ID: 1001012462

View in Genome Browser
Species Human (GRCh38)
Location 5:168110696-168110718
Sequence GCTCAAGTCCAGACTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001012462 Original CRISPR GCTCAAGTCCAGACTGAAGG AGG (reversed) Intronic
902341451 1:15785977-15785999 GCCCAAGTCAAGGCTGAAGGAGG - Intronic
904252147 1:29232720-29232742 GCTAAAGTCCAGCCCCAAGGAGG - Intergenic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
904373097 1:30063079-30063101 GCTCAGGCCCAGACTGATGATGG - Intergenic
905726461 1:40256161-40256183 GCTGAAGTCAAGAGTGAAGAGGG + Intergenic
906219625 1:44068621-44068643 GTTCCAGTCCAGACTGAGGCAGG - Intergenic
907015649 1:51010166-51010188 GCTCAATTCCAGATTGGATGTGG + Intergenic
907691386 1:56670394-56670416 CCTCAAGACCAGACTTAAGAAGG - Intronic
908973105 1:69862249-69862271 CCTCAAGTCCAGGTTGAACGTGG + Intronic
910095751 1:83519805-83519827 TCTGAAGACCAGACTGAAGGAGG + Intergenic
911156415 1:94641880-94641902 GCCCAATTCCAGCCTGAAAGTGG - Intergenic
915108282 1:153547583-153547605 GGGCAAGTCCAGATTGAAAGGGG + Exonic
916512588 1:165485827-165485849 GGTCAAGTCCAGAGTGAAGCTGG + Intergenic
920862681 1:209723482-209723504 GCTCATGTCCAGGCTCAGGGAGG - Intronic
922724090 1:227914559-227914581 GCGCAGGGCCAGACTGGAGGTGG - Intergenic
922900645 1:229133975-229133997 AGTCAAGTGCAGAGTGAAGGGGG - Intergenic
923838823 1:237645133-237645155 GCTCAAGTCTAGAATGAAAGGGG + Intronic
1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG + Intronic
1064506409 10:16035046-16035068 GCTCAAGAGCAGAGTGAAGAGGG + Intergenic
1064958144 10:20934112-20934134 ACTAAAGTCCAGTCTGAAGCAGG - Intronic
1067470691 10:46535775-46535797 GCTCAGGTCCAGACTGATGGAGG - Intergenic
1070674669 10:78404283-78404305 GCTCAAGCCCACATTCAAGGTGG - Intergenic
1071572894 10:86707806-86707828 GCCCAACTCAAGCCTGAAGGAGG + Intronic
1075237950 10:120748600-120748622 GTTTAAGTCCAGACTAGAGGGGG + Intergenic
1078563317 11:12391802-12391824 GCTCAAGTCCAGAGGAGAGGTGG + Intronic
1083492180 11:63021171-63021193 GCGCATGTCCAGTCTGAAGGGGG + Intergenic
1083713969 11:64565224-64565246 GCTGATGTCCAGCGTGAAGGAGG + Exonic
1083817885 11:65147387-65147409 GGCCAAGTCCAGAATTAAGGGGG - Intergenic
1084931466 11:72559929-72559951 ACTCAACTGAAGACTGAAGGAGG - Intergenic
1085390326 11:76178982-76179004 GCTCAGGTCCAGGCTCTAGGTGG - Intergenic
1087449941 11:98308184-98308206 GCTCATGTAGAGAATGAAGGAGG + Intergenic
1089597825 11:119592940-119592962 GCTGAAGCCCAAACTGAAAGAGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092914469 12:13177572-13177594 GCTCCAAGCCAGACTGAAGGAGG - Intergenic
1095938072 12:47706080-47706102 GCTCAAGCCCAGGCTAAAGGGGG - Intergenic
1096914491 12:55017116-55017138 GCTCAAGTCTAACCTGAAGATGG + Intergenic
1097643479 12:62208851-62208873 CCTCAGGTGGAGACTGAAGGAGG - Intronic
1100515139 12:95320213-95320235 GTTCAAAGCCACACTGAAGGAGG + Intergenic
1100737478 12:97552906-97552928 GCTCTCCTCCAGACAGAAGGGGG + Intergenic
1101583185 12:106062165-106062187 TATCAAGTCCAGACTGAACTTGG + Intergenic
