ID: 1001008664

View in Genome Browser
Species Human (GRCh38)
Location 5:168077358-168077380
Sequence GAACAGTGCTTGGCCCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 3, 2: 29, 3: 173, 4: 636}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001008664 Original CRISPR GAACAGTGCTTGGCCCATAG TGG (reversed) Intronic
900602296 1:3508357-3508379 GAACAGTGCGTGGCATAGAGTGG + Intronic
901036020 1:6336728-6336750 GAACAGTGCCTGGCACACTGTGG - Intronic
901350124 1:8588039-8588061 TTACAGTGCATGGCACATAGTGG - Intronic
901424250 1:9171240-9171262 GAACAGTGCCTGACGCGTAGTGG - Intergenic
901448103 1:9320214-9320236 GAACAATGCTTGGCACACAGTGG - Intronic
901558501 1:10050628-10050650 GCACAGGGCTTGGCACAGAGTGG + Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901789853 1:11648417-11648439 GCACAGTGCTTGCCACAAAGTGG - Exonic
902068729 1:13713284-13713306 GGGCAGTGCTTGACACATAGTGG + Intronic
902601326 1:17541377-17541399 GAACAGTGCCTGGTGCATAGTGG + Intronic
902604893 1:17563579-17563601 GAACAGGACTTGGCTCATGGAGG + Intronic
902670668 1:17971134-17971156 GATCAGAGCTTTGCCCATCGTGG + Intergenic
902772315 1:18652321-18652343 GAATAGCGCCTGGCACATAGTGG - Intronic
902833141 1:19030340-19030362 GCACAGTGCTCAACCCATAGGGG + Intergenic
902840455 1:19070828-19070850 GAACAGTGCTCAGTGCATAGAGG - Intergenic
902893148 1:19459596-19459618 GCACAGTGCCCGGCCCACAGTGG - Intronic
903016506 1:20365512-20365534 GAAATGTGCTTGGCCCAGTGTGG + Intergenic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903070630 1:20725424-20725446 AGAGAGTGCTTGGCCCAGAGCGG - Intronic
903164572 1:21511089-21511111 GAACAGAGCTTGGCACACGGCGG - Intronic
903210525 1:21815667-21815689 TAACAGTACTTGCCCCATAGGGG + Intronic
903382735 1:22908258-22908280 GGACAGTGCTTGGCCCAATTGGG - Intronic
903501555 1:23802854-23802876 GCACAGGGCCTGGCCCACAGAGG + Intronic
903560393 1:24222616-24222638 GAACAGTGCTTAGCGCACATTGG + Intergenic
903800431 1:25963266-25963288 GAACAGAGTGTGGCACATAGTGG - Intronic
903819885 1:26094140-26094162 GGACAGTGCTGTGCCCGTAGGGG + Intergenic
904054492 1:27661135-27661157 GAACAGTGCCTGGCATCTAGAGG - Intergenic
904085693 1:27906018-27906040 GAGCAGTGCTAGTCACATAGTGG - Intronic
904088272 1:27926478-27926500 TCACAGTTCTTGGCACATAGAGG + Intergenic
904113813 1:28147398-28147420 GAAGAGTGCTGGGCCCCTGGAGG + Exonic
904289600 1:29475610-29475632 ACACAGGGCTTGGCCCAGAGTGG - Intergenic
904383154 1:30124966-30124988 GCACAGAGTTTGGCACATAGAGG + Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904956194 1:34285847-34285869 AAACAGTGCTTGGCCCATAGTGG + Intergenic
905092315 1:35439443-35439465 GCACAGGGCCTGGCACATAGTGG + Intronic
905237480 1:36560191-36560213 GCACAGGGCATGGCCCAGAGTGG - Intergenic
905524822 1:38628520-38628542 GAACAGTGTGTGGCACATAGAGG + Intergenic
905653323 1:39671090-39671112 GAATAGAGGTTGGCCCACAGCGG - Intronic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906937039 1:50223518-50223540 GAAGAGTGCCTGGCAAATAGTGG - Intergenic
907081677 1:51629347-51629369 GAGCAGTGCCTGGCACTTAGTGG + Intronic
907263274 1:53238143-53238165 GAACAGAGCCTGGCACACAGTGG + Intronic
907357034 1:53884393-53884415 GATCAGTACTTGGCACATTGTGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907740699 1:57163076-57163098 GGCCAGTGCTTGGCACGTAGTGG - Intronic
907866511 1:58404569-58404591 GGAGAGTGCTTGGCCCAGAGCGG + Intronic
907885667 1:58590486-58590508 GGACTGTGCTTGGCCCTTTGAGG + Intergenic
907898211 1:58713173-58713195 GAACAGTGTCTGGCACATAGTGG - Intergenic
907925950 1:58955347-58955369 GAACAGTGCCTGCCACATAGTGG + Intergenic
908406801 1:63822238-63822260 TAACAGTGTCTGGCACATAGTGG + Intronic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
908530087 1:65026065-65026087 TAAAAGTGCCTGGCACATAGAGG + Intergenic
908663515 1:66463730-66463752 GAACAGTGCCTGACACATAATGG + Intergenic
908869537 1:68593026-68593048 GAATAGTGCTTGACACACAGTGG + Intergenic
909929097 1:81474366-81474388 AAATAGTACTTGGCCCATAGTGG + Intronic
910259029 1:85278114-85278136 GAACAGTGTCTGGCACATAGTGG - Intergenic
910448055 1:87318829-87318851 GAACATTGGTTGGCACATAATGG + Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911172555 1:94784570-94784592 GAACTGAGCTTGGCCCTGAGGGG + Intergenic
911211074 1:95138274-95138296 GCACAGTGCCTGGCTCATGGTGG + Intronic
911380028 1:97102681-97102703 GGACAGTTCCTGGCCCAGAGTGG - Intronic
911632279 1:100196730-100196752 GAAGAATACTTGGCACATAGTGG - Intronic
911645491 1:100333413-100333435 GAACAGTACCTGGCACATAATGG - Intergenic
911747999 1:101462310-101462332 GAAAAGTGCATGGCACATGGTGG - Intergenic
911853048 1:102842629-102842651 GAAGAGTCCTTGGGCCTTAGGGG + Intergenic
912204573 1:107495723-107495745 GCACAGTGCTTGGCATATTGAGG - Intergenic
912246883 1:107968875-107968897 GAAGAGTGCTTGACACATAGTGG - Intergenic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
913119918 1:115730456-115730478 GAAGAGTGCCTGGCACATAAAGG + Intronic
913130560 1:115834818-115834840 GAACAATGTTTGGCACACAGTGG + Intergenic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914447774 1:147764438-147764460 GAACAGTGGTAGGCACATAAAGG - Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
915681438 1:157585519-157585541 GAACATAGCTTGGCCCAGTGTGG + Intronic
915890812 1:159772113-159772135 GAACAATGCTTGGCACAGTGAGG - Intergenic
916656149 1:166876783-166876805 GAGCAGCGCCTGGCACATAGTGG + Intergenic
916730832 1:167565261-167565283 GAACAGTGCCTGGGCCACACAGG + Intergenic
917296737 1:173527586-173527608 GAAAAGTGCCTGGGACATAGTGG - Intronic
917636491 1:176942171-176942193 GAACAGTTCCTGACCCATAGTGG - Intronic
918337368 1:183531543-183531565 GAAAAGTGCATGGTACATAGCGG - Intronic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919517458 1:198544606-198544628 GAACAGTGCTTTGCACATAGTGG + Intergenic
919643200 1:200065681-200065703 GAACAGGGCTTGACACATACTGG - Intronic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919827522 1:201514007-201514029 GCCCAGTGCTTGGCACATAGTGG - Intergenic
919956010 1:202416717-202416739 GAGCAGTGTCTGGCACATAGTGG + Intronic
920179997 1:204126723-204126745 CAACAGTGCCTGGCACGTAGTGG - Exonic
920503962 1:206503513-206503535 GAACAGTGCTTGATACATAGTGG + Intergenic
920769457 1:208867391-208867413 GAAGAGTGCTAGACTCATAGAGG - Intergenic
921034927 1:211367843-211367865 GGACAGTGCCTGGCACAGAGAGG - Intronic
921055957 1:211542675-211542697 TAACAGTGTTTGGCACATGGTGG - Intergenic
921070809 1:211656147-211656169 AAACAGTGCCTGGCTCATAGTGG + Intergenic
921848543 1:219909257-219909279 GAACAGTACCTGGCACATAGTGG - Intronic
922567287 1:226608914-226608936 GAACCCTGCTTGGCCCCTAGAGG - Exonic
923580552 1:235207667-235207689 GCACAGTATTTGGCACATAGTGG + Intronic
924636437 1:245792172-245792194 GAAGAGTGCTTGGCTGATTGTGG - Intronic
1062921945 10:1286788-1286810 GAACAGTGCTGGTGTCATAGGGG + Intronic
1063614891 10:7592942-7592964 GCACACTGCTGGGCCCAGAGTGG + Intronic
1064371924 10:14759604-14759626 GAACAATGCCTGGCACCTAGAGG + Intronic
