ID: 1001013571

View in Genome Browser
Species Human (GRCh38)
Location 5:168120173-168120195
Sequence CAGCAGTAATGCCCTTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001013566_1001013571 26 Left 1001013566 5:168120124-168120146 CCAAAAGTCAGCTTCCATAACAT 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1001013571 5:168120173-168120195 CAGCAGTAATGCCCTTAATGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
1001013567_1001013571 12 Left 1001013567 5:168120138-168120160 CCATAACATTATTCCTCTAAGAT 0: 1
1: 0
2: 0
3: 18
4: 232
Right 1001013571 5:168120173-168120195 CAGCAGTAATGCCCTTAATGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
1001013568_1001013571 -1 Left 1001013568 5:168120151-168120173 CCTCTAAGATTTTTCAATATATC 0: 1
1: 0
2: 3
3: 23
4: 303
Right 1001013571 5:168120173-168120195 CAGCAGTAATGCCCTTAATGGGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001013571 Original CRISPR CAGCAGTAATGCCCTTAATG GGG Intronic
900877570 1:5355590-5355612 CAGCACTAATCCCATTTATGAGG - Intergenic
903539953 1:24091194-24091216 CAGCAGCAGTGCCTTTCATGGGG + Intronic
904976502 1:34460977-34460999 TGGCAGTCATGGCCTTAATGGGG - Intergenic
910746372 1:90579430-90579452 AAGCAGTAAAGCCCTTATTCTGG + Intergenic
914721959 1:150296611-150296633 CTGCATTAAGGCCTTTAATGTGG + Intronic
916162932 1:161937542-161937564 GAGCAGTAATTCCATTCATGAGG - Intronic
916726308 1:167526804-167526826 CAGCAGAAATGCACTTTGTGAGG - Intergenic
922396368 1:225205274-225205296 GGGCACTAATGCCATTAATGAGG - Intronic
922423909 1:225476776-225476798 CAGCACTAATCCCATTCATGTGG - Intergenic
923880808 1:238102026-238102048 CAGGTGTAGTGGCCTTAATGGGG - Intergenic
924277879 1:242406363-242406385 CAGCAGTAAGGCATTTAGTGAGG + Intronic
1063967996 10:11361928-11361950 CAGCATTAATGGCATCAATGTGG - Intergenic
1063977878 10:11431477-11431499 CTGCAATAAGGCCCTTGATGTGG + Intergenic
1072764418 10:98084047-98084069 CAGCACTAATCCCATTGATGGGG + Intergenic
1073537018 10:104286665-104286687 CAGCACTAATACACTTAACGAGG - Intronic
1076506011 10:130973136-130973158 CAGCAGTAATGCCCTGTGGGTGG + Intergenic
1080846250 11:36029606-36029628 CAGCTATCAGGCCCTTAATGAGG + Intronic
1084373424 11:68760092-68760114 CAGCAGTAATTCCTTTACGGCGG + Intronic
1090852097 11:130579585-130579607 AAGCACTAATCCCATTAATGAGG + Intergenic
1094212070 12:27903433-27903455 GAGCACTAATCCCATTAATGAGG + Intergenic
1097455047 12:59789931-59789953 CAAAAGAAATGCCCTTAATTTGG - Intergenic
1101733125 12:107443034-107443056 CAGCACTAATCCCCTTCATGAGG + Intronic
1103899630 12:124296513-124296535 CAGCAGTAAAGCTGTTAAGGTGG - Intronic
1107815999 13:44244860-44244882 CAGCAGTAAGAGCCTTAATAGGG - Intergenic
1110357811 13:74588717-74588739 GAGCATTAATCCCATTAATGAGG - Intergenic
1112501107 13:99943892-99943914 CAGCACAGATGCCCTTCATGAGG - Intergenic
1113490040 13:110684316-110684338 CATCAGTACTGTCCTTACTGCGG + Intronic
1116177029 14:41484241-41484263 GGGCAGTAATTCCATTAATGAGG + Intergenic
1118392374 14:65306120-65306142 TATTAGTAATGCCCATAATGGGG - Intergenic
1118512227 14:66488103-66488125 CATCAGTATTACCCTTAAGGAGG + Intergenic
