ID: 1001003178

View in Genome Browser
Species Human (GRCh38)
Location 5:168026949-168026971
Sequence TATTTCATGTAGAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 315}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001003178_1001003181 -7 Left 1001003178 5:168026949-168026971 CCTCCCAATTTCTACATGAAATA 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1001003181 5:168026965-168026987 TGAAATAAGAATATCAAATTAGG 0: 1
1: 1
2: 7
3: 66
4: 721
1001003178_1001003182 -4 Left 1001003178 5:168026949-168026971 CCTCCCAATTTCTACATGAAATA 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1001003182 5:168026968-168026990 AATAAGAATATCAAATTAGGAGG 0: 1
1: 0
2: 4
3: 61
4: 1879
1001003178_1001003183 1 Left 1001003178 5:168026949-168026971 CCTCCCAATTTCTACATGAAATA 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1001003183 5:168026973-168026995 GAATATCAAATTAGGAGGAATGG 0: 1
1: 0
2: 2
3: 27
4: 254
1001003178_1001003184 2 Left 1001003178 5:168026949-168026971 CCTCCCAATTTCTACATGAAATA 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1001003184 5:168026974-168026996 AATATCAAATTAGGAGGAATGGG 0: 1
1: 0
2: 2
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001003178 Original CRISPR TATTTCATGTAGAAATTGGG AGG (reversed) Intronic
900773388 1:4563473-4563495 TATTTTTTGTAGACATTGGGAGG + Intergenic
902139501 1:14341061-14341083 TATTTTTAGTAGAGATTGGGGGG + Intergenic
904753721 1:32756480-32756502 TATTTCTTGTAGAAATGGGCGGG - Intronic
904979763 1:34488875-34488897 TATGTCCTGTTGAATTTGGGTGG - Intergenic
905681477 1:39875177-39875199 TATTTTATGAAGTAACTGGGTGG - Intronic
906176842 1:43781793-43781815 CATTGCATGTGGAAATTGGGAGG - Intronic
906196179 1:43932023-43932045 TATTTCCGGTAGAAATGGAGGGG - Intergenic
908068888 1:60436721-60436743 TATTTCATTTACAATTTTGGTGG - Intergenic
909849542 1:80442951-80442973 TATTTCATGATGATATTGTGAGG - Intergenic
910579311 1:88804715-88804737 TTTCTCATGTAGAAAATGAGGGG + Intronic
910644910 1:89503990-89504012 TATTTCATTTAGAAATGAGTAGG - Intergenic
910657228 1:89632201-89632223 TTTTTCATCCTGAAATTGGGTGG + Intergenic
914433518 1:147640738-147640760 CTTTTCCTGAAGAAATTGGGAGG - Intronic
914779804 1:150774919-150774941 TATTTTAAGTAGAGATGGGGGGG + Intergenic
914954212 1:152146481-152146503 TATTTCAGGTAAATATTTGGTGG - Intergenic
915054563 1:153114235-153114257 AATTGCCTGTACAAATTGGGTGG - Intergenic
915073380 1:153290462-153290484 TTATTCATGTATAAAGTGGGGGG + Intergenic
916000876 1:160614142-160614164 TAATTCAAGCAGTAATTGGGTGG + Intronic
916847420 1:168666843-168666865 TATGTCATGTACAAAATAGGAGG + Intergenic
917109959 1:171537692-171537714 TATTAGATGTTGAAATTGGTAGG + Intronic
919648964 1:200126495-200126517 TTTTTAATCTAGAAGTTGGGAGG - Intronic
919689455 1:200516152-200516174 CATTTCATGTTGAAATGAGGAGG - Intergenic
920805379 1:209229024-209229046 TGTTTAATGCAGAAATTGGCTGG + Intergenic
921688649 1:218121408-218121430 CATTTTATGTATAAATTGTGAGG + Intergenic
921898749 1:220428387-220428409 CTTTTCAGGTGGAAATTGGGGGG + Intergenic
922230397 1:223680621-223680643 TATTTTTAGTAGAGATTGGGGGG + Intergenic
924529676 1:244882595-244882617 TATTTTTAGTAGAAATGGGGGGG - Intergenic
924926118 1:248682786-248682808 TATTTGTTGAATAAATTGGGTGG + Intergenic
