ID: 1001016696

View in Genome Browser
Species Human (GRCh38)
Location 5:168148305-168148327
Sequence CATTATGCAAAATTGAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001016694_1001016696 -5 Left 1001016694 5:168148287-168148309 CCTTCCTAAGGGCACACTCATTA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1001016691_1001016696 12 Left 1001016691 5:168148270-168148292 CCAAGGAGAAGCTCTTGCCTTCC 0: 1
1: 0
2: 3
3: 19
4: 204
Right 1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1001016695_1001016696 -9 Left 1001016695 5:168148291-168148313 CCTAAGGGCACACTCATTATGCA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001016696 Original CRISPR CATTATGCAAAATTGAAGAG TGG Intronic
905476902 1:38235391-38235413 CATTTGGCAAGATTAAAGAGGGG + Intergenic
907542833 1:55232099-55232121 CATGATGCAGAGTTGAAGATTGG + Intergenic
907564784 1:55424718-55424740 CATGATGCAGTAGTGAAGAGTGG - Intergenic
907795977 1:57717490-57717512 CATTATGGAAAATAGTATAGAGG + Intronic
908457392 1:64317371-64317393 CATTATGGAAAACAGTAGAGAGG - Intergenic
909258803 1:73460106-73460128 TATCCTGCAAAAATGAAGAGTGG + Intergenic
909695266 1:78461435-78461457 CATCATCCAAAAAGGAAGAGAGG - Intronic
910647414 1:89528638-89528660 CATTAAACAAACTTGCAGAGAGG + Intronic
911297726 1:96137980-96138002 CATTTTACAGAATTGAGGAGAGG - Intergenic
911961871 1:104314929-104314951 CATTCTGCAACATTGCAGAGTGG - Intergenic
912810209 1:112788459-112788481 AAATATGAAAGATTGAAGAGGGG - Intergenic
914691951 1:150037517-150037539 AATTATGAAAAATTCAAGACTGG + Intergenic
918503310 1:185223119-185223141 CATTATGTAAAATAGTACAGAGG - Intronic
918932162 1:190868417-190868439 CACAATGCAAAATTGAAGGAAGG - Intergenic
918981407 1:191564723-191564745 GATGATGCAAAAGAGAAGAGTGG + Intergenic
919541658 1:198854072-198854094 CATTTTGGAAAATAGTAGAGAGG + Intergenic
919709931 1:200716331-200716353 CATTCTGGAAAATAGAAGAGAGG + Intergenic
921798027 1:219370458-219370480 GATTATACAAAATTGGAGACAGG + Intergenic
1062770230 10:93817-93839 CATTCTGCAAAACAGGAGAGGGG + Intergenic
1064296100 10:14080283-14080305 CATAACACAAAAATGAAGAGGGG - Intronic
1064577851 10:16763887-16763909 CTTTATGCAAAGGTGAAGAGAGG - Intronic
1066113176 10:32215384-32215406 AATTATGCAAAATTGAAAATAGG - Intergenic
1066134290 10:32427654-32427676 CATTTTGTAAAATTTAAGAAAGG + Intergenic
1067154717 10:43769171-43769193 CATTATGGAAAATGGTACAGAGG - Intergenic
1067311249 10:45115434-45115456 CTTTATGCAAAGGTGAAGAGAGG - Intergenic
1068296045 10:55073683-55073705 TATTATAAAAAATTGAAGAGGGG - Intronic
1068334279 10:55611574-55611596 CATTATGGAAAACAGAAGGGAGG + Intronic
1068448377 10:57153333-57153355 CACTAAGCAAAATTGAGCAGGGG - Intergenic
1069011636 10:63380507-63380529 CAATTAGCAAAATAGAAGAGTGG + Intronic
1069324280 10:67212295-67212317 ATTTATGCAATATTGAGGAGTGG - Intronic
1070911957 10:80126831-80126853 CATTCTGCACAGATGAAGAGGGG - Intergenic
1071761610 10:88614400-88614422 GATTATGGAAAATTTAACAGAGG - Intergenic