1106865925 13:33963978-33964000 GGTCAAGACCAGCTTGAAGGCGG - Intronic
1112475730 13:99729756-99729778 ACTCAAGTGCAGGCTGAAAGTGG - Intronic
1113010574 13:105761299-105761321 GCTAAAGTCTAGACCTAAGGAGG + Intergenic
1113916495 13:113877109-113877131 GGCCATGTCCAGACTGAAGGAGG - Intergenic
1119119808 14:72064212-72064234 GCCCTAGACCAGGCTGAAGGAGG + Intronic
1122322450 14:100863425-100863447 GCTGAAGTCCTGGCTGAAGAGGG - Intergenic
1124982981 15:34582073-34582095 TCTCCAGCCCAGGCTGAAGGGGG + Intronic
1128329122 15:66744446-66744468 TCCCAAGTCCAGGCTGAGGGTGG + Intronic
1132557034 16:577072-577094 GCTCCAGCCCAGAAGGAAGGAGG + Intronic
1132776434 16:1597371-1597393 TCCCAAGTCCAGACTCAGGGAGG - Intronic
1133315930 16:4884079-4884101 GCTCAAGAGCAGCCTGGAGGAGG - Exonic
1133463464 16:6007438-6007460 TCTCAAGACCTGACTGAAGAAGG - Intergenic
1134178042 16:12024477-12024499 GCTCAGATCCAAACTGGAGGTGG + Intronic
1134746610 16:16593664-16593686 GCGCAAGCCCAGACTGGAGCTGG + Intergenic
1134998864 16:18760016-18760038 GCGCAAGCCCAGACTGGAGCTGG - Intergenic
1135425522 16:22332301-22332323 GCTCAAGACAAGACTGACTGGGG - Intronic
1136337042 16:29616552-29616574 GCTCACGTTCTGACGGAAGGAGG - Intergenic
1136889520 16:33958608-33958630 GTTCAAGACCAGACTGGCGGGGG - Intergenic
1141709324 16:85688821-85688843 GATCTTGTCCAGACTGAAGTTGG + Exonic
1143729535 17:8873176-8873198 GCTCCAGAGCAGACTGAAGGGGG - Intergenic
1145193287 17:20866679-20866701 GCTCCAAGCCAGGCTGAAGGAGG - Exonic
1145269027 17:21394664-21394686 GCTCAACTCGAGGCTGAGGGTGG + Intronic
1145298730 17:21614405-21614427 GCTCCAAGCCAGGCTGAAGGAGG + Intergenic
1145351549 17:22088885-22088907 GCTCCAAGCCAGGCTGAAGGAGG - Intergenic
1145723217 17:27091141-27091163 GCTCCAAGCCAGGCTGAAGGAGG + Intergenic
1146150932 17:30470989-30471011 GATCAAGTCAAAACTGTAGGTGG + Intergenic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1154316802 18:13310630-13310652 GCTAAGGTCAAGACTGAGGGAGG - Intronic
1158547438 18:58408174-58408196 GCAGAAGTCCAGACTGAGGGAGG - Intergenic
1158718381 18:59900327-59900349 GCTCAAGCACAGACTGCACGGGG + Intronic
1161249845 19:3274696-3274718 TCTCAAGTGGAGACTGAAGGAGG + Intronic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1163202310 19:15777955-15777977 CCTCAAGTCCAGAGTGGAGAAGG + Intergenic
1165477528 19:36039858-36039880 GCCAAAGTTCAGACTCAAGGAGG + Intronic
1165801029 19:38550283-38550305 GCACAGTTCCAGACTGAAGGAGG - Intronic
1167248961 19:48390843-48390865 CCTCAGGTCCAGACTGCGGGAGG - Intronic
1167489711 19:49785215-49785237 GCAAAAGTACAGACTGTAGGGGG + Intronic
1168149270 19:54436133-54436155 GCTCCAGTCCAGCCGGGAGGAGG - Exonic
925841978 2:8001040-8001062 GGTCAAGGCCAAACTCAAGGAGG - Intergenic
926227568 2:10979107-10979129 GCTCTGGGCCAGACTGAGGGAGG + Intergenic
926567980 2:14498718-14498740 GCTCAAGTTGACACTGATGGGGG - Intergenic
927067377 2:19486886-19486908 GATCAGGGCCACACTGAAGGTGG + Intergenic
928321199 2:30283996-30284018 GTTGAAGTCCAGGCTGACGGGGG - Intronic
930052488 2:47227493-47227515 GCTCAAGACCAGAATGAATTTGG - Intergenic
