71065239 ATGTGACTGCATTTGGAGATAGG + Intergenic
1043356946 8:79424891-79424913 ATGTGACTGTATTTGGAAATAGG + Intergenic
1043520888 8:81044229-81044251 ACGTGACTTCATTTGGAAATAGG + Intronic
1044184133 8:89231925-89231947 AGGTGGTGATATTGGGAAATAGG - Intergenic
1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG + Intergenic
1044370169 8:91400884-91400906 ATGTGACTATATTTGGAGATAGG - Intergenic
1044387083 8:91601879-91601901 ATGTGACTGCATTTGGAGATAGG - Intergenic
1044613489 8:94116888-94116910 ACGTGACTATATTTGGAAATAGG - Intergenic
1044627206 8:94245716-94245738 ATGTGACTTTATTGGGAAATAGG - Intergenic
1044704653 8:94996708-94996730 ATGTGGCTGGATTTGGAAATAGG + Intronic
1044740404 8:95320868-95320890 ATGTGACTATATTTGGAGATAGG + Intergenic
1045013310 8:97977420-97977442 ATGTGGCCTTATTTGGAAATAGG - Intronic
1045182700 8:99803040-99803062 ATTTGGCAGCATTAGGAAATTGG - Intronic
1045247593 8:100457171-100457193 ATGTGACTGCATTTGGAGATAGG + Intergenic
1045611097 8:103843078-103843100 ATGTGACTATATTTGGAGATAGG - Intronic
1045646924 8:104308307-104308329 ATGTGACTATATTTGGAGATGGG + Intergenic
1045651261 8:104343516-104343538 GTGTGGCTGTATTTGGAAATTGG + Intronic
1045858994 8:106794616-106794638 ATGTGACTTCATTTGGAAAAAGG - Intergenic
1045921683 8:107537543-107537565 GTGTGGTTACATTTGGAGATGGG + Intergenic
1046628070 8:116596403-116596425 ATGGGGAAACATGGGGAAATTGG + Intergenic
1046852728 8:118993774-118993796 ATGTGACTATATTTGGAGATGGG - Intergenic
1046938668 8:119910147-119910169 CAGGGGCTACATTGGGAAACAGG + Intronic
1047009220 8:120653161-120653183 ATGTGACTTTATTTGGAAATAGG + Intronic
1047909398 8:129510852-129510874 ATGTGACTTTATTTGGAAATAGG - Intergenic
1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG + Intronic
1048318998 8:133384067-133384089 ATGTGACTGCATTTGGAGATGGG - Intergenic
1048389540 8:133948318-133948340 ATGTGACTGCATTTGGAGATAGG - Intergenic
1048819711 8:138369614-138369636 ATGGCTCTTCATTGGGAAATGGG - Intronic
1048847135 8:138612525-138612547 ATGTGACCGAATTGGGAAATTGG + Intronic
1049393742 8:142386239-142386261 GTGTGGCTATCTGGGGAAATGGG + Intronic
1049764198 8:144345850-144345872 ATATGACAATATTGGGAAATAGG + Intergenic
1049894512 9:101001-101023 ATGTGACTTTATTTGGAAATAGG + Intergenic
1049966864 9:787738-787760 ATGTGACTATATTTGGAGATAGG - Intergenic
1050262401 9:3854391-3854413 GTGTGGCTACACTGGGGAAGTGG + Intronic
1050425602 9:5509614-5509636 ATGTGACTATATTTGGAAGTAGG + Intergenic
1051049979 9:12920818-12920840 ATGTGTCTACATTTTGTAATTGG - Intergenic
1051054656 9:12970736-12970758 ATGTGACCATATTTGGAAATAGG - Intergenic
1051125704 9:13802792-13802814 AAGTGACTACCTTGGGGAATGGG - Intergenic
1051667039 9:19475351-19475373 ATGTGACTTTATTTGGAAATAGG - Intergenic
1051744791 9:20285213-20285235 ATGTGACTGCATGTGGAAATAGG + Intergenic