1065537912 10:26732668-26732690 GAACAGTGCCTAGCACATAGTGG + Intronic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1070275672 10:75004272-75004294 GCACAGTGCCTAGCACATAGAGG + Intronic
1070392408 10:75982847-75982869 GAACAATGCCTGCCACATAGTGG - Intronic
1070566884 10:77610346-77610368 AGACAGTCCTTGGCACATAGAGG + Intronic
1071457314 10:85860947-85860969 GAATAGTACTTGGCACACAGGGG - Intronic
1071707068 10:88010821-88010843 GAACAGTGCTTGACCCATAATGG - Intergenic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1071821186 10:89282690-89282712 GAATAGTGCCTGGCACATAATGG - Intronic
1071972854 10:90925604-90925626 GAAAAGTGCCTGACACATAGTGG + Intergenic
1072105802 10:92272622-92272644 GTACAGAGCCTGGCCCATGGAGG - Intronic
1072316219 10:94205921-94205943 GAACAGTGCATGGCACACAGTGG - Intronic
1072618706 10:97066222-97066244 GGACAGTGCCTGGCCCACAGTGG + Intronic
1072820552 10:98552381-98552403 GAACTGTGCCTGGCACATATAGG + Intronic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1074153102 10:110776061-110776083 CAACAGTGATTGGCTCATGGGGG - Intronic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1074956491 10:118395929-118395951 GAAGAGTGCTTGGCACATCGTGG + Intergenic
1075015586 10:118908082-118908104 GCACAGTACCTGGCTCATAGTGG - Intergenic
1075799851 10:125146841-125146863 GTACTGTGCCTGGCCCCTAGTGG + Intronic
1075933927 10:126323591-126323613 GTGCAGTGCTTGGCACAGAGTGG - Intronic
1075960762 10:126566316-126566338 GCACAGTGCCTGACACATAGGGG - Intronic
1077344776 11:2041591-2041613 GCACAATGCATGGCCCATGGTGG + Intergenic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078080151 11:8198233-8198255 GCACAGTTCTTGGCACACAGTGG + Intergenic
1078519520 11:12052081-12052103 GAACAGTGCCTGGTTCATAGTGG - Intergenic
1078773650 11:14374369-14374391 GCTCAGTGCCTGGCACATAGAGG + Intergenic
1078826601 11:14935884-14935906 GGACAGTGCTTGGGCAACAGAGG + Intronic
1078912763 11:15748583-15748605 GCACAGTACTTGGCACATGGTGG - Intergenic
1078914756 11:15768971-15768993 GAACAGTACCTGGTGCATAGTGG + Intergenic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079361656 11:19775499-19775521 GAACAATGTGTGGCCCATAGTGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1079443242 11:20535998-20536020 GAACATTGCTTGGAACATATAGG + Intergenic
1080043335 11:27782708-27782730 AAACAGTGCCTGGCTCATAGTGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1081490194 11:43561876-43561898 GCACGGTGCTTGACCCATGGTGG + Intronic
1081659887 11:44881640-44881662 GAACAGTGCCTGGCATACAGCGG - Intronic
1081662753 11:44898070-44898092 GAGCAGTGCCTGGCACATAGTGG - Intronic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081859128 11:46322180-46322202 GCACAGTGCCTGGACCACAGTGG - Intergenic
1081866727 11:46364346-46364368 GCACAGTGCCTGACACATAGGGG + Intronic
1082879116 11:58021171-58021193 GCACAGAGCCTGGCCCAGAGTGG + Intergenic
1083193171 11:61067218-61067240 GAACAGTGCTTAGCTCTTGGTGG + Intergenic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1084489067 11:69468455-69468477 GCACAGCGCCTGGCCCACAGTGG - Intergenic
1084590536 11:70087605-70087627 GGACAGTGCCTGGCCCGTGGAGG + Intronic
1084615236 11:70231472-70231494 GGACAGCGCTTGGCACACAGAGG - Intergenic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085415697 11:76317945-76317967 GCACGGTGCCTGGCCCATTGCGG + Intergenic
1085775167 11:79358842-79358864 GCTCCGTGCCTGGCCCATAGTGG - Intronic
1085779730 11:79397210-79397232 GAACACTGCCTGGTACATAGTGG - Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1086239175 11:84668905-84668927 GAACAGTGCCTGGCACATTGTGG - Intronic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087703920 11:101467410-101467432 CAACAGGGCCTGGCACATAGTGG - Intronic
1088079899 11:105899319-105899341 CAACAGTGCTTGACACATAGTGG - Intronic
1088723897 11:112618006-112618028 GCACAGTGCTTGGCTCTGAGGGG - Intergenic
1089637257 11:119823045-119823067 GACCATGGCTTGGGCCATAGTGG + Intergenic
1089722781 11:120444113-120444135 GAACAGTTCCTGGGACATAGCGG + Intronic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1090816567 11:130302110-130302132 GAACAATACTTGGCACATATTGG - Intronic
1090911356 11:131122316-131122338 GCACAGTGCCTGGTCCATAGTGG - Intergenic
1091220431 11:133927220-133927242 GAAGAGGGCATGGCCCAGAGTGG + Intronic
1202827762 11_KI270721v1_random:96781-96803 GCACAATGCATGGCCCATGGTGG + Intergenic
1091463693 12:665220-665242 GAATAGTGCTTGATACATAGTGG - Intergenic
1091888722 12:4035594-4035616 TAAAAGTGCTTGGCACAAAGTGG - Intergenic
1092798104 12:12134046-12134068 GCACTGTGCTTGGACCGTAGGGG - Intronic
1092915783 12:13187893-13187915 GAACAGTGCCTGGCACATGATGG - Intergenic
1093547345 12:20364719-20364741 GAATAGTGCCTGGCACATGGTGG - Intergenic
1094066648 12:26368755-26368777 GAGCAGTGGCTGGCACATAGTGG - Intronic
1094072291 12:26431104-26431126 TAACAGTGCCTAGCACATAGCGG + Intronic
1094148967 12:27260840-27260862 GAACAGTATCTGGCACATAGTGG + Intronic
1094674085 12:32601202-32601224 GCACTGTGCTAGGCACATAGTGG - Intronic
1095127094 12:38492678-38492700 TAACAGTGCCTGGCACATGGTGG - Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1095840239 12:46684677-46684699 GCACAGAACTTGGCCCATAGTGG - Intergenic
1095926310 12:47583127-47583149 GAACAGTGCCTGACACACAGTGG - Intergenic
1096281830 12:50261874-50261896 GAACAGTGCCTGACACATGGGGG + Intronic
1096677948 12:53235621-53235643 GCACAGTGCTTATCACATAGTGG - Intergenic
1097381854 12:58904772-58904794 GCATAGTGCCTGGCCCATGGTGG - Intronic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1097659303 12:62411393-62411415 GAATAGTGCCTGGCACATAGTGG - Intronic
1097759697 12:63448866-63448888 TAGCAGTGCTAGGCCCATACTGG + Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098646276 12:72905375-72905397 GAAGAGTGCCTGGCACATAGGGG + Intergenic
1099316665 12:81092233-81092255 GAATAGTGCCTGGTCCATAGAGG - Intronic
1099902131 12:88724147-88724169 CCACAGTGGTTGGCCCACAGGGG + Intergenic
1100378981 12:94044150-94044172 GCACAGTTCATTGCCCATAGAGG - Intergenic
1100395263 12:94180549-94180571 GAACAGTGCTGGGTACATAATGG + Intronic
1100511663 12:95280750-95280772 GAACAGTGCCTGGCACATCATGG + Intronic
1100661702 12:96706690-96706712 GAACAGTACCTGGCACATGGTGG - Intronic
1100762528 12:97824923-97824945 CCCCAGTGCATGGCCCATAGTGG - Intergenic
1101090362 12:101279110-101279132 GAACAGTACCTGGTCCACAGAGG + Intergenic
1101098947 12:101372431-101372453 ACGCAGTGCTTGGCACATAGAGG + Intronic
1101440814 12:104703161-104703183 GCACAGTGCCTGGGCCATAGTGG + Intronic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1101728480 12:107407246-107407268 GCACAGTGCTTAGCACACAGTGG + Intronic
1101739841 12:107492355-107492377 GAACAGTGCCTAGCACAGAGGGG - Intronic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1101846166 12:108364837-108364859 GCACGGAGCTTAGCCCATAGAGG + Intergenic
1101857789 12:108458281-108458303 CAACAGTGCCTGGCCCAGAGTGG + Intergenic