1065511583 10:26484265-26484287 TATTTCATGCAGAAGTTGTTAGG + Intronic
1065683273 10:28259185-28259207 TATGTAATGTAAAAATTGTGAGG - Intronic
1065958548 10:30714650-30714672 TATTTTTTGTAGAGATGGGGGGG + Intergenic
1066147134 10:32572823-32572845 TGTATCATGTAGAAATAGGAAGG + Intronic
1066492827 10:35910509-35910531 TTTCTGAAGTAGAAATTGGGTGG - Intergenic
1066501621 10:36000537-36000559 AATCTCATGTTGAAATTTGGAGG + Intergenic
1066629471 10:37444865-37444887 AATCTCATGTTGAAATTTGGAGG + Intergenic
1068048105 10:51913223-51913245 TATCTAAAATAGAAATTGGGTGG - Intronic
1069005353 10:63311824-63311846 TATTTCAAGTAGAAATGGTCTGG + Intronic
1069455258 10:68548899-68548921 TATTTAATGTATAGATTTGGTGG - Intergenic
1072622844 10:97091551-97091573 TGTTTCAAGGAGAATTTGGGGGG - Intronic
1073971516 10:109049105-109049127 TAAGTCATGAAGACATTGGGTGG - Intergenic
1074205357 10:111278188-111278210 TCTTTCATGGAGTTATTGGGAGG + Intergenic
1074681712 10:115913897-115913919 CACTTCATGAAGATATTGGGAGG + Intronic
1075352612 10:121737340-121737362 CATTTCATTTAGATATGGGGAGG - Intergenic
1077834851 11:5917007-5917029 TATTTTATGTAGATTTGGGGTGG - Intronic
1078252444 11:9627449-9627471 TATTTTTTGTAGAGATTGGGGGG + Intergenic
1078253013 11:9633496-9633518 TATTTCAGGAAGAAACTGGGTGG + Intergenic
1078316306 11:10295428-10295450 TGTTTCATCTACAAATTGGGAGG + Intergenic
1079228092 11:18625740-18625762 TATTTTTTGTAGAGATTGGGGGG + Intronic
1079952841 11:26825627-26825649 TATTTTAAGTAGATATTTGGAGG + Intergenic
1080041656 11:27765544-27765566 TACTTCATGCAGAAATTGGCTGG - Intergenic
1080066661 11:28023837-28023859 TGTTTGATGTAGAACTTGAGAGG + Exonic
1083036655 11:59644165-59644187 TGGTTGATGTTGAAATTGGGTGG - Intronic
1083270745 11:61571323-61571345 TACTTCAGGTAGAAATTGGGTGG - Intronic
1083908044 11:65686877-65686899 TAATTCTGGTAGGAATTGGGTGG + Intergenic
1084345910 11:68548781-68548803 TGTCTCAGGTAGAATTTGGGTGG + Intronic
1084617084 11:70243650-70243672 TTTTTCTGGTAGAAATTTGGGGG - Intergenic
1084645589 11:70455582-70455604 TATTTCATGTTGAAAACTGGAGG - Intergenic
1084988199 11:72896734-72896756 TATTTCCTGTAGCAATTAGGGGG + Intronic
1085359105 11:75870035-75870057 TGTTCCATGTAGAAATTGGGCGG + Intronic
1086301831 11:85434723-85434745 TATTTCTGGTAGAATTTGGCTGG - Intronic
1087412009 11:97803474-97803496 TATTCCATGTATACATTTGGAGG - Intergenic
1089061464 11:115629505-115629527 TGCTACATGGAGAAATTGGGTGG - Intergenic
1090534893 11:127630350-127630372 AATTTTATGTGGAATTTGGGTGG + Intergenic
1091485520 12:883762-883784 TGTTTGTTGTAGAAATTGGAAGG + Exonic
1094586325 12:31780994-31781016 TATTTTTAGTAGAAATGGGGGGG + Intergenic
1095389921 12:41693429-41693451 TATTTCATAATGAAATTGGCTGG - Intergenic
1098103096 12:67040014-67040036 TTTTTCAATTAGAAATGGGGAGG - Intergenic
1098546503 12:71717369-71717391 TACTTCATGAAGTAGTTGGGAGG + Intergenic
1100205226 12:92341277-92341299 TATTTCTTGTTGAAATTGCCAGG - Intergenic
1100317364 12:93457220-93457242 TTTTTAATGTAGAGATGGGGGGG - Intergenic
1100482470 12:94992539-94992561 TTTCTCATGTAGAACTTGGGTGG + Intronic
1100577136 12:95902898-95902920 TCTTTCTTGTAGAAATTGAAAGG - Intronic
1102398880 12:112611612-112611634 TATTTTTGGTAGAGATTGGGAGG + Intronic