1051778177 9:20658901-20658923 ATGTGACTGTATTTGGAAATAGG + Intronic
1051888137 9:21916210-21916232 ATGTGGCCTCATTTGGAAATAGG + Intronic
1052222066 9:26036532-26036554 ATGTGGCAGTATTGAGAAATGGG - Intergenic
1052226252 9:26091465-26091487 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1052536619 9:29755839-29755861 ATGTGGCTCTATCGGGAGATGGG - Intergenic
1052622352 9:30930004-30930026 ATGTGACTTTATTTGGAAATAGG + Intergenic
1053117415 9:35517723-35517745 CAGTGGCCACATTAGGAAATAGG - Intronic
1053735721 9:41100991-41101013 ATGTGACTTTATTTGGAAATAGG + Intergenic
1054692658 9:68330407-68330429 ATGTGACTTTATTTGGAAATAGG - Intronic
1054857697 9:69918698-69918720 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1055016429 9:71623594-71623616 ATGTGACTATATTTAGAAATAGG - Intergenic
1055088693 9:72340328-72340350 ATGTGACTTTATTTGGAAATAGG + Intergenic
1055332215 9:75196438-75196460 ATGTGGCTATATTTGGAGCTAGG - Intergenic
1055367067 9:75556055-75556077 ATGTGCCTATATTTGGAGATAGG + Intergenic
1055416665 9:76091451-76091473 ATGTGACTATATTTGGAAAAAGG - Intronic
1055699369 9:78926145-78926167 ATGTGGCTATAAGGGGTAATGGG - Intergenic
1055955416 9:81768723-81768745 ATGTAATTAGATTGGGAAATTGG + Intergenic
1056074938 9:83028796-83028818 ATGTGACTATATTTGGAAATGGG + Intronic
1056633753 9:88314990-88315012 ATGTGACTTTATTGGGAAAAGGG + Intergenic
1056699743 9:88892330-88892352 ATGTGGCCATGTTTGGAAATAGG + Intergenic
1056935156 9:90910745-90910767 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1057332847 9:94131908-94131930 ATGTGACTATATTTGGAGATGGG + Intergenic
1057860127 9:98634352-98634374 ATGTGACTTCATTTGGAAATAGG + Intronic
1057952726 9:99382767-99382789 GTGTGACTATATTTGGAAATAGG + Intergenic
1058216995 9:102246924-102246946 ATGTGACTATATTTGGAAATAGG - Intergenic
1058237741 9:102514080-102514102 ATGTGACTTTATTGGGAAATAGG + Intergenic
1058383261 9:104403320-104403342 ATGTGGCTGTATTTGGAGATAGG - Intergenic
1058784576 9:108374610-108374632 CTGTGGCTACTGTGGGGAATAGG + Intergenic
1060806658 9:126581918-126581940 ATGTGACTTCATTTGGAAATAGG + Intergenic
1061702670 9:132427863-132427885 ATGTGGTTTCATTTGGTAATAGG - Intronic
1185856526 X:3541408-3541430 ATGTGACTATATTTGGAGATGGG - Intergenic
1185947777 X:4396999-4397021 ATGTGACCACATTTGGAAATAGG + Intergenic
1185965084 X:4591107-4591129 ATGTGACTTTATTTGGAAATAGG - Intergenic
1186017313 X:5212936-5212958 ATGTGGCTGTATTTGTAAATAGG + Intergenic
1186112014 X:6267754-6267776 ATGTGACTTCATTTGGAAATAGG - Intergenic
1186197747 X:7126702-7126724 ATGTGACTATATTTGGAGATAGG - Intronic
1186453222 X:9690545-9690567 ATGTGGCTGTATTTGGAGATAGG - Intronic
1186475458 X:9853709-9853731 ATGTGGCCTTATTTGGAAATAGG - Intronic
