ID: 1001008330

View in Genome Browser
Species Human (GRCh38)
Location 5:168074627-168074649
Sequence GTGGTTAACCAGACTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001008330_1001008334 -1 Left 1001008330 5:168074627-168074649 CCCTCTGCAGTCTGGTTAACCAC 0: 1
1: 0
2: 0
3: 2
4: 117
Right 1001008334 5:168074649-168074671 CCAGTCTCCTCCTCACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001008330 Original CRISPR GTGGTTAACCAGACTGCAGA GGG (reversed) Intronic
900523923 1:3119333-3119355 GTAATTAACCAGACCCCAGAGGG - Intronic
902395465 1:16130164-16130186 GTGGTTCAAGAGTCTGCAGAAGG + Intronic
902422644 1:16293530-16293552 GTGGTGGTCCAGTCTGCAGATGG - Intronic
903327701 1:22580562-22580584 CTGGCAAACCAGGCTGCAGAGGG - Intronic
905954583 1:41981550-41981572 GTGGTTACCCAGTTTGCAGAAGG - Intronic
906647631 1:47487249-47487271 GTGATGAACCAGACTCCACAGGG - Intergenic
907048080 1:51312144-51312166 GCGGTTCACCAGGCTGCTGAAGG + Exonic
907545692 1:55258155-55258177 GAGGTTAACCAGACTTCCCAGGG - Intergenic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
921448666 1:215276726-215276748 GAGGTGGTCCAGACTGCAGATGG + Intergenic
922244600 1:223783263-223783285 CTGGATATCCAGGCTGCAGAAGG - Intronic
924222196 1:241889139-241889161 GTTCTTAACCAGACTTGAGAAGG + Intronic
1063393279 10:5664085-5664107 GTGGCTAACCAGGATACAGAAGG + Intronic
1064409606 10:15093457-15093479 GTGGTGAAGCAGGCTTCAGAGGG - Intergenic
1065698410 10:28401568-28401590 GGGATGAACCAGGCTGCAGAGGG + Intergenic
1065964981 10:30763592-30763614 GTGGTTAACCCCACTTCAGGGGG - Intergenic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1069255612 10:66328717-66328739 GTGGGTCTCCAGCCTGCAGAAGG - Intronic
1070284819 10:75075309-75075331 GTGGTTAACCAGAAGACTGATGG + Intergenic
1074208580 10:111306199-111306221 GTGTTTAGCCATACGGCAGAAGG + Intergenic
1075133981 10:119765997-119766019 CTGGTTCTCCAGATTGCAGATGG - Intronic
1076731626 10:132442278-132442300 ATGTTTAACCAGTCTTCAGAGGG + Intergenic
1079496216 11:21047721-21047743 ATGTTTAGCCAGACTTCAGAGGG + Intronic
1079979263 11:27131987-27132009 GTGGGTCACAAGACTGGAGATGG - Intergenic
1080148488 11:29019755-29019777 GTGTTTATCCAGATTCCAGAAGG + Intergenic
1086544781 11:87955014-87955036 GTTGTTGAACAGACTGCAAAAGG + Intergenic
1090367861 11:126222978-126223000 GTGGAAAACCAGGCTACAGATGG + Intronic
1100648249 12:96554526-96554548 GTGTTTAAGCAAACTGCAAAGGG + Intronic
1101068871 12:101052050-101052072 GTGGTTTACAAGACTTCTGAAGG + Intronic
1102817007 12:115874580-115874602 GTGGTTGACCAGAAGGGAGAAGG + Intergenic
1105417772 13:20227943-20227965 GTGGGTGGACAGACTGCAGAGGG + Intronic
1105838506 13:24232112-24232134 CTGGTTCTCCAGGCTGCAGATGG - Intronic
1108754895 13:53487708-53487730 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1109995106 13:70112883-70112905 CTGGTTAATCACACTGCTGAGGG + Intergenic
1114926022 14:27400062-27400084 TTGTTTAACCTGACTGCATACGG - Intergenic