1119583786 14:75812659-75812681 CAGCAGAAATGCCTTTGATGGGG - Intronic
1134251211 16:12575394-12575416 CTGCAACAATGCCCTTCATGCGG - Intergenic
1138868917 16:60857015-60857037 CAACAGTGATTCCCTGAATGAGG + Intergenic
1147233758 17:39040837-39040859 CATCACTAATGAGCTTAATGAGG - Intergenic
1153115936 18:1656261-1656283 CAGAAGTAAGGCGCTTAATGAGG + Intergenic
1153314254 18:3706421-3706443 CAGCATTGATGTGCTTAATGAGG + Intronic
1154163792 18:11999056-11999078 CATCAGAAAAGCCCTTACTGAGG + Exonic
1156240409 18:35248259-35248281 GAGAAGTAATGCTCTTATTGGGG + Exonic
1156402138 18:36748994-36749016 CAGCTGTAAGGCCCTGAATAGGG - Intronic
1156889542 18:42174943-42174965 CAGCAGCAATGGCCTTCATGGGG - Intergenic
1157999891 18:52605771-52605793 CATAAGTAATGCCCTTACTCAGG - Intronic
1164520545 19:28975868-28975890 CAGCAGGAATGCCCACCATGGGG + Intergenic
926846992 2:17152340-17152362 CAGCAGTAATGCCAGAGATGAGG + Intergenic
927406504 2:22776032-22776054 CAGCAGTGGTGCCAATAATGTGG + Intergenic
927442208 2:23127244-23127266 GAGCACTAATGCCATTCATGAGG + Intergenic
931831446 2:66055865-66055887 GAGCATTAATGCCATTCATGAGG - Intergenic
932504309 2:72214059-72214081 CAGCAGGAATGGGCTTTATGGGG - Intronic
932505701 2:72229178-72229200 GAGTAGTGATGCCTTTAATGGGG + Intronic
933628847 2:84633600-84633622 GAGGAGTAATGCCCATCATGAGG - Intronic
934547935 2:95234232-95234254 CAGCAGTCAGGCGCTCAATGAGG + Intronic
935815082 2:106839719-106839741 CACCAGTAATAGCCTTCATGTGG - Intronic
937445659 2:121955716-121955738 CAGCATGAGTGCCCTTGATGTGG - Intergenic
938177779 2:129151974-129151996 AAGCATTAATGGCCTTAAAGAGG - Intergenic
941294259 2:163716257-163716279 TAGCAGTAATGCTTTTAATCTGG - Intronic
944172003 2:196789561-196789583 CAACAGTAATCTTCTTAATGTGG + Intronic
944350988 2:198726213-198726235 AAGCAGAATTGCCCTTATTGGGG - Intergenic
945440561 2:209874264-209874286 CACCAGTAATCTCTTTAATGTGG + Intronic
946059848 2:216932615-216932637 CAGCACTAAGCACCTTAATGTGG + Intergenic
1176522527 21:7835254-7835276 CAGCTGTAATGCCCAAACTGTGG - Intergenic
1178542212 21:33462805-33462827 CAGCAGTAATGTCAGGAATGAGG - Intronic
1178656547 21:34465266-34465288 CAGCTGTAATGCCCAAACTGTGG - Intergenic
949442597 3:4098508-4098530 CACCAGAAATGCCCTTTGTGTGG + Intronic
951342880 3:21510431-21510453 CTGTAATAATGCCCTTATTGGGG + Intronic
952326435 3:32324593-32324615 CAGTAATAATTCCCTAAATGAGG - Intronic
952341811 3:32453546-32453568 CATGAGTAATGCCCTCAAAGAGG - Intronic
955124880 3:56101477-56101499 CAGCAGTAATGCCCTTAGCCTGG - Intronic
959397726 3:105862354-105862376 AGGCAGTGATGCACTTAATGAGG - Intronic
960588758 3:119345485-119345507 CAGAACTCATGCCCTTAATCAGG + Intronic
965592412 3:170374554-170374576 CAGCAGTAATGCTACTAATCAGG - Intronic
966475475 3:180340062-180340084 CTGCTGTAATTCCCTAAATGTGG + Intergenic
968699918 4:2050250-2050272 CAGCAGTAATGGCTGAAATGGGG + Intergenic
969732027 4:8963289-8963311 CTGCAGTGATGCTCTTCATGGGG - Intergenic
970871273 4:20819703-20819725 CAGCACTAATCCCATTAATGAGG - Intronic
975641878 4:76508994-76509016 CAGCACTAATCCCATTCATGAGG + Intronic