1101954815 12:109203843-109203865 GCACAGTGCTCGGAGCATAGTGG + Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102474658 12:113180826-113180848 CCACAGTGCTGGGCCCAGAGTGG + Intronic
1103020189 12:117527647-117527669 GAACAGTGTTAGGCCCTTGGAGG + Intronic
1103158289 12:118706415-118706437 GAACAGTGCCTAGCACATGGTGG + Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1103243563 12:119435550-119435572 GCTCAGTGCTTGGCACAGAGTGG + Intronic
1103845973 12:123902332-123902354 GAGCAGGGCTTGGCTCACAGTGG - Intronic
1104010715 12:124928210-124928232 GAACAGTGCCTAGCACATTGTGG + Intergenic
1104301626 12:127569960-127569982 GAACAGTGCCCGACCCAGAGTGG - Intergenic
1104374835 12:128255709-128255731 GAACTGTCCTTGGCTCTTAGAGG - Intergenic
1104444968 12:128825163-128825185 GGACAGCGCCTGGCACATAGTGG + Intergenic
1104706495 12:130951400-130951422 GAACAGTGGTGGGCCCGGAGGGG - Intergenic
1105782626 13:23717279-23717301 GGACACTGTTTGGCCCAGAGTGG - Intergenic
1105955903 13:25282444-25282466 GAACAGTGCCTGGCCCAAGGAGG + Intronic
1106302476 13:28481599-28481621 GTACAGTGCCTGGCACATAATGG - Intronic
1106548916 13:30754744-30754766 GCATAGTGCCTGGCACATAGGGG - Intronic
1106707587 13:32298473-32298495 AAACAGTGCCTAGCCCAGAGTGG - Exonic
1106722438 13:32449670-32449692 GCACAATGCTTGACACATAGTGG + Intronic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1109245731 13:59952872-59952894 GAAGAATGCTTGGCACATATGGG - Intronic
1110154121 13:72293310-72293332 GAACTGTGCTTGGGACAGAGGGG + Intergenic
1110209254 13:72953239-72953261 GTGCAGTGCTGGGCTCATAGGGG - Intronic
1110373450 13:74765580-74765602 GAACAGTGCATGGCATATGGTGG - Intergenic
1110647880 13:77909670-77909692 GTACAGTGATTGGCACACAGTGG + Intronic
1111838140 13:93414530-93414552 GAACAGTGATTGGCACACTGTGG + Intronic
1111899861 13:94187633-94187655 GAACAATGTTTGCCCGATAGTGG - Intronic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112354365 13:98661594-98661616 TCACAATGCTTGGCCCATAAAGG + Intergenic
1113436374 13:110294856-110294878 GAATAGTGCCTGGCACATAGTGG + Intronic
1113802925 13:113095845-113095867 GAACTGTGCCTGGCACACAGCGG - Intronic
1114401674 14:22416016-22416038 CAACAGTGCTGGGCACTTAGTGG - Intergenic
1114405637 14:22453563-22453585 GAACAGTGCCTGGCACTTCGTGG - Intergenic
1114834053 14:26182187-26182209 GAACAGAGCCTGACACATAGAGG - Intergenic
1115520807 14:34231363-34231385 GCACAGTGCTGGGCACATAATGG + Intronic
1115759089 14:36559890-36559912 GTACAGTGCACGGCCCATGGCGG - Intergenic
1116784976 14:49277706-49277728 GGAAACTGCTTGGCACATAGTGG - Intergenic
1117885402 14:60356020-60356042 GAACAGTGTCTGGCACATATGGG + Intergenic
1118033276 14:61838983-61839005 GCACAGTGCTTAGACCATGGCGG - Intergenic
1118497778 14:66325780-66325802 GAACAGTGCCTGGCACGTAAAGG + Intergenic
1118838824 14:69496002-69496024 GAGCAGTGCTTGGCACACAGTGG + Intronic
1119149744 14:72347634-72347656 GAGCAGTGCCTGGCCCAGAGTGG + Intronic
1119569786 14:75660529-75660551 GTACAGTGCTAGGCTCATAGTGG + Intronic
1119590568 14:75883760-75883782 GAACAGCGCTTGGTACTTAGTGG - Intronic
1119652611 14:76394362-76394384 GCACAGCGCCTGGCTCATAGTGG - Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121522553 14:94596270-94596292 GAACAGTGCCAGGCACACAGTGG - Intronic
1121626802 14:95391178-95391200 TAACAGTGCCTGCCTCATAGAGG + Intergenic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1121938658 14:98045369-98045391 GAACAGTGCTAGGCACATCATGG + Intergenic
1122516786 14:102314523-102314545 AAACAGTGCTTGGCACACAGCGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125350454 15:38761717-38761739 GCACAGTGCCTGACACATAGTGG - Intergenic
1125596982 15:40893672-40893694 GAACAGTGCTTGGCACAGAGTGG + Intergenic
1126064833 15:44818784-44818806 GAATAGTGTCTGGCCTATAGTGG + Intergenic
1127308072 15:57727712-57727734 GAATAGTGCTAGACACATAGTGG + Intronic
1127359555 15:58232804-58232826 GAGTAGTGCCTGGCACATAGTGG - Intronic
1127837071 15:62798414-62798436 GCACAGCTCTTGGCACATAGTGG + Intronic
1128741512 15:70087145-70087167 GAGCAGTGCCTGGCCCATACTGG - Intronic
1128888886 15:71313011-71313033 GAACAGTGCCTGGCATATAACGG + Intronic
1128933804 15:71728416-71728438 GATCATTGCCTGGCACATAGTGG + Intronic
1128976895 15:72160883-72160905 GCACTGTGCTAGGCCCACAGTGG + Exonic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1130151018 15:81311721-81311743 GAACAGTGCTTGCCACAGAGCGG + Exonic
1130681741 15:86002908-86002930 GAACAGTGTCTGGCACATGGAGG - Intergenic
1130725647 15:86436559-86436581 GCACAGTGCTTGTCACCTAGTGG - Intronic
1130921375 15:88347866-88347888 GCACAATGTTTGGCTCATAGTGG + Intergenic
1131967646 15:97861071-97861093 GCACAGTGCAGGGCACATAGAGG + Intergenic
1132842138 16:1983406-1983428 GAACAGCGCTTGGAACAGAGCGG + Intronic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133288342 16:4701760-4701782 GAGCAGTGCTTGGCACACGGTGG + Intronic
1133465667 16:6024830-6024852 CAATAGTGCTTGGCACACAGTGG - Intronic
1133523740 16:6583469-6583491 GAACAGTGCTTAGTCAATGGAGG + Intronic
1133608336 16:7410204-7410226 GCACTGTGCCTGGACCATAGCGG - Intronic
1133730023 16:8570722-8570744 GAACGGTGCCTGGCCCACGGTGG + Intronic
1133811631 16:9165379-9165401 AAACAGTGCCTGGCGCACAGTGG - Intergenic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1134004070 16:10805800-10805822 GAACTGTGCTTGGCACACAAAGG + Intronic
1134065345 16:11224795-11224817 GAACAGTGGCTGGCACACAGCGG - Intergenic
1134092494 16:11399088-11399110 GAACAGTGCTCGGCCCCATGAGG + Intronic
1134133703 16:11666571-11666593 GAACAGTGCCTGCCACACAGTGG - Intergenic
1134452613 16:14372700-14372722 GGGCAGTGCCTGGCCCACAGGGG - Intergenic
1134586486 16:15416046-15416068 GGACAGTGCCTGGCACATAGTGG + Intronic
1134787930 16:16961886-16961908 GCACAGTGCCTGCCCCATCGTGG + Intergenic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1135046302 16:19158829-19158851 GAAGATTTCTTGGCCCCTAGAGG + Intronic
1135100452 16:19600591-19600613 GATCAGTGCCTGGCACACAGGGG - Intronic
1135160975 16:20096092-20096114 GCACAGTGCTGAGCCCATAATGG - Intergenic
1135520120 16:23170108-23170130 GAACAGTGCCTGGCACACAATGG - Intergenic
1135841945 16:25884926-25884948 GAACAGTGCCTGGTTCATAAAGG + Intronic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1136188060 16:28599677-28599699 GAACAGTGCCTGCTGCATAGAGG - Intergenic
1136190532 16:28612671-28612693 GAACAGTGCCTGCTGCATAGAGG - Intronic
1136317705 16:29463973-29463995 GAACAGGGCTTGGCGCCTATGGG - Intronic
1136432280 16:30203318-30203340 GAACAGGGCTTGGCGCCTATGGG - Intronic
1137077089 16:35981745-35981767 GAACACTTTTTGGCCCATGGTGG + Intergenic
1137486930 16:48899314-48899336 GAACAGTGCCTGCCCCAGTGAGG - Intergenic
1137730379 16:50685273-50685295 GCACAGTGCCTGCCACATAGTGG + Intergenic
1137826461 16:51500757-51500779 GCAAAGTGCCTGGCCCTTAGCGG + Intergenic
1137858491 16:51821301-51821323 GAACACTGCCTGGCGCAGAGGGG - Intergenic
1138209297 16:55149721-55149743 AAACAGTGTTTGGCAAATAGAGG + Intergenic
1138246322 16:55469519-55469541 GAACAGGGTTTTGCACATAGTGG - Intronic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1138375805 16:56563264-56563286 GCACAGTGCCTGGCCCTTGGAGG + Intergenic