1115034492 14:28840702-28840724 CTTGGTAACCACACTGCAGAAGG - Intergenic
1116578271 14:46604479-46604501 GTGGTTCTCCAGTTTGCAGATGG - Intergenic
1117226394 14:53664821-53664843 GTGGTTAATTATAATGCAGAAGG - Intergenic
1117420642 14:55541585-55541607 CTGGTCAACCAGACTGAAGCAGG + Intergenic
1125791939 15:42373692-42373714 GTAGGTAACTTGACTGCAGATGG - Intronic
1129080381 15:73034050-73034072 GTGGTGAACCTGCCTGCACAGGG + Intergenic
1130062674 15:80580977-80580999 CTTGGTAACCAGACTCCAGAGGG + Intronic
1137879625 16:52032723-52032745 CTGGTTTAGCAGACAGCAGAGGG + Intronic
1143485990 17:7254573-7254595 ATGGTAAACCAGCCTGCAAAGGG - Exonic
1145101963 17:20085008-20085030 GAGGTTTACCAGACAGTAGAGGG + Intronic
1148022565 17:44562996-44563018 GTGAGTAGCAAGACTGCAGAAGG - Intergenic
1152768424 17:82153200-82153222 CTGGTAAAACAGATTGCAGATGG + Intronic
1152986040 18:322054-322076 CTGGTTCATCAGAATGCAGAGGG + Intronic
1156811637 18:41260041-41260063 GTGGGTAACCAGCCTTCACAAGG + Intergenic
1159873038 18:73779815-73779837 GTGGGTCACCAGCCAGCAGATGG - Intergenic
1163378243 19:16947398-16947420 GTGGGGCACCAGACAGCAGAGGG - Intronic
1164484533 19:28643471-28643493 CTGGTGAGCCAGCCTGCAGAGGG - Intergenic
1165246364 19:34500539-34500561 GTGGGTCACCAGGCTGGAGAGGG + Exonic
1165947623 19:39453885-39453907 GGGTTTCACCAGACTACAGAAGG - Intronic
1166200262 19:41232913-41232935 GTGGTTAACCAGATTGTCCAAGG + Intronic
927928142 2:27027051-27027073 GTGGTGAACCAGGCTGCTGGAGG - Exonic
929225466 2:39507668-39507690 GGGGTTCACCATGCTGCAGATGG + Intergenic
932002919 2:67900905-67900927 GTGGTACACCAGAAGGCAGAAGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938301989 2:130221896-130221918 TTGGTTCTCCAGAATGCAGATGG + Intergenic
938454712 2:131452556-131452578 TTGGTTCTCCAGAATGCAGATGG - Intergenic
946570124 2:221015314-221015336 TTGGTTCTCCAGCCTGCAGAAGG - Intergenic
1168818664 20:758640-758662 GCGTTAAACCAGACTGCAGTGGG - Intergenic
1174239309 20:49120100-49120122 GTTGGAAACCACACTGCAGAAGG - Exonic
1174408112 20:50316110-50316132 GGGGTCAGCCAGACTGCAGCAGG - Intergenic
1176895904 21:14378121-14378143 GTGGTAAACCTTACTACAGAAGG + Intronic
1181938800 22:26458626-26458648 GTGGTTAACTAGCCCTCAGAAGG - Intronic
1182619677 22:31612015-31612037 GTTCTTATGCAGACTGCAGACGG - Intronic
950413724 3:12856290-12856312 GGGGGTAACCATACTGCAGATGG - Intronic
952577711 3:34794835-34794857 CTAGTTGAACAGACTGCAGAGGG + Intergenic
952959189 3:38579193-38579215 GTGGAAGACCAGTCTGCAGAGGG - Intronic
953008015 3:38995718-38995740 CTGGTTCTCCAGCCTGCAGATGG + Intergenic
955795900 3:62636743-62636765 GTGGATACCCAGGCTGTAGAGGG + Intronic
955844418 3:63146674-63146696 ATGGTTCTCCAGTCTGCAGATGG + Intergenic
959144615 3:102529859-102529881 GTGGGGAATCAGGCTGCAGAGGG - Intergenic
962459861 3:135600757-135600779 CTGGTTCTCCAGACTGCAGGTGG - Intergenic
962740424 3:138359267-138359289 GTGGTGAACCAGGCTGGAGGTGG - Intronic
964473849 3:157081621-157081643 GTGGATAACAAGACCGCAAATGG + Intergenic