1186495152 X:10007157-10007179 ATGTGGCTTTATTTGGAAATGGG - Intergenic
1186632310 X:11363161-11363183 CTGTGGCTCCATTAGGAGATGGG - Intronic
1186940535 X:14502058-14502080 ATGTGACTATATTTGGAGATAGG - Intergenic
1187215606 X:17273060-17273082 ATGTGACTATATTTGGAGATAGG - Intergenic
1187301715 X:18057453-18057475 ATGTGACTGCATTTGGAGATAGG + Intergenic
1188027842 X:25229553-25229575 ATGTGACTTCATTTGGAAATAGG + Intergenic
1188059637 X:25585193-25585215 ATGTGACTTTATTTGGAAATAGG + Intergenic
1189246047 X:39564385-39564407 ATGTGACTACATTTGGAAATAGG - Intergenic
1189369848 X:40418988-40419010 ATGTGGCCACTTTGGGGACTGGG + Intergenic
1189422022 X:40864530-40864552 ATATTGCCACATTGGGAATTAGG + Intergenic
1189563322 X:42213678-42213700 ATGTGACTTCATTTGGAAACAGG - Intergenic
1189568929 X:42274381-42274403 ATGTGGCTGTATTTGGAAATAGG - Intergenic
1189629957 X:42942447-42942469 ATGTGACTATATTTGGAGATGGG + Intergenic
1190104584 X:47550300-47550322 GTGTGGCTATATTTGGAGATAGG - Intergenic
1190223809 X:48530440-48530462 ATGTGACTATATTTGGAGATAGG - Intergenic
1190444480 X:50509801-50509823 ATGTGACTATATTTGGATATTGG + Intergenic
1192826936 X:74707108-74707130 ATGTGACCATATTTGGAAATAGG + Intergenic
1192867326 X:75148559-75148581 ATGTGACTATATTTGGAAACAGG + Intronic
1192886410 X:75339164-75339186 ATGTGACTATATTTGGAAATAGG - Intergenic
1194335691 X:92643827-92643849 AGGTGTCTACCATGGGAAATTGG - Intergenic
1194602994 X:95946627-95946649 ATGTGACTGCATTTGGAGATAGG + Intergenic
1195096555 X:101506641-101506663 ATGTGGCTGTATTTGGAAATAGG - Intronic
1196125745 X:112096993-112097015 GTGTGCCTTTATTGGGAAATTGG + Intergenic
1197375710 X:125679815-125679837 ATGTGGCAAAATTGAGAATTTGG - Intergenic
1198038720 X:132827483-132827505 ATGTGTCAACAGTGGGAAAAGGG + Intronic
1198175414 X:134149646-134149668 ATGTGACTATATTTGGAGATAGG - Intergenic
1198281781 X:135149804-135149826 ATGTGACTTTATTTGGAAATAGG - Intergenic
1198289178 X:135222718-135222740 ATGTGACTTTATTTGGAAATAGG + Intergenic
1198420672 X:136468490-136468512 ATGTGACTATATTTGGAGATAGG + Intergenic
1198631147 X:138640112-138640134 ATGTGAGTACATTGGTAAAAAGG - Intronic
1198644406 X:138790215-138790237 GTGAGGATACAATGGGAAATTGG - Intronic
1199019039 X:142853674-142853696 ATGTGGCTATATTTGGAGACAGG + Intergenic
1199671012 X:150148411-150148433 ATATGGCTTTATTTGGAAATAGG - Intergenic
1199694236 X:150332148-150332170 ATGTGACTTTATTTGGAAATAGG + Intergenic
1199722476 X:150551861-150551883 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1199754942 X:150855185-150855207 ATGTGACTTTATTTGGAAATAGG + Intronic
1200246782 X:154530722-154530744 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1200807684 Y:7449029-7449051 ATGTGACTATATTTGGAGATGGG + Intergenic
1202028204 Y:20546979-20547001 ATCTGGCTATTTTGGGAAACAGG + Intergenic