1138515339 16:57532996-57533018 GCACAGGGCTTGGCCCAGAGAGG + Intronic
1138582210 16:57949035-57949057 GAACAGTGCCTGGTACACAGTGG - Intronic
1138638258 16:58361604-58361626 GAAGAGTGCTTGGGCCTTAAGGG - Intronic
1139665996 16:68456820-68456842 AAACAGTGCTGGGACTATAGTGG + Intergenic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1139814238 16:69654703-69654725 GAACAGTGCCTGGCACATGGAGG - Intronic
1139829886 16:69788809-69788831 GAACAGTGCCTGACACATAGTGG + Intronic
1140949652 16:79804569-79804591 ACACAGTGCCTGGCCCATGGTGG - Intergenic
1141220204 16:82062483-82062505 GCACAAGGCTTAGCCCATAGTGG - Intronic
1141288782 16:82698004-82698026 GCGCAGTGATTGGCACATAGGGG + Intronic
1141610529 16:85178683-85178705 GAACAGTGCCTGGGACACAGTGG - Intronic
1141640790 16:85339925-85339947 GAACGGTGCTTGGCCCAGGGCGG + Intergenic
1141657196 16:85422551-85422573 GAACAGGGCAAGGCCCACAGTGG - Intergenic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144067476 17:11637647-11637669 GCACAGCGCTTTGCACATAGTGG + Intronic
1144261762 17:13528427-13528449 GAGCAGAGCTTGGTCAATAGTGG + Intronic
1145029196 17:19491670-19491692 GAAGAGTGCTCAGCTCATAGGGG + Intergenic
1145748653 17:27339515-27339537 GCACAGGGCTTGGCCCAGATGGG + Intergenic
1147243282 17:39104851-39104873 CAACAGTGCCTGGAACATAGTGG + Intronic
1147771450 17:42870932-42870954 GAACAGTGCCTGACACATAGTGG + Intergenic
1148336463 17:46845236-46845258 CACTAGTGCTTTGCCCATAGGGG + Intronic
1148522008 17:48286005-48286027 GTACAGTGCTTAGCACATAAAGG + Intronic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1148847493 17:50537937-50537959 GCACACTGCTTGGCCCACGGGGG + Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149419963 17:56500796-56500818 GAAGAGAGCCTGGCACATAGAGG - Intronic
1149424663 17:56543488-56543510 GAACAGTGCCCGGCACATAGTGG + Intergenic
1149469207 17:56902327-56902349 GCAGAGTGCTTGGCATATAGTGG - Intronic
1149530286 17:57389594-57389616 ATGCAGTGCTTGGCACATAGTGG + Intronic
1149964518 17:61148348-61148370 GAACAGTGTCTGGCACATAATGG - Intronic
1150397762 17:64834743-64834765 GAACAGTGTTTGGCACAGACTGG + Intergenic
1150851285 17:68705959-68705981 GAACAGTGCCTGACACATAGTGG + Intergenic
1151311989 17:73298802-73298824 GTACAGTGCTTGGCACGCAGCGG - Intronic
1151339982 17:73464978-73465000 GAACAGTGCTTGGCATATGGGGG + Intronic
1151904304 17:77037760-77037782 GCACCTTGCTTGGCCCATGGAGG - Intergenic
1152257343 17:79247939-79247961 GCACAGTGCCTGGCCCACAATGG + Intronic
1152257353 17:79247983-79248005 GCACAGTGCCTGGCCCACAATGG + Intronic
1152504694 17:80741189-80741211 GAATAGCGCTTGGCCCACACTGG + Intronic
1153167517 18:2279577-2279599 GGACAGTGCTGGGCCCACAGTGG + Intergenic
1153369866 18:4303096-4303118 GAATAGTGACTGGCACATAGAGG + Intronic
1153807494 18:8721880-8721902 GAACAGTGCCTGGCACATGCTGG + Intronic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1156030806 18:32709766-32709788 GAAAAATGCTTTGCACATAGTGG + Intronic
1156463334 18:37333845-37333867 GAACAGGGCCTGGCACACAGAGG - Intronic
1156522073 18:37730392-37730414 CACCAGGGCTTGGCCCACAGGGG - Intergenic
1157288168 18:46391552-46391574 GAGCAGGGCCTGCCCCATAGAGG - Intronic
1157415937 18:47502873-47502895 GTCCAGTGCCTGGCACATAGTGG - Intergenic
1157539682 18:48491548-48491570 GAACAGTGCCTAGCACATAGTGG - Intergenic
1158018411 18:52811009-52811031 GAACAGAGCTTAGCACAGAGGGG + Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158534991 18:58300229-58300251 GAATAGTGCTGGGCACAGAGTGG + Intronic
1160605140 18:80044571-80044593 GACCAGGGCTTGGCACACAGTGG - Intronic
1160616575 18:80134861-80134883 GGACAGTGTTTGGCCCATGCAGG - Intronic
1161396897 19:4049467-4049489 GAACAGGGCCTGGCCCTCAGCGG - Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162052887 19:8045712-8045734 GCTCAGTGCTGGGCACATAGAGG + Intronic
1162158116 19:8693753-8693775 GAGCAGTACTGGGCACATAGTGG + Intergenic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1162864746 19:13537225-13537247 GAACAGCGCCTGGCCCACAGTGG - Intronic
1164375756 19:27684040-27684062 GAACATTTCTTAGCCCATTGAGG - Intergenic
1165325485 19:35112042-35112064 GAACAGGGCCTGGTGCATAGTGG - Intergenic
1165726051 19:38113707-38113729 GCACAGAGCTTGGCACATAGTGG + Intronic
1166099121 19:40560521-40560543 GAACAGTGCCTAGCACACAGAGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166312402 19:41970115-41970137 GAGCAGTGCCTGGCCCACCGTGG - Intronic
1166324344 19:42040016-42040038 GAACAGGGCCTGGTGCATAGTGG - Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
1168579230 19:57539829-57539851 GAACAGTAATTGGCCCAGACAGG + Exonic
926964942 2:18399565-18399587 GAACAGTTCTGAGCACATAGTGG - Intergenic
927424304 2:22963921-22963943 GAGCAGTTCCTGGCACATAGTGG - Intergenic
927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG + Intergenic
927818282 2:26240257-26240279 GAACAGTGAATGGCACATGGAGG - Intronic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928943269 2:36749496-36749518 GTAAAGTGCTTGGCACATACAGG - Intronic
928945695 2:36770168-36770190 GAACAGTGCCTGACACATAGTGG - Intronic
929077878 2:38093349-38093371 AAACAGTGCCTGGCACTTAGGGG - Intronic
930340489 2:50107839-50107861 GAACAGTATTTGGCTCATAATGG + Intronic
931070116 2:58637440-58637462 GCACAGTGCTGGGCACTTAGGGG + Intergenic
931183589 2:59928273-59928295 GTACAGTGTTTGGCACTTAGTGG + Intergenic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931610199 2:64090734-64090756 GGACAGGGCTTGGCACACAGTGG + Intergenic
931811102 2:65856007-65856029 GGACAGAGCTTGGCATATAGTGG - Intergenic
932219550 2:69989409-69989431 GGACAGTGCTTGGCACAGAGGGG + Intergenic
932461445 2:71884345-71884367 TGACAGTGCTTGGCCCATGAAGG - Intergenic
932621551 2:73267520-73267542 GAACAGTGCCTGGCACCTAGAGG - Intronic
932782822 2:74572892-74572914 CAACAGTGCTTGGCATACAGTGG + Intronic
933894211 2:86795663-86795685 TCACAGTGCTTTGCCTATAGAGG + Intronic
934864589 2:97794847-97794869 GAACAGTGGCTGGCACACAGTGG + Intronic
935348661 2:102134233-102134255 GAACAGTGCCAGGCACATCGTGG - Intronic
935587728 2:104816795-104816817 GCACAGTGCCTGGCCCATGAAGG + Intergenic
935658276 2:105443460-105443482 GCACAATGCTTGGCACATGGAGG - Intergenic
936156546 2:110050775-110050797 GAACAGGGCCTGGCCCACAGTGG - Intergenic
936188144 2:110320669-110320691 GAACAGGGCCTGGCCCACAGTGG + Intergenic
936985424 2:118307800-118307822 TAAAAGTGCTTGGCATATAGTGG + Intergenic
937299470 2:120830335-120830357 GCATAGTGCCTGGCACATAGGGG + Intronic
937399224 2:121567236-121567258 GGACAGTGCCTGGCCCACAGCGG - Intronic
937399427 2:121569071-121569093 AAACAGTGCTTGGGACATGGTGG - Intronic
937463931 2:122112664-122112686 GCACAGTGCTTGGCTCAGAATGG + Intergenic
938761805 2:134432831-134432853 GAACAATGCCTGGCCCATGTGGG + Intronic
939700982 2:145390282-145390304 GAACAGTGTTTGCCATATAGTGG + Intergenic
939994770 2:148909516-148909538 GAACAGTACTTGGCACATGGAGG + Intronic
940071218 2:149690332-149690354 GCACAGTGCTTTGAACATAGCGG + Intergenic