933998009 2:87684129-87684151 GCTCACGGCCAGAACGAAGGCGG - Intergenic
934694226 2:96387413-96387435 GCTCAAGAGCAGATTGAAGATGG - Intergenic
937900147 2:127013740-127013762 GTTCAAGGCCAGCCTGAGGGTGG + Intergenic
938757685 2:134395926-134395948 GCTCAAGCCAAGACTAAATGTGG + Intronic
940053960 2:149493864-149493886 GCACCAGTCCAGCCTGGAGGTGG - Intergenic
940623958 2:156149355-156149377 GTTAAAGTACAGACTGAAGTGGG + Intergenic
941596298 2:167480957-167480979 GTTCAAGGCCACAGTGAAGGTGG - Intergenic
942001605 2:171653368-171653390 GATCAAGTCCACACTGAAAGTGG + Intergenic
945268939 2:207919427-207919449 TCTTAAGAACAGACTGAAGGGGG + Intronic
946575046 2:221065998-221066020 GATACAGTCAAGACTGAAGGAGG + Intergenic
947111227 2:226721538-226721560 ACTCAAGTCCAGACTGAGGCTGG + Intergenic
1169031907 20:2416015-2416037 GCTCAACTCTAGACTGAGGTAGG + Intronic
1170158657 20:13291071-13291093 GCTCACATCCAGACTCAAGGTGG + Intronic
1171264138 20:23756653-23756675 TCTCACCTCCAGCCTGAAGGTGG + Intergenic
1171419450 20:25008116-25008138 GCTTAGGTCCAGACAGTAGGAGG - Intronic
1171561852 20:26134170-26134192 GCTCCAAGCCAGGCTGAAGGAGG - Intergenic
1172935212 20:38615399-38615421 GCTCTTGTCCAGACTGAAGTTGG + Intronic
1174049710 20:47759114-47759136 GTGCAGGTACAGACTGAAGGGGG + Intronic
1178383869 21:32133991-32134013 GCTGAGGCCCAGTCTGAAGGTGG - Intergenic
1183382295 22:37496284-37496306 GCACAAGGACAGACAGAAGGAGG + Intronic
1183805710 22:40208961-40208983 TCTCAAGAGCAGCCTGAAGGAGG + Intronic
1184425533 22:44407040-44407062 GCTCAAGTTCAGAGTCAAGAAGG - Intergenic
950629769 3:14274752-14274774 ACTCCAGACCAGACTGAAGCAGG - Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
954001700 3:47562704-47562726 TCTCAAGTCCTGCCTGAAAGAGG - Exonic
955841526 3:63117878-63117900 GCACAAATCCAGACAGAAGCAGG - Intergenic
956832963 3:73071549-73071571 GTGCAAGTAAAGACTGAAGGTGG + Intergenic
959860348 3:111208666-111208688 GCTCACATCCAGACTGAGGGAGG - Intronic
961222062 3:125208959-125208981 GAGCAGGTCAAGACTGAAGGTGG + Intronic
961613079 3:128156019-128156041 GAGCCAGTCCAGACTGGAGGTGG + Intronic
961642042 3:128370832-128370854 GCTCCCTTCCAGAGTGAAGGTGG + Intronic
973729881 4:53813103-53813125 GTGAAAGTCCAGACTGAAGCAGG + Intronic
975884788 4:78952088-78952110 GCTCAAGTCCAGAGCGCAAGAGG - Intergenic
976366221 4:84235321-84235343 GCTCAAGTCTACTCTGCAGGTGG + Intergenic
978652746 4:111026982-111027004 GGACAAGTGCAGACTGAATGGGG + Intergenic
980408092 4:132380425-132380447 GCAAAAGTGCAGAGTGAAGGTGG + Intergenic
982174445 4:152692408-152692430 GTTCAAGACCAGCCTGAATGTGG + Intronic
983827946 4:172287666-172287688 GTTCAAGTGCAGAATGAAAGGGG - Intronic
988204398 5:28115499-28115521 GCTCCAGTCATGACTGAAAGGGG - Intergenic
990283389 5:54275538-54275560 GCTCATGTGCAGGCTGCAGGAGG - Intronic
992749016 5:79844967-79844989 GCAACAGTCCATACTGAAGGTGG - Intergenic
995079750 5:108035768-108035790 GCTGAACTCTAGACTTAAGGTGG - Intronic
995460654 5:112399630-112399652 GCTCTAATCCAGCCTGCAGGTGG + Intronic
995528058 5:113066626-113066648 GTGCAAGTCGAAACTGAAGGAGG + Intronic