1073448310 10:103593941-103593963 CATTATCCCAAATTGCAAAGTGG - Intergenic
1073719612 10:106152232-106152254 CATTATGGAAAATAGTATAGAGG + Intergenic
1073817070 10:107219284-107219306 CATTATATAAAAATGAAGAAAGG + Intergenic
1075831471 10:125415427-125415449 CATAATGCAAAATTACAGATAGG - Intergenic
1076195056 10:128511921-128511943 CCTTGTGAAAAATTGAAGACTGG + Intergenic
1082738550 11:56884515-56884537 CATTTCCCAAAATTGAAGTGAGG + Intergenic
1083004352 11:59327835-59327857 CATTATGGAAAACTGTACAGAGG - Intergenic
1083040917 11:59685950-59685972 CATTATGGAAAACAGAATAGAGG + Intergenic
1083389928 11:62340977-62340999 CTTTATGTCAAATTGAAAAGTGG + Intronic
1084223715 11:67701326-67701348 CAGTATGCAATGTTGAAAAGCGG - Intergenic
1084805444 11:71575800-71575822 CATAAAGAAAAAATGAAGAGGGG + Intergenic
1085842843 11:80032851-80032873 CATTATGGAAAATAGAATGGAGG + Intergenic
1086107192 11:83158170-83158192 CATGATGCGAAAGGGAAGAGAGG + Intronic
1091317835 11:134627710-134627732 CATTATGCAAATGTGAACTGTGG - Intergenic
1091927338 12:4364883-4364905 CAATATGAAAAATGGCAGAGGGG - Intergenic
1092141477 12:6186633-6186655 CATTATCCCTAATTTAAGAGAGG + Intergenic
1093668953 12:21849402-21849424 CGTTATGCAAAATTTAAAACTGG - Intronic
1094141286 12:27184395-27184417 TATTATCAAAAATTGAAGAAGGG + Intergenic
1094404561 12:30102112-30102134 CAATATGCAAAAATGAATTGTGG - Intergenic
1094768677 12:33627345-33627367 CATTAAGTGAAATTGTAGAGGGG - Intergenic
1097551790 12:61080697-61080719 CATTATCCAAAATGAAAGAATGG + Intergenic
1097630504 12:62056272-62056294 CATTTTGCTAAATTGAAGAAGGG - Intronic
1097641561 12:62190013-62190035 CATTTTGTAAAATCCAAGAGGGG + Intronic
1098127081 12:67308438-67308460 TATTATGCAAAATAGGACAGAGG + Intronic
1098540651 12:71652744-71652766 CATAGTACTAAATTGAAGAGGGG + Intronic
1098770761 12:74550307-74550329 TATTATGCAAAACTGAAGCCTGG + Intergenic
1099270241 12:80499575-80499597 CATGAAACAATATTGAAGAGTGG - Intronic
1103149624 12:118625725-118625747 CATTATACAGAGTTGAAGAGAGG + Intergenic
1104119258 12:125783376-125783398 CAATAAGCAAAATTAAGGAGCGG - Intergenic
1107036155 13:35904807-35904829 CAATCTGCAAAATTGCAAAGGGG + Intronic
1108210623 13:48136391-48136413 CATTATGGAAAATTGTATGGAGG + Intergenic
1109052519 13:57502638-57502660 AAATATGGAAGATTGAAGAGGGG + Intergenic
1109151352 13:58852279-58852301 CATTTTGCAAAATAGAAGAAGGG + Intergenic
1109400084 13:61815718-61815740 TATTATGAAAAACTGAAGGGAGG + Intergenic
1109456613 13:62600885-62600907 CATTATGCAAAATAGCATGGAGG - Intergenic
1109805552 13:67436642-67436664 CATTATGGGAAATAGCAGAGTGG - Intergenic
1109956550 13:69575372-69575394 CATTATGGAAAACAGAACAGAGG - Intergenic
1110156987 13:72328962-72328984 ATTTATGCAAAATAGAAGTGAGG - Intergenic
1110556573 13:76866513-76866535 CATTATGGAAAATAGTATAGAGG - Intergenic
1110789269 13:79569418-79569440 CATTATGTAAAAATGAACACTGG + Intergenic
1111744675 13:92252096-92252118 CATTAAGCAACATTGAATTGAGG + Intronic