940290300 2:152071994-152072016 GAACTGTGTCTGGCACATAGTGG - Intronic
940460936 2:153961914-153961936 AAACAGTGCCTGGCTTATAGTGG + Intronic
940623614 2:156145310-156145332 GGAGAATGCTTGGCACATAGAGG - Intergenic
940765111 2:157781885-157781907 GAACAGTGCTTCGGCAAAAGTGG - Intronic
941001647 2:160208719-160208741 GAACAGTGCCTGGTCCATTGTGG - Intronic
941279768 2:163535405-163535427 GAACAGTGCTTGGCACAGAGTGG + Intergenic
941354143 2:164467908-164467930 GAGCAGAGCTTGGATCATAGAGG + Intergenic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942398723 2:175578902-175578924 GCACAGTGCCTGGCACTTAGTGG - Intergenic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
944190853 2:197002334-197002356 GAACAGTTCTTGGCACATCATGG + Intronic
944345628 2:198661886-198661908 GAGCAGTGCCTGGTGCATAGAGG - Intergenic
944708121 2:202311380-202311402 CACAAGTGCCTGGCCCATAGTGG - Intergenic
945105130 2:206304555-206304577 GAACACTGCATGGACCACAGAGG - Intronic
945748061 2:213743311-213743333 GAACAATGCCTGGCCCCTATAGG + Intronic
945808497 2:214519287-214519309 GAAAGGTGCTTGGTGCATAGTGG - Intronic
946054259 2:216887222-216887244 GAACAGTGCTTTGCACACAGTGG + Intergenic
946174711 2:217915492-217915514 GAACAGTGCCTGGCACTGAGGGG + Intronic
946324012 2:218973763-218973785 GAATAGTGCCTGGCACATAAAGG + Intergenic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
946960554 2:224980509-224980531 AACCAGTGCTTGGACCATAGTGG + Intronic
947081069 2:226397686-226397708 ACACAATGCTTGGCTCATAGTGG - Intergenic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
947946755 2:234110394-234110416 GGACAGTGCCTGGCACCTAGTGG - Intergenic
947987708 2:234463155-234463177 GTACAGTGCTTGGAACATGGTGG + Intergenic
1168765540 20:379824-379846 GAACAGTGTGTGGCACATTGCGG - Intronic
1168913074 20:1465747-1465769 GTAAAGTGCTTGGCACATGGTGG + Intronic
1169472214 20:5896446-5896468 GAACAGTACCTGGCTCATAGTGG - Intergenic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169885032 20:10389674-10389696 GAACAGTGCCCAGCACATAGTGG + Intergenic
1170063340 20:12283927-12283949 GAATGATGCTTGGCCCATAGTGG + Intergenic
1171017003 20:21551154-21551176 GCACAGTGCATGGCACACAGAGG - Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172164515 20:32890884-32890906 GCATAGTGCCTGGCACATAGTGG + Intronic
1172397035 20:34615308-34615330 AAACAATGCTTGGAACATAGTGG - Intronic
1172626048 20:36347475-36347497 GCACAGGGCTTGGCACATGGTGG - Intronic
1172750885 20:37250341-37250363 GAACAGTACCTGGCACAGAGTGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173310019 20:41889040-41889062 GCACAGTGCTTGTTCAATAGCGG + Intergenic
1173345975 20:42200366-42200388 GCACAGTGCCTCGCACATAGTGG + Intronic
1173583364 20:44163182-44163204 GAACAGTGCCTGGTACACAGAGG + Intronic
1173957376 20:47044341-47044363 GAACAATGCCTGGCACACAGTGG - Intronic
1174047154 20:47741594-47741616 GAACAGTGCCTGGCACGCAGTGG + Intronic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174364831 20:50050390-50050412 GAGCAGAGCCTGGCGCATAGTGG - Intergenic
1174497320 20:50957465-50957487 GAAAAGTGCTTGACACATAGCGG - Intronic
1174621013 20:51874645-51874667 GAACAGTGCTGGGCACAAATAGG + Intergenic
1174784517 20:53420045-53420067 GAGCAGTGCCTGGCACTTAGTGG - Intronic
1174805976 20:53604805-53604827 GAACAATGCCTGGTACATAGTGG - Intronic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1175596584 20:60239485-60239507 GAACAGTGCCTGGTGCACAGTGG + Intergenic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1178376043 21:32068160-32068182 GAGCAGTACTTGGCACAGAGTGG - Intergenic
1178463002 21:32819954-32819976 CAACATGGTTTGGCCCATAGAGG + Intergenic
1178550616 21:33535696-33535718 GGACAGTACTTAGCACATAGTGG - Intronic
1179125952 21:38590736-38590758 GCTCAGTGCTTGGCACATGGAGG - Intronic
1179839506 21:44062266-44062288 GAACAGTGCCTGGCACATGGTGG - Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180643116 22:17315459-17315481 GAACAGCACCTGCCCCATAGTGG - Intergenic
1180688422 22:17689057-17689079 GAAGACTGCTTGGCCCATCTTGG + Exonic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182309522 22:29394689-29394711 CAACGATGCTTGGCCCATGGTGG - Intronic
1182794324 22:32979696-32979718 GAACAGTACCTGGCACATACTGG - Intronic
1183061484 22:35338861-35338883 GGCCAGTGCTTGGCCCACAACGG - Intronic
1183079246 22:35446006-35446028 GCCCAGTGCTTGACACATAGTGG + Intergenic
1183159960 22:36106242-36106264 GAACACTGCCTGGCTCATGGTGG - Intergenic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183263171 22:36809301-36809323 GAATAGGGCCTGGCCCATAGTGG - Intronic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183620365 22:38968484-38968506 GAAAAGAGCTTAGCCCAGAGGGG - Intronic
1183682124 22:39338076-39338098 GAACAATGCCTGGAACATAGTGG + Intergenic
1183722731 22:39571872-39571894 GCACAGTGCTTGGCACATCGTGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183947284 22:41333716-41333738 GCTCAGTGCTTGGCCCATACTGG - Intronic
1184267946 22:43359940-43359962 GAACAGTGCTTGGCATATAGTGG - Intergenic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
1184289969 22:43493380-43493402 GAACAGTGCATGGCCCAGGGAGG + Intronic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
1184423389 22:44395023-44395045 GAGCAGTGCTTGGCCCTCATTGG - Intergenic
1184451342 22:44584494-44584516 GAACAGTGCCTGGCACCAAGTGG + Intergenic
949119139 3:364496-364518 ATACAGTGCTTGGCCCAAAATGG + Intronic
949267278 3:2172880-2172902 GAACAGTGCTTGGTCCCTGATGG + Intronic
949334912 3:2963868-2963890 GAAGAGTGCAGGGCCCACAGTGG + Intronic
949385733 3:3500467-3500489 GAAAAATGCCTGGCCCATAGGGG - Intergenic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
949939323 3:9142715-9142737 TCCCAGGGCTTGGCCCATAGTGG - Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
950736382 3:15012055-15012077 GAACAGTGTTTGACTCGTAGTGG + Intronic
951564336 3:23997983-23998005 GAACAGTTCTTAGCACATAATGG + Intergenic
951707223 3:25555495-25555517 GAACAGTACCTGGAACATAGTGG + Intronic
952496122 3:33917182-33917204 GCACAGGGATTGGCCCAGAGTGG - Intergenic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
953122298 3:40056569-40056591 GAGCAGTGCCTAGCACATAGTGG - Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953134594 3:40171773-40171795 GCACAGTGCCTTGCACATAGTGG - Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953852601 3:46477649-46477671 GAACAGTGCCCAGCACATAGGGG + Intronic
955066335 3:55536449-55536471 GCACAGTGCTAGGGCCACAGTGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955500255 3:59576035-59576057 GTAAAATGCTTAGCCCATAGTGG - Intergenic
955666235 3:61351902-61351924 GAACAGTGGCTGGCACATAGTGG - Intergenic
955787083 3:62552034-62552056 GAATAGTGCATGGCACATAGTGG + Intronic
955961534 3:64345973-64345995 GAACAGAGCCTGGCAGATAGTGG - Intronic
956225063 3:66948016-66948038 GAACAGTGTTTGGCACTTAGTGG + Intergenic
956684426 3:71811118-71811140 CCGCAGTGCTTGGCCCAAAGTGG + Intergenic
957724032 3:84041657-84041679 GAACAGTGACTGGCACATAGTGG - Intergenic