1102509311 12:113403537-113403559 TTTTTTTTGTAGAGATTGGGGGG + Intronic
1106511068 13:30413060-30413082 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1106556456 13:30812694-30812716 TATTTGTTGAAGAAATTGTGTGG + Intergenic
1106658762 13:31776430-31776452 TATTTTTAGTAGAAATGGGGTGG + Intronic
1107048063 13:36015178-36015200 TATTTCCTGAAGAAATTTGGAGG - Intronic
1107761216 13:43681273-43681295 TTTCTCATGTATAAATTGAGAGG - Intronic
1107907037 13:45070812-45070834 AATTTCATGAAGAAATAAGGAGG - Intergenic
1108520057 13:51238482-51238504 TTTTTCATCTAGATATTAGGTGG - Intronic
1109554796 13:63958666-63958688 TTTTTCATCCAGAAAGTGGGAGG + Intergenic
1109667263 13:65555776-65555798 TGTTTGATTTAGAAAGTGGGAGG - Intergenic
1110464083 13:75780906-75780928 TATTTCATGAATAAAGTTGGAGG - Intronic
1110591303 13:77264234-77264256 TAATTCATTTTGAAATTAGGTGG - Intronic
1111194827 13:84860865-84860887 TATATGATGCAGAAATTTGGAGG - Intergenic
1112094915 13:96121779-96121801 AATTTCATGGAGTCATTGGGTGG - Intronic
1112521322 13:100097846-100097868 TATTTTTTGTAGAGACTGGGCGG - Intronic
1115152256 14:30299168-30299190 TCTTTTATGTACAAATTGGCTGG - Intergenic
1117415405 14:55490883-55490905 AATTTCTTGTAGAGATTGGGGGG + Intergenic
1119014218 14:71032414-71032436 TTTCTCATCTATAAATTGGGGGG + Intronic
1119905833 14:78301139-78301161 TATTTAATGTGGAATTGGGGGGG + Intronic
1120860571 14:89251548-89251570 TATTTAATGTGGAATGTGGGTGG + Intronic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1121398703 14:93652430-93652452 TATTTTTTGTAGAAATGAGGGGG + Intronic
1122485309 14:102075583-102075605 TATTTTTTGTAGAGATGGGGTGG - Intergenic
1124458433 15:29866550-29866572 TATGTCATGTGGAATTTGTGTGG + Intronic
1125558172 15:40603590-40603612 TATTTTTTGTAGAGATGGGGGGG - Intronic
1125760351 15:42092207-42092229 TCCCTCATGTAGAAAATGGGAGG - Intronic
1126400493 15:48263991-48264013 TATTTCATTTAAAAAGTGAGTGG - Intronic
1127197225 15:56601068-56601090 TATGTTTTGTAGAGATTGGGGGG - Intergenic
1129276237 15:74447528-74447550 TATTTTTTGTAGAGATGGGGGGG - Intronic
1129311235 15:74710789-74710811 AATTTCATCTGGAAAATGGGGGG - Intergenic
1129489401 15:75908787-75908809 CATTTTATGTAAAAATTCGGTGG + Intronic
1129792709 15:78352277-78352299 TATTTTTTGTAGAGATTGGGGGG - Intergenic
1129827599 15:78644807-78644829 AAATTCATGTAGTAATTGAGGGG + Intronic
1130911019 15:88270810-88270832 AATTGCTTGGAGAAATTGGGGGG - Intergenic
1133552451 16:6870191-6870213 TATTTCATCTAGAATTTTGCAGG + Intronic
1135053978 16:19215217-19215239 TATTTGATGTAGAAGTGGGGAGG + Intronic
1135379959 16:21987598-21987620 TATTTCAAGAAGAGAGTGGGTGG + Intronic
1135642562 16:24133748-24133770 TATATCATATAGAAATTGTAAGG + Intronic
1139425508 16:66877447-66877469 TATTTTTTGTAGAGATGGGGGGG + Intergenic
1141374127 16:83514168-83514190 TATTGCATGGAGTAATTGTGAGG - Intronic
1142178762 16:88657115-88657137 TATTTTTTGTAGAGATGGGGGGG + Intronic
1143168766 17:4913594-4913616 TTTTTTTTGTAGAGATTGGGGGG - Intergenic
1143188870 17:5026917-5026939 TATTTTTTGTAGAGATGGGGGGG - Exonic
1143528027 17:7483581-7483603 TATTTCAGGAATAAAATGGGGGG - Intronic
1143635053 17:8159686-8159708 GATTTCAGGCAGGAATTGGGGGG + Exonic
1143654859 17:8288270-8288292 AATTACTTGTAGAAATGGGGCGG - Exonic