1111867074 13:93782502-93782524 CATTATGGAAAACAGAATAGAGG - Intronic
1111972888 13:94935361-94935383 CATTATTCAAAATAGACAAGAGG - Intergenic
1112683386 13:101793648-101793670 CATTATGGAAAATTGTATGGAGG - Intronic
1112889977 13:104217778-104217800 CATTCAGCAGAACTGAAGAGTGG - Intergenic
1113872683 13:113570799-113570821 CAATATCCAAAATGAAAGAGGGG + Intergenic
1115012261 14:28563202-28563224 CATTATAGAAAATTGTACAGAGG + Intergenic
1115388512 14:32826208-32826230 CAGTATGCAAAATTGAAGAAAGG + Intronic
1116214556 14:41995352-41995374 CATGATGAAAAATTGAGGAGGGG + Intergenic
1117782344 14:59246477-59246499 CATTATTCACAATAGCAGAGAGG - Intronic
1117820318 14:59642352-59642374 CATTATTCAAAATTGATAAAAGG - Intronic
1120085333 14:80265700-80265722 CATTATGTAAAATTGAATACAGG + Intronic
1120223786 14:81767006-81767028 CAATATGTAAAAAGGAAGAGTGG - Intergenic
1120411282 14:84159385-84159407 CAATATCCAAAATTGAACAGAGG + Intergenic
1120589487 14:86358490-86358512 CATTAAGCAAACTTGACTAGAGG - Intergenic
1120660638 14:87246204-87246226 CATTATGGAAAATAGTATAGAGG - Intergenic
1121509931 14:94505024-94505046 GATTAAGCAGAATTGAAGATAGG - Intronic
1121597882 14:95179732-95179754 CATGCTGCAGAATGGAAGAGAGG - Intergenic
1121907315 14:97758131-97758153 CATTATGCTAAAATGAGAAGGGG + Intronic
1123764079 15:23457554-23457576 CATTAAGCAACATTGAATTGAGG + Intergenic
1125057069 15:35373134-35373156 CATTATTCAAAGCTTAAGAGAGG - Intronic
1125276677 15:38000056-38000078 TATTCTGAAAAATTGAGGAGGGG - Intergenic
1125306243 15:38319027-38319049 AATTTTGTAAAATAGAAGAGGGG + Intronic
1125545296 15:40498971-40498993 CAATCTGCAAAAGTGAAGGGGGG - Intergenic
1125817174 15:42596037-42596059 GACTATGCAAAAATGAACAGTGG + Intronic
1126195638 15:45927418-45927440 CATTACTCAAACTTGAAGAAAGG + Intergenic
1126640916 15:50826002-50826024 AATTCTGGAAAATTCAAGAGAGG - Intergenic
1126643836 15:50855108-50855130 CTTTATGCAAAATTGAATGTAGG - Intergenic
1129480102 15:75817232-75817254 CACTATGCAAAATTAAAGTTAGG + Intergenic
1129622344 15:77159823-77159845 CATAATGAAAAATTGATAAGAGG - Intronic
1134589293 16:15439049-15439071 AATTAAACAGAATTGAAGAGGGG + Intronic
1136539248 16:30919816-30919838 AATTATGCAGAATGGATGAGTGG - Intergenic
1136732667 16:32431693-32431715 CATAATGCCAAACTCAAGAGTGG - Intergenic
1137030169 16:35516544-35516566 CATTATGAAAAATAGTACAGAGG + Intergenic
1138048599 16:53752373-53752395 CATTATTCATAATTAAAAAGTGG + Intronic
1140338645 16:74135914-74135936 AATGAAGCAAAATAGAAGAGTGG - Intergenic
1203020415 16_KI270728v1_random:397909-397931 CATAATGCCAAACTCAAGAGTGG + Intergenic
1203038750 16_KI270728v1_random:671067-671089 CATAATGCCAAACTCAAGAGTGG + Intergenic
1145190083 17:20832528-20832550 CATTATGGAAAACAGAAGGGAGG + Intergenic
1149385215 17:56136265-56136287 CTGTATGGAAAATTGTAGAGGGG + Intronic
1149945201 17:60917894-60917916 CATTATTCAAAATTGGCGAAAGG - Intronic
1153322074 18:3783519-3783541 CATTATGCTAAATGAAAGAAAGG + Intronic
1153417892 18:4869758-4869780 GAATAAGCAAAATTGAAGATAGG + Intergenic