996923761 5:128799387-128799409 GCTGAAGTCTACAATGAAGGTGG - Intronic
997383642 5:133455681-133455703 GCTCAAGACCATATTCAAGGAGG + Intronic
998745838 5:145258990-145259012 GCTCCAGTCCAGGCTCAAAGGGG + Intergenic
1001012462 5:168110696-168110718 GCTCAAGTCCAGACTGAAGGAGG - Intronic
1001625264 5:173126981-173127003 GCTCAAGACCAGCCTGAACCTGG + Intronic
1002969926 6:2005193-2005215 GCTCAAGTCCTTACTCAATGGGG + Intronic
1004555034 6:16688395-16688417 GCTCAACTCCAGAGGCAAGGTGG + Intronic
1005384350 6:25271229-25271251 GCGGAAGTACAGAATGAAGGAGG - Intergenic
1006385566 6:33728891-33728913 GCTCAAGGGCAGACAGACGGGGG - Intronic
1007081874 6:39112315-39112337 GCTCAAGTCTAAACTGGAGAAGG + Intronic
1007222116 6:40286910-40286932 GCTGTAGTCCAGGCTGATGGGGG - Intergenic
1007732165 6:43953971-43953993 GCCCAAGTGCAGACAGACGGAGG - Intergenic
1012420289 6:99057332-99057354 GTTCAAGTCCAGCCTGGTGGAGG + Intergenic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1015176283 6:130312545-130312567 GCTGAGTTCCAGACTGAATGGGG - Intronic
1017662113 6:156685029-156685051 GCTACAGTCCAGATTCAAGGCGG + Intergenic
1019389445 7:777740-777762 GGTCAACTCTAGACTGAATGTGG + Intronic
1020826208 7:13032333-13032355 GTTCAAGTCAAGCATGAAGGTGG - Intergenic
1025276022 7:57581523-57581545 GCTCCAAGCCAGGCTGAAGGAGG + Intergenic
1033664906 7:143431252-143431274 GCATAAGTCCAGACTGGAGCAGG - Intergenic
1038477418 8:27877948-27877970 GGTCACATCCAGACTGGAGGTGG - Intronic
1042290452 8:67165616-67165638 AGTCAAATCCAGACTGGAGGAGG - Intronic
1044830719 8:96245115-96245137 GATCAAATCCAGAGTGATGGGGG - Intronic
1046766570 8:118075738-118075760 GCTTAAGTCAAGGCAGAAGGGGG + Intronic
1049552752 8:143267959-143267981 TCTGAGCTCCAGACTGAAGGGGG - Intronic
1050646903 9:7730009-7730031 ACTCAAGTCTAGAATGAAGACGG - Intergenic
1051436712 9:17041506-17041528 GCACAAGTCCAGAGTGAGTGTGG + Intergenic
1052174086 9:25435325-25435347 GGACAAGTGCAGAGTGAAGGGGG + Intergenic
1054844856 9:69783816-69783838 GGTCAAGTAAAGACTGAAGCAGG - Intergenic
1056587369 9:87937617-87937639 GCTCCAAGCCAGGCTGAAGGAGG - Intergenic
1056609508 9:88115326-88115348 GCTCCAAGCCAGGCTGAAGGAGG + Intergenic
1056796409 9:89661839-89661861 GGCCCAGCCCAGACTGAAGGCGG - Intergenic
1057709707 9:97428246-97428268 GCACAAGACCAGCCTGAAGAGGG - Intronic
1060002988 9:119975368-119975390 GCCCAAGTCCAAAATGATGGTGG - Intergenic
1061235396 9:129339371-129339393 GCTCAAGTCCAGACACCAGAAGG - Intergenic
1061726660 9:132585724-132585746 GCTCCAGTCCACGCTGGAGGGGG + Intronic
1186890272 X:13952981-13953003 TCTAAAGTCCAGACTTTAGGAGG + Intergenic
1194505626 X:94730186-94730208 GCTCCAGTCATGACTAAAGGGGG - Intergenic
1195666052 X:107432348-107432370 GCTCAAGTAGAGACTGACAGGGG - Intergenic
1198946892 X:142025836-142025858 GTTCAAGTCCAAAATGAAGCAGG - Intergenic
1200852111 Y:7893970-7893992 GCTAAAGGACACACTGAAGGGGG - Intergenic
1201223959 Y:11798596-11798618 GCTTAATTCCAGTCTGAAGTTGG - Intergenic
1201715587 Y:17041392-17041414 AATCAACTACAGACTGAAGGAGG - Intergenic