1143725239 17:8840089-8840111 TATTTCATATACATATTTGGAGG - Intronic
1143725243 17:8840145-8840167 TATTTCATATATATATTTGGAGG - Intronic
1143725245 17:8840171-8840193 TATTTCATATATATATTTGGAGG - Intronic
1143725247 17:8840201-8840223 TATTTCATATATATATTTGGAGG - Intronic
1143725252 17:8840321-8840343 TATTTCATATACATATTTGGAGG - Intronic
1143725254 17:8840351-8840373 TATTTCATATACATATTTGGAGG - Intronic
1143725256 17:8840381-8840403 TATTTCATATACATATTTGGAGG - Intronic
1143725258 17:8840411-8840433 TATTTCATATACATATTTGGAGG - Intronic
1143725262 17:8840473-8840495 TATTTCATATATATATTTGGAGG - Intronic
1144563295 17:16339534-16339556 TGTTTCCTGTAGAGATGGGGGGG + Intronic
1144962169 17:19050871-19050893 TATTTCAAGTAGACACAGGGAGG - Intergenic
1144972992 17:19123650-19123672 TATTTCAAGTAGACACAGGGAGG + Intergenic
1145359551 17:22200984-22201006 TATTTCCTCTAGAGATGGGGGGG + Intergenic
1146620213 17:34391339-34391361 TTTCTCATGTAGAAAATGAGAGG - Intergenic
1147850358 17:43437626-43437648 TATTTTTTGTAGAGATGGGGTGG + Intergenic
1148147521 17:45375353-45375375 TTTTTTTTGTAGAGATTGGGGGG + Intergenic
1151410444 17:73923332-73923354 TATTTCATATAAAAATTTTGGGG + Intergenic
1151896611 17:76985051-76985073 TATTTTTTGTAGAGATGGGGGGG + Intergenic
1152679391 17:81658027-81658049 TATTTTTTGTAGAGATGGGGGGG - Intronic
1152829382 17:82487783-82487805 AATTTTTTGTAGAGATTGGGCGG - Intronic
1153426527 18:4971137-4971159 TATTTCAGAGAGAACTTGGGTGG - Intergenic
1155520429 18:26662474-26662496 TATTTCATCTAGAAATTACATGG + Intergenic
1156652185 18:39237598-39237620 TACTACATGCAGAAATTTGGGGG - Intergenic
1157655437 18:49383073-49383095 TATTTATTGAAGAAAATGGGTGG - Intronic
1158051973 18:53233275-53233297 AATTACATGAAGAAATAGGGAGG - Intronic
1158490447 18:57905528-57905550 TTATTTTTGTAGAAATTGGGAGG - Intergenic
1159936070 18:74368582-74368604 TTTTTAATGTAAAAATTGGCTGG + Intergenic
1159959346 18:74543315-74543337 TATTTTTTGTAGAAACAGGGGGG - Intronic
1160314474 18:77828766-77828788 CAATTCACGTAGGAATTGGGTGG - Intergenic
1161491627 19:4565321-4565343 TATTTCCTGTAGGAATTGTGAGG - Intergenic
1163623005 19:18371943-18371965 TATTTTTTGTAGAGATGGGGGGG - Intergenic
1167950852 19:53026545-53026567 TATTGCATTTAAAAATGGGGAGG + Intergenic
925125486 2:1452717-1452739 TATTTTGTTTAGAAATTTGGAGG - Intronic
927892768 2:26762789-26762811 TATTTCTAGTAGAGATGGGGGGG - Intergenic
928103488 2:28452887-28452909 TATCTCATTTACAAATGGGGTGG - Intergenic
928621425 2:33092029-33092051 TTTTTCATCTACAAATTGTGAGG + Intronic
929376560 2:41293999-41294021 TTTTGCATTTAGATATTGGGTGG - Intergenic
929591111 2:43146893-43146915 TATTTTTTGTAGAGATGGGGGGG + Intergenic
930077864 2:47421884-47421906 TATTTAATGTATCAAATGGGTGG + Intronic
930584641 2:53254794-53254816 TATTTTTTGTAGAGATGGGGTGG - Intergenic
931126843 2:59287401-59287423 GATTTCATGTAAAAATTTGCTGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
933674574 2:85042970-85042992 TATTTCCTGAAGAAATGGGGTGG - Intronic
934969088 2:98748699-98748721 TATTTTTTGTAGAGATGGGGGGG + Intergenic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
937147971 2:119663612-119663634 TATAAAATGGAGAAATTGGGCGG + Intergenic
939107681 2:137968476-137968498 TAATTCATGGAGAAGTTGTGAGG - Intronic