958014657 3:87925268-87925290 GAACAGTCCTTGGACTCTAGGGG + Intergenic
958879651 3:99654987-99655009 GCACAGGGCTTGGCACATGGTGG - Intronic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
958930875 3:100206720-100206742 GTCTAGTGCCTGGCCCATAGTGG - Intergenic
959650683 3:108747718-108747740 GCACAGTGCCTGGCCCATGGAGG - Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960915894 3:122694496-122694518 GCACAGTGCCTGGCACATCGTGG + Intronic
961867481 3:129964236-129964258 GACCACTGCTTGGCCCTGAGAGG + Intergenic
961931298 3:130536351-130536373 GAACAGTGCCTGACCCACTGTGG - Intergenic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962886797 3:139635066-139635088 GCACAGTACCTGGCCCATAGAGG + Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963712270 3:148760034-148760056 GCACAGTGCTTGACATATAGTGG + Intergenic
963927558 3:150967122-150967144 AGACAGTGCATGGCCCAAAGAGG - Intronic
964107793 3:153057444-153057466 GAACAGAACATGGCACATAGAGG - Intergenic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964714531 3:159708083-159708105 GAACAGTGCCTGACACAAAGTGG + Intronic
964899581 3:161642216-161642238 GTTCAGTGCTTTACCCATAGTGG - Intergenic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
967197272 3:187039356-187039378 GCACAGTGCCTGGACCAGAGCGG - Intronic
968230108 3:197000589-197000611 GCACAGTGCTTGGCACACGGTGG - Intronic
969280428 4:6167060-6167082 GAACAGTGCCTGGTGCGTAGGGG + Intronic
969349811 4:6591853-6591875 GAACAGGGCCTGGCTCATGGTGG - Intronic
969435735 4:7188323-7188345 GAACAGTGCCTAGCCCATGGTGG + Intergenic
969502739 4:7563264-7563286 GAACAGTCCCTGGCCCACGGTGG - Intronic
970255304 4:14162630-14162652 GTACAGTGCTTTGAACATAGTGG + Intergenic
970422149 4:15915298-15915320 AAACAGTGCTTGGCAGAAAGTGG + Intergenic
970994470 4:22249439-22249461 GAATAGTGCCTGGCATATAGCGG + Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
972253554 4:37330706-37330728 GAACAGAGCTTGGCATTTAGTGG + Intronic
973627378 4:52786259-52786281 GAACAGAGCTTGGCATACAGAGG + Intergenic
973671316 4:53221091-53221113 GCACAGTGCCTGGCCAATTGTGG - Intronic
973764522 4:54151004-54151026 GCACAGTGTCTGGCCCATTGAGG + Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973863057 4:55084801-55084823 GAACAGTGCTGTGCACATACTGG - Intronic
974842343 4:67312215-67312237 GAACAATGCTTTGCTCAAAGTGG - Intergenic
974902916 4:68022983-68023005 GCATAGTGCTTGGCTCAAAGTGG + Intergenic
975423084 4:74192030-74192052 TAATAGTGCCTGGACCATAGAGG - Intronic
975656097 4:76642554-76642576 GAATAGTGAATGGACCATAGTGG + Intronic
975868775 4:78754345-78754367 ACACAGTGCCTAGCCCATAGTGG + Intergenic
976318828 4:83687851-83687873 GAAGAGTGCCTGACACATAGAGG + Intergenic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
977792400 4:101123229-101123251 GGATAGTGCCTGGCACATAGGGG + Intronic
979227744 4:118308810-118308832 GAACAGTGCCTGGCATACAGAGG + Intronic
979747095 4:124230173-124230195 GGACAGTGCTTGGTATATAGTGG + Intergenic
980064999 4:128177302-128177324 GAATAGTGCTTGGCAAATAGCGG + Intronic
981040925 4:140220797-140220819 AAAAAGTGCCTGGCACATAGTGG - Intergenic
981582745 4:146266948-146266970 GAAGAGTGCCTGGCACATAATGG - Intronic
982012727 4:151122556-151122578 GAACAGTGTCTGACACATAGTGG - Intronic
982046671 4:151454336-151454358 GAACAGTCTTTGGCCCAAACAGG - Intronic
982062587 4:151619705-151619727 GAACAGTGCCTGGCATATATTGG - Intronic
982115886 4:152098075-152098097 GGACAGTGCCTGACCCATAGTGG + Intergenic
982754303 4:159200338-159200360 GAGCAGTGCTGGGACCACAGAGG - Intronic
982765449 4:159342656-159342678 TAGCAGTGCTTAGCCCATAGCGG - Intronic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
983349193 4:166565872-166565894 GAAGAGTACCTGGCCCATAATGG + Intergenic
983873324 4:172847630-172847652 GGATAGTGCCTGGCCCATACGGG - Intronic
984953624 4:185024502-185024524 AGACAGTGCCTGGCCCATAGGGG + Intergenic
985242265 4:187943120-187943142 GATCAGTGCCTGACACATAGTGG + Intergenic
986120765 5:4834237-4834259 CACCAATGCTTGGCACATAGTGG - Intergenic
986351571 5:6885183-6885205 GAACAGTGCCAGCCCCAAAGAGG - Intergenic
987213681 5:15710653-15710675 GAATGGTACCTGGCCCATAGTGG + Intronic
987879284 5:23720712-23720734 GAATAGTGCCTGGCACATAGAGG + Intergenic
988734106 5:34003378-34003400 GAACAGTGCCTGGCGTACAGTGG - Intronic
989356522 5:40549748-40549770 GAACAGTGCCTGGCACTTAGTGG - Intergenic
989678039 5:43995814-43995836 ACACAGTGCTTGGCCCATAGTGG + Intergenic
989706140 5:44333341-44333363 GAACAGTGCTTTGAACATACAGG - Intronic
990058152 5:51611647-51611669 GAAGAGTACATGGCACATAGTGG + Intergenic
990349168 5:54898649-54898671 CAGCAGTGCTTGGGCCATAATGG + Intergenic
990700192 5:58466737-58466759 GAACAGTGCCTGTCACATGGTGG + Intergenic
990896397 5:60704122-60704144 GTATGGTGCTTGGCACATAGTGG + Intergenic
991100618 5:62788436-62788458 GCACAGTACTTGGGTCATAGTGG + Intergenic
991448166 5:66722601-66722623 GAACAGTGCCTGGAACATTGAGG + Intronic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
992024461 5:72656964-72656986 AAACAGTGCCTGGCACATGGTGG - Intergenic
992696444 5:79293055-79293077 GAACAGTTCTTTGCCAGTAGAGG + Intronic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
992795660 5:80253336-80253358 GAACACTGCTTGCCCCTAAGAGG + Intronic
993425849 5:87763311-87763333 AAAGAGTGCCTGACCCATAGCGG + Intergenic
993954754 5:94218535-94218557 GAACAGTGTTTGTCACTTAGTGG + Intronic
994014122 5:94945543-94945565 GAACAGTACTTGGAACATTGTGG - Intronic
994458196 5:100041525-100041547 GAACAGTGCTTAGAACATAGTGG - Intergenic
995046780 5:107658936-107658958 GAACAGTACCTGGCCCACAGTGG + Intronic
995412935 5:111878920-111878942 AAACAGTGTCTGGCACATAGTGG - Intronic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
996284825 5:121777115-121777137 GAACTGTGCTTGGCAAATAGGGG + Intergenic
996400215 5:123054235-123054257 GAACAGTGTCTGGCCCAAGGAGG - Intergenic
997071963 5:130633143-130633165 GAAGAGTGCTTGGGCCTTAAGGG - Intergenic
997201997 5:132016104-132016126 GAACAATGCCTTGCACATAGTGG - Intergenic
997233914 5:132261705-132261727 GAACACTGCTTGACCCCGAGGGG + Intronic
997240973 5:132308039-132308061 GCACAGTGCTAGGCACACAGTGG - Intronic
997640459 5:135445469-135445491 GGGCAGTGCGAGGCCCATAGTGG - Exonic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
998156471 5:139789669-139789691 GAACAGTGCCTGGCACCCAGTGG - Intergenic
998416502 5:141950058-141950080 GAACAGGGCGTGGCACACAGTGG + Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998599454 5:143570210-143570232 GCACAGTGCTTGACACATAGGGG + Intergenic
998795986 5:145819338-145819360 TCACATTGCTTGACCCATAGAGG - Intronic
999476784 5:151907602-151907624 GCACAGTGCTGGGCATATAGTGG - Intronic
999690233 5:154140094-154140116 GAATAGTGCCGGGCACATAGAGG + Intronic
999696023 5:154189825-154189847 GCACAGTGTTTGGCACATAGTGG + Intronic
1000255393 5:159533444-159533466 GAACAGTGCCTTGCCCTCAGGGG + Intergenic
1000359667 5:160435377-160435399 GAAGAGTGCCTGGCTCATAGTGG - Intergenic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1000507152 5:162135468-162135490 GCACAGTGCCTGGGACATAGAGG - Intronic