967817951 3:193815037-193815059 GGGGTTACCCAGACAGCAAAAGG + Intergenic
971487002 4:27170767-27170789 CTGGTTTTCCAGCCTGCAGATGG - Intergenic
977015943 4:91693488-91693510 ATGGTTCTCCAGACTCCAGATGG - Intergenic
977915383 4:102586680-102586702 AGAGTTCACCAGACTGCAGAAGG + Intronic
985570568 5:642623-642645 GGGGTTAGGCAAACTGCAGAGGG - Intronic
986173241 5:5330723-5330745 CTGGTTCTCCAGGCTGCAGAGGG + Intergenic
986824688 5:11507688-11507710 GTGGGAAACCAGACAGCACAGGG + Intronic
986973321 5:13363721-13363743 GTGGTTTTCCAGCTTGCAGATGG - Intergenic
990771948 5:59257406-59257428 GTGGTTCCCCAAACTGCAGTAGG - Intronic
992785488 5:80166870-80166892 GTGGTAAACCAGATTTCATAGGG + Intronic
997261802 5:132470960-132470982 CTGGATAACCAGTCTGCTGAGGG - Intronic
997484662 5:134220109-134220131 GTGGTAGACCAGGCTGAAGAAGG - Intronic
1001008330 5:168074627-168074649 GTGGTTAACCAGACTGCAGAGGG - Intronic
1005291817 6:24387105-24387127 GTGGTTGATGAGAGTGCAGACGG - Intergenic
1009209718 6:60847590-60847612 CTGGTTCTCCAGCCTGCAGAAGG - Intergenic
1010034363 6:71306351-71306373 TTGGATAACTAGAATGCAGAAGG - Exonic
1010960655 6:82141978-82142000 CTGGTTAACCAGACTTCTGCTGG - Intergenic
1011738939 6:90340121-90340143 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1013859546 6:114618790-114618812 ATGGTTCACCAAACTGTAGAGGG - Intergenic
1019060340 6:169252927-169252949 GTGTTTAATCAGACTGCTGTTGG - Intronic
1019856631 7:3615197-3615219 GTTGTTAAACAGAGTGCAAATGG + Intronic
1027247602 7:76377825-76377847 GTGGGCAGCCAGACTGCAGGGGG + Intergenic
1028987222 7:97017974-97017996 CTGGTAAACCAGTCTGCAGCGGG - Intergenic
1030858461 7:114591678-114591700 GTGGTAAATCAGACTGGAAATGG - Intronic
1031561382 7:123242939-123242961 CTGGTTCACCAGCTTGCAGATGG - Intergenic
1032999684 7:137490670-137490692 TTGGTTAACCATAGTGTAGAAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1039768610 8:40659505-40659527 GTGGTCAAACAGAATGGAGAGGG + Intronic
1040602948 8:48902377-48902399 GTGGTTTCCCAGACTCCACAGGG + Intergenic
1043511101 8:80950864-80950886 GTGATTATCCACACTGGAGAAGG - Intergenic
1044086869 8:87953193-87953215 GTGCCTAACCAGGTTGCAGAAGG - Intergenic
1045280478 8:100745547-100745569 GTGATTATCCAGACTTCAGCCGG - Intergenic
1048604116 8:135949804-135949826 GTGGTTAAAGAGACTGCCCATGG - Intergenic
1055129168 9:72754548-72754570 GTGGTTGACCTGACTGCTGGTGG + Intronic
1056934197 9:90903368-90903390 ATGGATAATCAGGCTGCAGAGGG - Intergenic
1057691923 9:97293209-97293231 GTGGTTAATGCCACTGCAGATGG + Intergenic
1058298388 9:103338596-103338618 GTGGTTCACCAGAGTACAAAAGG + Intergenic
1062098110 9:134712937-134712959 GTGGGTGACCAGGCTGCAGCCGG + Intronic
1192047888 X:67695720-67695742 GTGTTTAGACAGACTGGAGAAGG - Intronic
1192451076 X:71245458-71245480 GTGAGCAACCAGAGTGCAGAGGG - Exonic
1198675812 X:139128920-139128942 GTGCTGAAATAGACTGCAGAAGG - Intronic
1201677243 Y:16600334-16600356 GTGGTGAACCAGGATGCAAATGG - Intergenic