939807799 2:146794747-146794769 TTCTTCATATAGAAATTGAGAGG + Intergenic
939808718 2:146806404-146806426 TAGTGCATATGGAAATTGGGAGG + Intergenic
940574853 2:155489800-155489822 AATTTCAAGTAGAAATTGTAGGG - Intergenic
940605597 2:155920530-155920552 TATTTCAGGTAAATATTGTGTGG + Intergenic
940993831 2:160125758-160125780 AATTTCATTAAGAAATTGTGAGG + Intronic
941703984 2:168637835-168637857 TTTTACAGGTAGAAATTTGGAGG + Intronic
942381632 2:175397835-175397857 TGTTTCATTTAGAAAATGGAAGG - Intergenic
942432717 2:175931075-175931097 TCTTTAATGTAGAAATTGGGTGG - Intronic
944153383 2:196585957-196585979 TTTTGCATGAAGATATTGGGTGG - Intronic
944565298 2:200984431-200984453 TATTACATGTTGAAATTGAAGGG - Intronic
946487914 2:220118506-220118528 TCTTTCATGAAGAAATTGCCTGG + Intergenic
948014298 2:234675347-234675369 TATTTGATGTAAAAAATGGATGG - Intergenic
1169363021 20:4967527-4967549 TATTTACTGGAGAAATTGGGTGG - Intronic
1169688387 20:8302872-8302894 TATAACATCTAGACATTGGGAGG + Intronic
1170212065 20:13855626-13855648 TTTTTCATGTGGTAATTGTGGGG + Intronic
1171021821 20:21591420-21591442 TTTTTCATATAGAAGTAGGGAGG + Intergenic
1172221851 20:33279642-33279664 TACTTCATCTGGAAAATGGGAGG + Intronic
1173075544 20:39815475-39815497 TATTTCTTGAAGAAAGTGGCTGG + Intergenic
1173203280 20:40969824-40969846 ATTTTTATGTAGAAATTTGGAGG - Intergenic
1173280671 20:41624311-41624333 TATTTAATGTAATAATTGTGTGG + Intergenic
1174437111 20:50516733-50516755 TCTCTCAAGTAGCAATTGGGTGG + Intronic
1174517751 20:51106193-51106215 CAATTCATGTTGAAATTGGGAGG + Intergenic
1174794805 20:53513075-53513097 TTTTTTTTGTAGAGATTGGGGGG - Intergenic
1175528054 20:59649456-59649478 TATTTCATGTTGTAACTCGGGGG + Intronic
1175775482 20:61650840-61650862 TATTTCATGTAGATATTAGCAGG + Intronic
1176973101 21:15289155-15289177 TATTTCTTGTAGGAATTCTGTGG + Intergenic
1177737264 21:25107132-25107154 TAGTTCTGGTAGAAATTGGTTGG - Intergenic
1179773905 21:43646976-43646998 TATTCCATATAGACATTTGGAGG - Intronic
1180974694 22:19841886-19841908 TACTTCATAGAGAAATTAGGTGG - Intronic
1181150983 22:20883375-20883397 AATTTCATCTGGAAAATGGGTGG - Intronic
1181621358 22:24093702-24093724 TATTTTTTGTAGAGATGGGGGGG - Intronic
1181764693 22:25082864-25082886 TATTTTATATAGAAATTCTGAGG + Intronic
1181787125 22:25235499-25235521 TATTTTATGTAGAGATTTGGGGG + Intergenic
1181819120 22:25462108-25462130 AATTTCATGTAGAGATTGGGGGG + Intergenic
1182729231 22:32474303-32474325 TATTTTTTGTAGAGATGGGGGGG + Intergenic
949478508 3:4471422-4471444 TACGTCATGGAGAAATTGGACGG - Intergenic
949977438 3:9473864-9473886 TAATTCATGTGGAACTTGGCTGG - Intronic
951066251 3:18269355-18269377 TATTTCAGTTAGAGATTTGGAGG + Intronic
953346819 3:42182802-42182824 TATTGCATGGAATAATTGGGTGG + Intronic
954158557 3:48702760-48702782 GTTTTCAAGTGGAAATTGGGTGG - Intronic
955938486 3:64126130-64126152 AATTTCATGAAAAACTTGGGGGG + Intronic
956858486 3:73299296-73299318 TATGTGTGGTAGAAATTGGGAGG - Intergenic
956981355 3:74642367-74642389 TACTGCATCTATAAATTGGGTGG + Intergenic
962778744 3:138690591-138690613 TATTTCATCTAGAAAGTTGTGGG - Intronic
963838327 3:150079513-150079535 TATTTAATGTGGAATGTGGGTGG + Intergenic
964592193 3:158377320-158377342 TATTTCAACAAGAAATTTGGAGG - Intronic