1155023394 18:21917559-21917581 CTTTATATAAGATTGAAGAGGGG - Intergenic
1155470359 18:26185387-26185409 CAATATTCAAAGTTGCAGAGTGG - Intronic
1155863765 18:30938467-30938489 TCTTATAAAAAATTGAAGAGTGG - Intergenic
1155898539 18:31359772-31359794 CATTATGAAGAAGAGAAGAGAGG - Intergenic
1156586060 18:38432487-38432509 CATTCTGCCAAATTGTGGAGTGG + Intergenic
1156803963 18:41153824-41153846 CATTGTGAAAAAATGAAAAGTGG + Intergenic
1157069914 18:44394078-44394100 CATTTAGGAAAATTGAAGACTGG + Intergenic
1158688218 18:59634148-59634170 CATTTTGCAAAATGGAAATGAGG + Intronic
1158983859 18:62793285-62793307 CATTCTGGAAAATTGAATAATGG + Intronic
1159291279 18:66424767-66424789 CATTGTGCAAAATAGAATGGAGG + Intergenic
1159686899 18:71433442-71433464 CATTCTGCAAGATTGCACAGAGG - Intergenic
1161747705 19:6071046-6071068 CATTTGGCAAATTTGAAAAGAGG - Intronic
1161762730 19:6186429-6186451 GGTTATACAAAATTGAATAGTGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1168609692 19:57789245-57789267 CATTATACAAAAGAGCAGAGTGG - Intronic
926691172 2:15734904-15734926 CGTTTTTCAAAATTGAAGACTGG + Intronic
926979700 2:18555384-18555406 CATGACACCAAATTGAAGAGTGG + Exonic
927379867 2:22467033-22467055 CATTGTGGAAAATTCAAGAATGG + Intergenic
927609277 2:24521799-24521821 CATTATGAAAAATAGTAGGGAGG - Intronic
929355889 2:41023944-41023966 CATTGTGCCAAATAAAAGAGGGG + Intergenic
931576694 2:63724634-63724656 CATAAAGCAAAATTTAAGAGTGG + Intronic
932721518 2:74142066-74142088 TTTTATTCAAAATTGAAGACAGG - Intronic
933124216 2:78584034-78584056 CATAGAGCAAAATTGAAAAGAGG + Intergenic
933420915 2:82043892-82043914 TGGAATGCAAAATTGAAGAGTGG + Intergenic
935144253 2:100383820-100383842 CATCACGCAAAATTAAAGATGGG + Intergenic
936082643 2:109445285-109445307 AATTCTCCAAAATTGAAGAGGGG + Intronic
936393912 2:112103711-112103733 AATTTTCCAAAATTGGAGAGTGG + Intronic
936751125 2:115643394-115643416 CAGCATGAAAAATTGTAGAGAGG + Intronic
937039700 2:118811298-118811320 CATGATACAAAATTCAAAAGGGG + Intergenic
937704599 2:124905355-124905377 CATTATGGAAAAGAGTAGAGAGG + Intronic
937745317 2:125405236-125405258 CATTATGGAAAATAGTATAGCGG - Intergenic
938863508 2:135394447-135394469 GAATATGCAAAACTGAAGGGAGG + Intronic
939042438 2:137207113-137207135 CAAGATGTAAAAGTGAAGAGAGG + Intronic
939687760 2:145220747-145220769 CATTATGCATGATTGAAAACAGG + Intergenic
939792286 2:146592748-146592770 CAATATGCAAGAAGGAAGAGAGG - Intergenic
941201091 2:162511727-162511749 CAATATACAAAATTGCACAGTGG + Intronic
941301679 2:163810169-163810191 CATTTTCCAAAAGTGAAGAAAGG - Intergenic
941538693 2:166755291-166755313 TATTATGCAAAATTGTAGTGAGG - Intergenic
942530135 2:176901023-176901045 CATTCTGGAAATTTGAAGAGAGG + Intergenic
942774704 2:179567395-179567417 CATTATGGTAAATTGAAAAGTGG + Intronic
944005728 2:194903087-194903109 CAATTTGAAAAATTGATGAGAGG + Intergenic
944116122 2:196188088-196188110 TATTATGCAATAATGATGAGTGG + Intergenic
