ID: 1001006645

View in Genome Browser
Species Human (GRCh38)
Location 5:168057489-168057511
Sequence GCAGCTAGCTAGTTTTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001006645_1001006648 -7 Left 1001006645 5:168057489-168057511 CCTGCCTAAAACTAGCTAGCTGC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1001006648 5:168057505-168057527 TAGCTGCTTAGTAACAAGGATGG 0: 1
1: 0
2: 1
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001006645 Original CRISPR GCAGCTAGCTAGTTTTAGGC AGG (reversed) Intronic
910787409 1:91015390-91015412 GTAGGTAGCTAGATTGAGGCGGG - Intronic
917756857 1:178110200-178110222 GTAGCTGTCTAGTGTTAGGCTGG - Intronic
918918092 1:190670869-190670891 TCAGCTAGCTAGTTGGTGGCAGG - Intergenic
921137689 1:212276522-212276544 GCAGCTAGGTATTTTAAGACAGG + Intergenic
921224118 1:213000006-213000028 GCACCTAGGTAGTGTTAGGAAGG - Intronic
1065578105 10:27144107-27144129 GCTGCTTGCTAGGTTTAGGCAGG - Intronic
1065742143 10:28806683-28806705 GCATCAAGCTATTTTTAGGAGGG + Intergenic
1067011318 10:42716497-42716519 GCAGATAGATAGCTTGAGGCCGG - Intergenic
1069765709 10:70857022-70857044 GCAGGTAACTAGTTTTATGTGGG + Intronic
1074654510 10:115569989-115570011 GGAGCTAGCTAGCTTTCTGCTGG + Intronic
1076813293 10:132900069-132900091 ACAGCTAGTTAGTTTTGGGTTGG - Intronic
1084102108 11:66956625-66956647 GCAGCTAGAAAGTTTTATTCTGG - Intronic
1093446381 12:19264258-19264280 ACAGCTAGTTAGTGTTAGGCAGG + Intronic
1094190171 12:27689905-27689927 GCAGCTAGCTACATTCTGGCAGG + Intronic
1097219188 12:57437091-57437113 GCACCCAGCTATTTTTAGCCCGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1119213416 14:72849819-72849841 TGAGTTAGCTAGGTTTAGGCTGG + Intronic
1121015582 14:90546930-90546952 GCCGCTAGCTACCTGTAGGCGGG - Intronic
1127149577 15:56059672-56059694 CCAGGCAGCTAGTTTTTGGCAGG + Intergenic
1128519763 15:68367597-68367619 GAAGCAGGATAGTTTTAGGCAGG - Intronic
1130832863 15:87619524-87619546 GCAGCTAGCTAGAACCAGGCAGG - Intergenic
1139391794 16:66610063-66610085 GATGCCAGCTAGTTTGAGGCTGG + Intronic
1150233013 17:63568915-63568937 AAAGCTATCTAGTTTTAGCCTGG - Intronic
1158205534 18:54988909-54988931 AAAGCTCACTAGTTTTAGGCTGG + Intergenic
1165255628 19:34576082-34576104 GCAGCTACCTAGTTTGGGGATGG + Intergenic
1167326107 19:48826838-48826860 GCAGCTGACCAGTTTGAGGCTGG - Intronic
928100929 2:28437047-28437069 GCAGGCAGCTTGTTTCAGGCAGG + Intergenic
930810168 2:55531851-55531873 GCAGCTAACTACTTAGAGGCAGG - Intronic
932609524 2:73188339-73188361 GCAGGTAGATAGTGTTGGGCAGG - Intergenic
933189064 2:79312902-79312924 GCAGCCAGCTAGTTTTTGAAAGG - Intronic
935605397 2:104967733-104967755 GCTGCTAGCTAGTTTGAGTTGGG + Intergenic
937753778 2:125511347-125511369 TCAGTAAGCTATTTTTAGGCTGG - Intergenic
1170273383 20:14554061-14554083 GCAGCTAGCAAATATTAAGCTGG - Intronic
950864342 3:16176673-16176695 GCAGCTTGTTAGTTTTAGTTTGG + Intronic
961424103 3:126831332-126831354 GCAGCACGCTAGTTAAAGGCTGG - Intronic
962142504 3:132805217-132805239 GCTGATAGCTAGTTTTGGGTGGG + Intergenic
964267461 3:154915038-154915060 GCAGCTAGAGAGTTTTATGATGG + Intergenic
970215039 4:13750079-13750101 GCAAATAGCTACTTTTAGGCAGG + Intergenic
973828664 4:54736071-54736093 GCAGCTAGCTAGCTGTAGTTAGG - Intronic
974933386 4:68386012-68386034 GCAGCTAGCAAGTCTTAGCATGG + Intergenic
975180474 4:71338853-71338875 GCAGTTAGCCAGTTATTGGCAGG + Intronic
992295566 5:75323363-75323385 GCACCTAGATAGTGTTAGGGTGG - Intergenic
993887509 5:93433286-93433308 GCATATAGATTGTTTTAGGCTGG - Intergenic
998346244 5:141466579-141466601 GTAGCTAGCTTGTTTTAAGAAGG - Intronic
1001006645 5:168057489-168057511 GCAGCTAGCTAGTTTTAGGCAGG - Intronic
1001923888 5:175622171-175622193 GCCCCTAGATAGTTTTAGGATGG - Intergenic
1002278096 5:178115984-178116006 ACAGCTGGCTAGATTTGGGCTGG - Intronic
1003916999 6:10796114-10796136 GCTGCTGGCTAGTTTTTGGCTGG + Exonic
1013560300 6:111296876-111296898 ACAAGTAGCTACTTTTAGGCTGG - Intergenic
1015344155 6:132135924-132135946 GTAGCTAGCTAGTTTTAAGGAGG - Intergenic
1022315377 7:29240473-29240495 GCAGAAAGCTAGTCTTGGGCAGG + Intronic
1027347079 7:77271703-77271725 CCAGCTCTCTAGTTTCAGGCAGG - Intronic
1028908388 7:96179967-96179989 GCAGGCAGCTAGTTTAAGCCAGG - Intronic
1029595063 7:101533346-101533368 GCAGCAGGCTGGTTTTGGGCAGG + Intronic
1033265900 7:139886840-139886862 GCAGCTAACAATCTTTAGGCTGG - Intronic
1033825384 7:145183568-145183590 TCACCTCGCTAGTTTTAGTCTGG + Intergenic
1040851424 8:51904741-51904763 ATAGCTAGATTGTTTTAGGCAGG + Intergenic
1041008002 8:53514671-53514693 ACAGCTAGCTGGTCTAAGGCCGG + Intergenic
1046655592 8:116890871-116890893 GCACCTAGGTAGTTTCAGGATGG + Intergenic
1057420424 9:94907775-94907797 GCAGCTAGCTAGCTTTGTGAAGG + Intronic
1057427971 9:94969261-94969283 GGAGGTATCCAGTTTTAGGCTGG + Intronic