964991233 3:162815213-162815235 TATGTCTTGTAGAATTTGGCTGG + Intergenic
965751070 3:171975602-171975624 TATTAGATGTAGCAATAGGGAGG + Intergenic
965823151 3:172705170-172705192 TATTTTTTGTAGAGATGGGGAGG + Intronic
968772068 4:2513801-2513823 TACTTCATATATAAATGGGGTGG - Exonic
970698222 4:18703203-18703225 TATTTCATGTTTGAATTGGGTGG - Intergenic
971317515 4:25579924-25579946 ACTATCATGTAGAAACTGGGAGG - Intergenic
971730649 4:30375335-30375357 TGATTTATGGAGAAATTGGGAGG + Intergenic
971803403 4:31321866-31321888 TATATCTTTTAGAAACTGGGTGG - Intergenic
971937805 4:33175461-33175483 TATTTTTTGTAGAGATGGGGGGG - Intergenic
972046698 4:34674091-34674113 TATTTCAAGTAGAAATAGCTAGG + Intergenic
972432812 4:39000214-39000236 TATTTTTTGTAGAGATGGGGTGG - Intronic
974166909 4:58215306-58215328 TTTTCCATGTAGATATTTGGTGG - Intergenic
975388454 4:73787240-73787262 TATTCCATGTGGATATTTGGTGG + Intergenic
975546499 4:75565707-75565729 TTTTGCATGTAGATCTTGGGAGG - Intronic
975980241 4:80149145-80149167 TTTTTCATGTTTAAAGTGGGAGG - Intergenic
976570984 4:86610624-86610646 GATTTCATATAAAAATTGGAGGG - Intronic
976768808 4:88628642-88628664 CATTTGCTGTAGAAATTGAGTGG + Intronic
976823789 4:89236622-89236644 AATTTCATGTTGAAATTTGGAGG + Exonic
977110638 4:92949634-92949656 TCTTTCAGGTAGAATTTGGTAGG + Intronic
977267340 4:94871054-94871076 TAATTCATGTAGTAAATTGGAGG + Intronic
978456463 4:108897965-108897987 TCTTTTGTGTAGAAATTAGGAGG - Intronic
980446611 4:132918838-132918860 TATTACATGTTGAAATTTGTGGG - Intergenic
980727432 4:136782552-136782574 GATTTCATGTAAAACTTGTGTGG + Intergenic
981288378 4:143046142-143046164 TATTTCTTGTAGACATTTAGTGG + Intergenic
981903913 4:149897229-149897251 TAGTTAATGTAGAAATTTGGGGG + Intergenic
982351948 4:154425607-154425629 TATATAATGTAGAGATCGGGTGG - Intronic
984154762 4:176181873-176181895 GATTTCAGACAGAAATTGGGTGG - Intronic
984654749 4:182305821-182305843 CATTTCATGTAGGGCTTGGGAGG + Intronic
986593126 5:9391912-9391934 GAGATCATGTAGAAATAGGGAGG - Intronic
987534675 5:19168648-19168670 TATATCATGCAGAGATTGGCTGG - Intergenic
987577162 5:19744779-19744801 TATTTCATGTAATAAATGTGAGG + Intronic
988206721 5:28146047-28146069 TATTGCCTGTAGACATTGTGTGG - Intergenic
990080984 5:51913311-51913333 TATTTCCTGTAAAAATTGATTGG - Intergenic
990916097 5:60907227-60907249 TATTTCAAGGAGAAAATAGGAGG + Intronic
991391424 5:66148049-66148071 GATTTTAGCTAGAAATTGGGAGG + Intronic
992040878 5:72830087-72830109 TATTTAATGTAGGAATTTGATGG + Intronic
992285268 5:75228684-75228706 TATATCATGTAGAAAATGAAAGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994117487 5:96077521-96077543 AACTTCATGTTGAAATTGTGGGG + Intergenic
995590721 5:113697176-113697198 GAGTACATGTAGTAATTGGGAGG + Intergenic
997138935 5:131357944-131357966 TGTTTCAAGGAGAAAGTGGGTGG - Intronic
997176601 5:131784646-131784668 TATTTTTTGTAGAGATGGGGGGG - Intronic
997792756 5:136776596-136776618 TTTTTAATGTACAAATTGTGAGG - Intergenic
997881932 5:137599512-137599534 TATTTGATGAAGAAATTTGATGG + Intergenic
1000156024 5:158552678-158552700 TATTTCATGTGGTTGTTGGGAGG - Intergenic
1000897059 5:166867967-166867989 TTTCTCAGGTAGAAAATGGGGGG + Intergenic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1001727355 5:173917249-173917271 TATTTCAGGTAGGAATGGTGGGG + Intronic