976134358 4:81920035-81920057 CAGCAGCAATGCCCTAGCTGTGG - Intronic
979753763 4:124313325-124313347 CCGCAGTACTGTCTTTAATGTGG - Intergenic
980679357 4:136137386-136137408 GAGCAGTCATTCCCTTAATTAGG + Intergenic
983480147 4:168263606-168263628 CAGCATTAATCCCATTCATGAGG - Intronic
987191710 5:15485243-15485265 CAGCAGAAATTCCCTTAAAATGG - Intergenic
987588652 5:19893073-19893095 AAGCACTAATGCCATTCATGAGG - Intronic
988326139 5:29770444-29770466 CTCCACTACTGCCCTTAATGTGG - Intergenic
989154405 5:38330402-38330424 CAGCAGTAATGCCAGTAGTGGGG + Intronic
989318366 5:40107260-40107282 CAGCGTTAATGCCCTTAAATCGG - Intergenic
990181509 5:53165693-53165715 CAGCATTTATGCACATAATGGGG + Intergenic
990867334 5:60394807-60394829 CAGCAGTAATGACATTACTTTGG + Intronic
991183358 5:63779966-63779988 GGGCACTAATGCCATTAATGAGG + Intergenic
993701428 5:91123491-91123513 CAGCACTAATCCCATTGATGAGG + Intronic
994152679 5:96466698-96466720 CAGCAGTAATACAATTAATGAGG - Intergenic
997244918 5:132339397-132339419 CACCAGTAGAGTCCTTAATGAGG - Intronic
1001013571 5:168120173-168120195 CAGCAGTAATGCCCTTAATGGGG + Intronic
1002820864 6:723465-723487 GATCAGTGATGCCCTTGATGAGG - Intergenic
1005249328 6:23926779-23926801 AAGCAGTAATCCCATTCATGAGG + Intergenic
1010049677 6:71487944-71487966 GAGCACTAATCCCATTAATGAGG - Intergenic
1014294856 6:119605738-119605760 GGGCAGTAATCCCCTTCATGAGG + Intergenic
1016055647 6:139575194-139575216 GAGCAGTAATCCCATTCATGAGG - Intergenic
1018215180 6:161519320-161519342 CAGCAGGATTGCTCTGAATGAGG + Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021560615 7:21965546-21965568 CAGCAGTAAAGCACAGAATGAGG + Intergenic
1027820655 7:83039578-83039600 CAGCAGTAAAGAAGTTAATGTGG - Intronic
1031646032 7:124226708-124226730 CAGCAGTAATACCTTTATTTTGG + Intergenic
1032720656 7:134548627-134548649 CACCAGTTATGTCCTTAAGGAGG - Intergenic
1041735602 8:61107507-61107529 AGGCACTAATGCCCTTCATGAGG + Intronic
1043251865 8:78084907-78084929 CAGCAGTAAAGCCCTAGATCAGG - Intergenic
1045501219 8:102745724-102745746 CAGCAGAAATGCCCTTAAAAAGG + Intergenic
1046680319 8:117162400-117162422 CACCAGTATTGCCCACAATGGGG + Intronic
1049458868 8:142711458-142711480 CAGCATTAATCCCATTTATGAGG + Intergenic
1051694733 9:19755636-19755658 CAGCAGGGATGACCTTACTGAGG - Intronic
1059577978 9:115512295-115512317 GAGCAGTAATCCCATTTATGAGG + Intergenic
1185670976 X:1809996-1810018 GGACAGGAATGCCCTTAATGAGG - Intergenic
1186080480 X:5925585-5925607 CAGCAGTAATGTTCAAAATGTGG - Intronic
1188293521 X:28417619-28417641 GGGCAGTAATCCCCTTCATGAGG + Intergenic
1188546995 X:31318795-31318817 CAGCAGTAATGCATTTCATCAGG - Intronic
1189729802 X:44007666-44007688 CAGCATTAATCCCTTTATTGGGG - Intergenic
1190470338 X:50772599-50772621 AAACAGTTATGCTCTTAATGGGG - Intronic
1190550430 X:51574180-51574202 CAGCACTAATCCCATTCATGAGG - Intergenic
1197059477 X:122160283-122160305 CAGCAGTTCTGACTTTAATGAGG - Intergenic
1199414579 X:147566442-147566464 CAGCATTATTGCCATTACTGAGG - Intergenic
1199573577 X:149291437-149291459 GAGCAGTAATCCCATTCATGAGG - Intergenic