1000594705 5:163201698-163201720 GAAAAGTGCTTGCTGCATAGTGG - Intergenic
1001008664 5:168077358-168077380 GAACAGTGCTTGGCCCATAGTGG - Intronic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001171445 5:169423275-169423297 GAACAGTGGTTGGTACATAGTGG + Intergenic
1001220910 5:169900095-169900117 GCACAATGTTTGGCACATAGTGG - Intronic
1001350150 5:170954481-170954503 GAACAGTGCCTGGCAATTAGTGG + Intronic
1001566264 5:172701388-172701410 GAACAGTGCCTGGCACGTAGTGG + Intergenic
1001575212 5:172758778-172758800 GAACAGTGCTTGGCGTGCAGGGG - Intergenic
1001711616 5:173783440-173783462 GAACAGTGCCTGGCCCAGGAAGG + Intergenic
1001740853 5:174051616-174051638 GCACAGTGCCTGGCTCACAGAGG - Intronic
1001741472 5:174056340-174056362 GCACAGTGCCAGGCACATAGTGG + Intronic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1001957039 5:175854879-175854901 GCACAGCGCCTGGCCCATGGCGG - Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002701318 5:181127206-181127228 GAATGGTGCCTGGCTCATAGCGG + Intergenic
1002781567 6:370598-370620 GAGCAGTGCTTGGCACAGGGTGG + Intergenic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1003128334 6:3373883-3373905 GGACAGTGCCTGGCACGTAGTGG - Intronic
1003253771 6:4456809-4456831 GAGCAGGGCCTGGCACATAGTGG - Intergenic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003633084 6:7806147-7806169 GAGCAGTGCTTGCCCCATGTCGG - Intronic
1003940302 6:11017856-11017878 GAACAATGCCTGGCACATAATGG + Intronic
1003947906 6:11092216-11092238 GAACAGTGCCTGGCCCCTATAGG + Intergenic
1004267069 6:14157826-14157848 TAACAGTACCTGGCACATAGTGG - Intergenic
1004341702 6:14813632-14813654 GAATATTGCTGGACCCATAGTGG - Intergenic
1004825257 6:19412957-19412979 TAACAGTGCCTGGCCAACAGTGG - Intergenic
1004873452 6:19931328-19931350 GAACAGTGCCTGGGCAGTAGTGG - Intergenic
1005031869 6:21516580-21516602 GAAGAGTGTCTGGCACATAGTGG - Intergenic
1006380947 6:33696870-33696892 GGACAGGGCTGGGCCCACAGCGG - Exonic
1006500330 6:34454719-34454741 GAACAGTGCCTGGGACACAGTGG + Intergenic
1006923237 6:37639793-37639815 GAACAGTGCCTGGCATATAATGG + Intronic
1006925123 6:37649756-37649778 GAACAGTGTTTGGCACATGGTGG + Intronic
1007166092 6:39830128-39830150 GCACAGTGTCTGGCCCAGAGTGG + Intronic
1007547389 6:42704743-42704765 GAACAGTGACTGGCACGTAGCGG - Intronic
1007843308 6:44734356-44734378 GAACAGGGCTGGGCACACAGTGG - Intergenic
1007850544 6:44798714-44798736 GTACAGTGCTTGGAACATAGAGG + Intergenic
1007947473 6:45839259-45839281 CAACAGTGACTGGCACATAGTGG + Intergenic
1008541084 6:52546912-52546934 CAACAGCGCTTGGCACATAGTGG + Intronic
1009498250 6:64377043-64377065 GAATAATGCCTGGCACATAGTGG + Intronic
1010931838 6:81813152-81813174 GAACAGAGCTTAGGCCCTAGCGG - Intergenic
1011305740 6:85924434-85924456 GAAAAGTGGTTGGAGCATAGAGG - Intergenic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012667948 6:102001144-102001166 GAACAGTGTTGGGCACCTAGCGG - Intronic
1012841807 6:104338225-104338247 GTACAGTGCCTAGCACATAGTGG + Intergenic
1012865615 6:104614782-104614804 GAACAGTACCAAGCCCATAGTGG - Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013642307 6:112097810-112097832 GAACAGTGCTTGTCACACAGTGG - Intronic
1014378831 6:120713736-120713758 GAACATGGCCTGGCCCAGAGGGG + Intergenic
1014937805 6:127404434-127404456 GAACAGTGCCTGACACATACAGG + Intergenic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015738402 6:136426327-136426349 GCACAGTGTCTGGCCCATGGAGG - Intronic
1015866262 6:137729795-137729817 GCACAGTGCACGGCACATAGTGG - Intergenic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1016597791 6:145821001-145821023 GAACAGTGCCTGGCACATGTGGG + Intergenic
1017540514 6:155397505-155397527 GAACAGTGCCTGGCATACAGTGG + Intronic
1017587798 6:155946679-155946701 GAGCAGTGCCTGGCACATGGAGG - Intergenic
1017600523 6:156075810-156075832 GAAAAGTTCCTGGCACATAGTGG + Intergenic
1017943292 6:159072578-159072600 GCACAGTGCCTGACACATAGTGG - Intergenic
1018224013 6:161610540-161610562 TCACAGTGCCTGGTCCATAGAGG - Intronic
1018541988 6:164891696-164891718 GTACAGTGCTTGTTCCACAGTGG + Intergenic
1019399604 7:844724-844746 GAACAGTGCCTGGCGCAGAGTGG - Intronic
1019490270 7:1309893-1309915 GCACAGTGCCTGGTGCATAGAGG - Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1020066067 7:5189656-5189678 GCACAGTGATTGGCACATGGAGG + Intergenic
1020786264 7:12576854-12576876 GCATAGTGTCTGGCCCATAGGGG + Intronic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021669421 7:23020450-23020472 GTATAGTGCTTGGCCAATGGAGG + Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022300271 7:29096364-29096386 GATCAGTACTTTGCTCATAGTGG - Intronic
1022966786 7:35481567-35481589 GCACAGTGCCTGGCACATGGTGG + Intergenic
1023083453 7:36546891-36546913 GCACAGTGCTTGGCACATCGTGG + Intronic
1023541733 7:41273394-41273416 GCACAGGATTTGGCCCATAGAGG - Intergenic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1023728107 7:43164629-43164651 GCACAGTCCTTGGTGCATAGTGG + Intronic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1024332828 7:48173369-48173391 GAACAGTGCCTGGCACACAATGG + Intronic
1024633831 7:51270414-51270436 GAACAGTGCCTGGCACGTAGTGG - Intronic
1024677517 7:51650449-51650471 GAACAGTGCGTGGCACGTATTGG - Intergenic
1026107994 7:67436304-67436326 GACTGGTTCTTGGCCCATAGGGG + Intergenic
1026191725 7:68134984-68135006 GAACAGTGCCTAGAACATAGTGG - Intergenic
1028596266 7:92548561-92548583 GAACAATGCCTGGCTGATAGTGG - Intergenic
1028821831 7:95220633-95220655 GTACATTGCTTGGCATATAGTGG - Intronic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1030080008 7:105769440-105769462 AGGCAATGCTTGGCCCATAGTGG + Intronic
1030299253 7:107959054-107959076 GAACGGTGCCTGGCACATAGAGG + Intronic
1030326688 7:108227158-108227180 GAACAGTGCCTGGCCCTTCACGG + Intronic
1030653805 7:112144280-112144302 GAATAGTGCTTAGTTCATAGTGG - Intronic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031127817 7:117794061-117794083 GAACAGTGGCTGGCACACAGTGG + Intronic
1032022488 7:128416716-128416738 GCACAGTGCCTTGCCCATAGTGG - Intergenic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032633167 7:133676152-133676174 GAACAGTGCCTGGTACATAACGG - Intronic
1033248535 7:139738979-139739001 GCACAGTGCTTCTCCCACAGTGG + Intronic
1033467421 7:141608043-141608065 GAACAAGGCTTAGCTCATAGTGG - Intronic
1033684168 7:143623609-143623631 GAACAGTGCTTGGCCCACAATGG + Intronic
1033687344 7:143702828-143702850 GAACAGTGCTTGGCCCACAATGG + Intronic
1033700444 7:143834014-143834036 GAACAGTGCTTGGCCCACAATGG - Intergenic
1033822522 7:145151294-145151316 GATCAGTGCCTGGCACATAGTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034365491 7:150542719-150542741 GAACAGTGCTTTGCCCCAATGGG + Intergenic
1034973690 7:155435898-155435920 AATCAGTGCTTGGACCATGGAGG - Intergenic
1035144192 7:156796932-156796954 GAATAGTGCTTGGCACATAAGGG - Intronic