1002146181 5:177183178-177183200 TATTCAATGTATAAATTTGGGGG - Intronic
1002207478 5:177573489-177573511 TCTTTTAGGTAGAAAGTGGGAGG + Intergenic
1003717251 6:8661128-8661150 TATTTGATGTTAAAATTGGTGGG + Intergenic
1003930786 6:10922239-10922261 TACTTCCTGTAGAAATTGTGAGG - Intronic
1003963679 6:11233057-11233079 CGTTTCATGTAGAGATTGTGAGG - Intronic
1004141891 6:13025791-13025813 TACATCATATAGAAATTGGTAGG + Intronic
1005529424 6:26687923-26687945 TATTTCATAAAGAAGTTTGGTGG + Intergenic
1005541372 6:26813723-26813745 TATTTCATAAAGAAGTTTGGTGG - Intergenic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007678649 6:43618945-43618967 TATTTTATTTATAAATTGGGGGG + Intronic
1008092137 6:47304659-47304681 TATGTCATGCAGGAATTTGGTGG + Intronic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1009012175 6:57855787-57855809 TATTTCATAAAGAAGTTTGGTGG - Intergenic
1011302011 6:85885630-85885652 TATTTAAGGTAAATATTGGGAGG + Intergenic
1012277311 6:97290016-97290038 TATCTCATCTAGAAATCCGGAGG - Intergenic
1012796008 6:103762104-103762126 GTTTTAATGTATAAATTGGGGGG + Intergenic
1013296577 6:108762979-108763001 TATTGGATTTAGAAATTTGGAGG - Intergenic
1014282543 6:119457755-119457777 AATTACATGGAGAAATTTGGGGG + Intergenic
1015138841 6:129907211-129907233 TATTTATTGTGGAGATTGGGTGG + Intergenic
1015341363 6:132104729-132104751 TATTTAATGTAGGATATGGGTGG - Intergenic
1015560336 6:134508627-134508649 TATTTCATGAAAAAAGTGGCTGG + Intergenic
1016785334 6:148005341-148005363 TATTTACTGTAGAAATCGGATGG + Intergenic
1018628337 6:165801852-165801874 TATTTCATGCAGTCATTGGTAGG - Intronic
1019204924 6:170352451-170352473 TATATTATGTTGAATTTGGGTGG - Intronic
1019503894 7:1380890-1380912 TATTTTTTGTAGAGATTGTGGGG - Intergenic
1020418593 7:7972596-7972618 TAATTTATTTAGAAATTGAGTGG - Intronic
1022199017 7:28097783-28097805 TTTTGCATGTAGAAATGGGAGGG + Intronic
1022783653 7:33613192-33613214 TATTTCATCTGCAAAGTGGGGGG + Intergenic
1022839923 7:34154183-34154205 TATTTCATGTATAAAATGAAAGG + Exonic
1023088062 7:36592228-36592250 TTTCTGATGTTGAAATTGGGGGG + Intronic
1023343941 7:39252031-39252053 CATTTCAGATAGAAATTGGGCGG - Intronic
1023597633 7:41848808-41848830 GAATTCATGTAAAAATAGGGGGG - Intergenic
1023821061 7:43980711-43980733 TATTTTTAGTAGAGATTGGGCGG - Intergenic
1024381408 7:48701298-48701320 CATTGCTTGTAGAAATTTGGAGG + Intergenic
1024882474 7:54104310-54104332 TATTTCACGTTGAAATTGTAAGG - Intergenic
1026220105 7:68388771-68388793 TATGTCATGTGGAAATTAGAGGG - Intergenic
1026322101 7:69277097-69277119 TATTTGTTGTAGAGATGGGGGGG + Intergenic
1026328024 7:69327751-69327773 TATTTTTTGTAGAGATGGGGGGG - Intergenic
1027328235 7:77064863-77064885 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1027936745 7:84615197-84615219 TGTTTCATGTAGAAATAAGGAGG + Intergenic
1029529974 7:101118867-101118889 TATTTTTTGTAGAGGTTGGGGGG + Intergenic
1029544864 7:101205321-101205343 TATTTTTTGTAGAGATGGGGGGG + Intergenic
1029642812 7:101831917-101831939 TATTTTTTGTAGAGATGGGGGGG + Intronic
1029746585 7:102518571-102518593 TATTTTTAGTAGAAATGGGGGGG + Intergenic
1029764523 7:102617546-102617568 TATTTTTAGTAGAAATGGGGGGG + Intronic
1030002078 7:105075559-105075581 TATTTCTGATAAAAATTGGGAGG - Intronic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1030796282 7:113791865-113791887 CATTTAATGGAGAAGTTGGGAGG - Intergenic
1032644308 7:133805460-133805482 TTTTTCATGTAGACATTGTTTGG - Intronic
1033355075 7:140592773-140592795 TATTTTTTGTAGAGATAGGGGGG + Intronic
1035967959 8:4215577-4215599 TATTTCATGTATAAATTTTAGGG - Intronic
1036732114 8:11275053-11275075 TATGTCTTCTTGAAATTGGGTGG + Intergenic
1037238087 8:16745044-16745066 TATTTCATATTGAAATTGATTGG + Intergenic
1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG + Intergenic
1039323369 8:36457747-36457769 TATTTCAAGTATAATTTGGTAGG - Intergenic
1042777230 8:72446592-72446614 TATTTCATTTATAAATTAAGAGG - Intergenic
1042822233 8:72942691-72942713 TCTTTCATTTAGAAATTGAGAGG - Intergenic
1042832256 8:73043961-73043983 AATTTCATATACAAATTTGGGGG - Intronic
1043467134 8:80521354-80521376 TATTTCTGGTAGAAATTAGTTGG + Exonic
1044300766 8:90580522-90580544 TATTTGGTGTAAAAAATGGGTGG + Intergenic
1045050898 8:98324127-98324149 TTTTCCATATAGAAATTGAGAGG - Intergenic
1045779516 8:105847513-105847535 TATTTCAGGGAGAAACTAGGAGG - Intergenic
1046237343 8:111442846-111442868 TATTTCATTTAGAACTTGTTTGG + Intergenic
1046736681 8:117783561-117783583 TATAGCTTGTAGAAATTGGCAGG - Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1047828222 8:128602342-128602364 TATTTGTTTTAGAAGTTGGGTGG - Intergenic
1048102177 8:131364773-131364795 TCTTCCAAGTAGAAATTAGGAGG - Intergenic
1050823249 9:9910253-9910275 TATTTTATGTAAAAATTCAGGGG - Intronic
1051245137 9:15102332-15102354 TATTTCATGAGGAAGTTGTGAGG + Intergenic
1051245344 9:15104799-15104821 TATAGTATGGAGAAATTGGGAGG + Intergenic
1051865927 9:21682634-21682656 TATTTAATACAGAAAATGGGTGG - Intergenic
1052544339 9:29854226-29854248 TATCTAATGTTGAAATTGGAAGG + Intergenic
1057603438 9:96479997-96480019 TATTTTTTGTAGAGACTGGGTGG - Intronic
1058948573 9:109881810-109881832 GATTTCAGGTAGAATTTGGTGGG - Intronic
1060117945 9:120959565-120959587 TTTTTCATTTTGAAATTGGAAGG - Intronic
1062294577 9:135817569-135817591 TATTTTTTGTAGAGATGGGGGGG + Intronic
1185546048 X:946633-946655 CATTTAAAGTAGAAATTTGGAGG + Intergenic
1185818155 X:3175709-3175731 AATTTTTTGTAGAGATTGGGTGG + Intergenic
1185848040 X:3458107-3458129 AATTTCATATATAAATTTGGTGG + Intergenic
1187620805 X:21051884-21051906 TATTTCATGTTAAAATTTGGGGG + Intergenic
1189184236 X:39038567-39038589 TATTTCATGTAAACAATTGGAGG + Intergenic
1189246099 X:39564720-39564742 ATATTCATGTAGAATTTGGGGGG + Intergenic
1190068803 X:47262273-47262295 TATGTCCTGTAAAAATGGGGAGG - Intergenic
1194019405 X:88668439-88668461 TATTTCATTAAGAGATTTGGTGG + Intergenic
1194891657 X:99386098-99386120 TTGTTCATGTAGCAATTTGGTGG + Intergenic
1195430523 X:104784121-104784143 AATTTCATGCTGAAATTGGGTGG + Intronic
1195431511 X:104794734-104794756 TATTTCATGAGGGAATTAGGTGG + Intronic
1196925250 X:120627937-120627959 TATTTCAATTAGAAATTAAGAGG + Intronic
1198783510 X:140261635-140261657 CACTTCATTTAGAAATAGGGTGG + Intergenic
1199886265 X:152024755-152024777 TTTTTCATCTAGAAAATGTGGGG + Intergenic
1200016406 X:153167370-153167392 TTTTTAAAATAGAAATTGGGAGG + Intergenic