1035884422 8:3276931-3276953 TAATAGTGCTTAGCCCATTGTGG - Intronic
1035932250 8:3793211-3793233 GAACAGGACTTAGACCATAGCGG - Intronic
1037706472 8:21319684-21319706 GTACAGTGCCTGGCACATGGTGG - Intergenic
1037750882 8:21681586-21681608 GAACAGTGCCTGGCAGAGAGTGG - Intergenic
1038433960 8:27521690-27521712 GAACAGGGCATGGCCCAGAGTGG + Intronic
1038729527 8:30114617-30114639 GAACCCTGCATGGCCCATTGTGG + Intronic
1038796553 8:30715501-30715523 GAACAATGCTAGCCCCATAATGG + Intronic
1038905576 8:31898323-31898345 GCACAGTTCCTGGCACATAGTGG - Intronic
1039165367 8:34673463-34673485 GAACAATGCCTAGCACATAGTGG - Intergenic
1040016980 8:42707869-42707891 GAACAGTGCCTGGCCCATAGTGG - Intronic
1040720533 8:50316809-50316831 GCACAGTGCTTGGGACATAGTGG - Intronic
1042231493 8:66559560-66559582 TAACAGTGTTTGCCTCATAGGGG + Intergenic
1042232615 8:66573712-66573734 GAACAGTGTTTAGCACATATAGG + Intronic
1042379761 8:68100296-68100318 GAACAGTACTTGGCACATAGAGG - Intronic
1042521649 8:69718715-69718737 GAACAGGCCTTGGCACAGAGTGG - Intronic
1042618764 8:70679851-70679873 GCTCAGTGCTTGGCACATAGTGG + Intronic
1042903622 8:73751339-73751361 GAATAGTACTTGGCCCATAGTGG - Intronic
1043413604 8:80026557-80026579 GCACAGTCCTTGACCCATAGTGG - Intronic
1043877652 8:85504167-85504189 GAACAGTGTCTGGCACTTAGCGG + Intergenic
1043919380 8:85963609-85963631 GAATAGTGCCTGGCACAGAGTGG + Intergenic
1044343843 8:91079863-91079885 GAGTAGTGCTTGGCACACAGCGG - Intronic
1044831337 8:96252969-96252991 AAAAAGTGCCTGGTCCATAGTGG - Intronic
1044914513 8:97098246-97098268 CAACAGTGCTTGGTTCATGGTGG - Intronic
1044941246 8:97346108-97346130 GTACAGTGCTTTGCACAGAGTGG + Intergenic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1045379290 8:101607170-101607192 GAACTGTGCTTGGCACACAATGG - Intronic
1045710696 8:104980335-104980357 GAACAGTTCTTGGCTCATAGTGG - Intronic
1046614621 8:116462511-116462533 TTACAGTGCCTGGCCCATAGTGG - Intergenic
1046621885 8:116537098-116537120 GAATGGTGCTTGGCCTATAGTGG - Intergenic
1046800967 8:118426109-118426131 GCACAGTGTTTGGCTCATAGTGG + Intronic
1047547521 8:125833578-125833600 GAACAGTGCCTAGAACATAGTGG - Intergenic
1047605264 8:126468170-126468192 GCAGATTGCCTGGCCCATAGCGG + Intergenic
1047733613 8:127746909-127746931 GAACAGTGCTTTGAACAGAGGGG - Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1048235633 8:132687317-132687339 GAAGAGTGCCTGGCACAAAGTGG - Intronic
1049237827 8:141521315-141521337 GAACACTGTGTGGCCCACAGTGG + Intergenic
1050171815 9:2827748-2827770 GAACAGTGCTTTGCCCATAAAGG - Intronic
1051114097 9:13674356-13674378 GTACAGTGCCTGGAACATAGTGG + Intergenic
1051612878 9:18978674-18978696 GAACAGTGCCTGGTGCACAGTGG - Intronic
1052339739 9:27353457-27353479 GCAGGGTGCTTGGACCATAGGGG - Intronic
1052932219 9:34065223-34065245 GAACACAGCTAGGCACATAGTGG - Intergenic
1053384820 9:37678697-37678719 GAACAGTGCCAGGCACATAGAGG + Intronic
1054851296 9:69849243-69849265 GAACAGTGCCTAGAACATAGTGG + Intronic
1055415949 9:76083249-76083271 AACCAGTGCTTGGCATATAGTGG - Intronic
1055772371 9:79730968-79730990 GAACAGTGCTTGCAGCACAGTGG - Intergenic
1055896071 9:81177303-81177325 GAAAGGTGCTTGGCACATTGTGG + Intergenic
1057747449 9:97763292-97763314 GAAAAGTGCCTGGCACATGGTGG - Intergenic
1057856070 9:98601744-98601766 GACCAGCCCTTGGCCCATACTGG - Intronic
1057872420 9:98728470-98728492 GCACAGTGCCTGGCACATGGAGG - Intergenic
1057999656 9:99851914-99851936 GTACAATGCTTGGTACATAGTGG - Intronic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1058854093 9:109043002-109043024 TAACAGTGGTTGGCACGTAGTGG - Intronic
1060006514 9:120004975-120004997 GAAGAGTGCTGGACCCACAGAGG + Intergenic
1060139708 9:121199943-121199965 TAACAGTGCCAGGCACATAGTGG - Intronic
1060171392 9:121464223-121464245 GCACAGTGCCTGGTACATAGTGG + Intergenic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061276035 9:129569750-129569772 TAACAGTGCCTGGCCCACAGGGG - Intergenic
1061621141 9:131812050-131812072 GCACAAGGCTTGGCTCATAGAGG + Intergenic
1185870604 X:3662045-3662067 GAACATTACTTGGCACATAAGGG - Intronic
1186468807 X:9805295-9805317 GAACAGTGCCTGGAGCACAGTGG - Intronic
1186876241 X:13820804-13820826 GAACACTTCTGGGCACATAGCGG + Intronic
1187468593 X:19548093-19548115 GCACAGTGCCGAGCCCATAGGGG + Intronic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1188602954 X:31991893-31991915 GAACAGTGCTTGGAACATAATGG - Intronic
1189131708 X:38505624-38505646 GCACAGTGCTTGCCACATAGTGG + Intronic
1189193218 X:39129541-39129563 GCATAGTGCTTGGCACATAATGG + Intergenic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189301797 X:39957687-39957709 AAACAGTACTTGGCACATGGAGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1190223076 X:48525219-48525241 GAACAGTGTTTGGCAAACAGTGG + Intronic
1191228867 X:58078354-58078376 GAACATTTCTTAGCTCATAGAGG - Intergenic
1191238512 X:58158251-58158273 GGACAGTTCTTAGACCATAGGGG + Intergenic
1191240050 X:58180723-58180745 GAACATTTCTTAGCCCATAGAGG + Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192546619 X:72019518-72019540 GAACAGTGCCTGACACACAGTGG + Intergenic
1192833155 X:74771853-74771875 GTACAGTACCTGGCTCATAGTGG + Intronic
1194752314 X:97698637-97698659 GAACAGTGTCTGGCACATAATGG + Intergenic
1195083237 X:101390488-101390510 GAACAGTGCCTGCCACATAATGG + Intronic
1195667003 X:107440757-107440779 GCCCAGTGCTGGGCCCATGGTGG - Intergenic
1195679322 X:107531990-107532012 GAACAGTGCCTGGTGCATCGAGG - Intronic
1196023120 X:111011062-111011084 GCACAGTGCTTGCCTCATAGTGG + Intronic
1196259828 X:113565546-113565568 TGACAGTGCTTAGCACATAGAGG + Intergenic
1196262884 X:113606037-113606059 GTACTGTGCATGGCACATAGCGG - Intergenic
1196356459 X:114799981-114800003 GAACAGTGCCTCACACATAGTGG - Intronic
1196405343 X:115356087-115356109 AAGCATTGCCTGGCCCATAGAGG + Intergenic
1196762694 X:119213816-119213838 GCACAGAGCTTGGTGCATAGAGG + Intergenic
1197290405 X:124649552-124649574 GTACAGTGCTTGGAGCAGAGTGG + Intronic
1197314996 X:124954746-124954768 GCAGAGTACTTGGCACATAGTGG + Intronic
1197694490 X:129536507-129536529 AAACAGTGCATTGCACATAGTGG - Intergenic
1197702057 X:129606946-129606968 GCACAGTGCGTGGCCCAGAGTGG + Intergenic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197881666 X:131172984-131173006 GAACAGTGCCTGGAACACAGTGG - Intergenic
1198004616 X:132480212-132480234 GAAGAGTGCTTTGCCTTTAGTGG - Intronic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1198428755 X:136545403-136545425 GCACAGTGCCTAGCACATAGTGG - Intronic
1198511471 X:137356146-137356168 GCAAAGTGCCTGGCACATAGTGG + Intergenic
1199032621 X:143017999-143018021 GAAAGGTGATTGGCTCATAGGGG + Intergenic
1199678994 X:150212588-150212610 AAACAGTGCTTGGCACATGGCGG + Intergenic
1199890565 X:152075016-152075038 GCAGAGTGCTTTGCTCATAGTGG - Intergenic
1200274947 X:154723272-154723294 GCACAGTGTCTGGCACATAGTGG - Intronic
1200793432 Y:7319085-7319107 GGACATTGCTTGGCACATAAGGG + Intergenic
1202578594 Y:26354466-26354488 GAGCAGTGTCTGGCACATAGTGG - Intergenic