944604000 2:201333125-201333147 CATTATGGAAAACTGTATAGAGG - Intronic
945037727 2:205718285-205718307 CATCATGCAAATTTGAAAGGAGG + Intronic
945684035 2:212947396-212947418 CATTATGCTAAGTTAAATAGTGG - Intergenic
946597259 2:221319809-221319831 CATCATGCCAGATGGAAGAGGGG - Intergenic
946641738 2:221791129-221791151 CATTATGAAAAATTGCATAGAGG + Intergenic
947164583 2:227248908-227248930 CATTATGCAAATTTTAAAATAGG - Intronic
947359385 2:229332193-229332215 CCATATGCATAATTGCAGAGGGG + Intergenic
948511737 2:238471113-238471135 CATTCCAGAAAATTGAAGAGGGG - Intergenic
1169124061 20:3114592-3114614 CTTTATGTAAATGTGAAGAGAGG - Intronic
1169271383 20:4202064-4202086 CAGTATACAAAGTTGAAGAAAGG - Intergenic
1169386695 20:5156015-5156037 CATTAGGCAAAAATGAATGGGGG + Intronic
1172453995 20:35051856-35051878 CACTTTGATAAATTGAAGAGAGG - Intronic
1172740623 20:37163757-37163779 CATTCTGCAATATGGCAGAGTGG - Intronic
1172865858 20:38096680-38096702 CATTATGCTAAATGAAAGCGAGG - Intronic
1174229668 20:49035268-49035290 CAAGAGGCAAAATTAAAGAGAGG - Exonic
1174892963 20:54417706-54417728 AATTATGCAATATTGATTAGGGG - Intergenic
1175774906 20:61647041-61647063 AATTATGCAAAATTGAGCACAGG + Intronic
1177180931 21:17744444-17744466 CATTAAGTAAATTTGAAGCGGGG - Intergenic
1177801865 21:25835814-25835836 AAATCTGCAAAATTGGAGAGAGG - Intergenic
1179357714 21:40676753-40676775 CATGATGAAATATTGAAGAAAGG - Intronic
1180610915 22:17097268-17097290 CATTATGCAAAAGTCAGGAAAGG + Intronic
1182006806 22:26967121-26967143 CATTATACTAAGTTCAAGAGAGG + Intergenic
1182983207 22:34692178-34692200 CATTATGGAAAATAGTATAGAGG - Intergenic
1184740476 22:46426015-46426037 CATTATTCAAAAAAGAAGGGAGG - Intronic
1185129572 22:49031408-49031430 CAAAATGCAAAATTAATGAGGGG + Intergenic
950881309 3:16324893-16324915 CATTATGGAAAATAGTACAGAGG - Intronic
951215290 3:20018565-20018587 GTTTATGTAAAATTGAACAGAGG + Intergenic
951280960 3:20749073-20749095 CATTATGAAAAACTGTAGAGAGG + Intergenic
952752483 3:36836507-36836529 CATTATTGAAAAATGAATAGTGG - Intronic
954601140 3:51870683-51870705 AATTATCCAAAACTGGAGAGAGG + Intergenic
954845826 3:53554965-53554987 CACAATGCAAATTTGAAAAGGGG - Intronic
955871688 3:63445528-63445550 CATTATGCTAAAAAGAAGAGAGG - Intronic
956257866 3:67303832-67303854 CATTATTCCAAACTGAAGAGAGG - Intergenic
957700347 3:83702201-83702223 CAGTATTCAAATATGAAGAGAGG - Intergenic
959172741 3:102861982-102862004 CATTATGGAAAACAGTAGAGAGG + Intergenic
959254951 3:103997757-103997779 CATTATGAAAAATAGTATAGAGG + Intergenic
959369972 3:105511086-105511108 CATTCTTCTTAATTGAAGAGTGG - Intronic
960058829 3:113297930-113297952 CATTATGCACAATCCAGGAGGGG + Intronic
962489605 3:135880390-135880412 CATTCTGGAAAATAGTAGAGAGG + Intergenic
964453747 3:156838183-156838205 CTTTAAGCAACATGGAAGAGTGG + Intronic
965401589 3:168219083-168219105 GATTATGCTAAACGGAAGAGTGG - Intergenic
967492141 3:190104908-190104930 CATAATGCAAAAAAGAAAAGAGG - Intronic
968409540 4:377517-377539 CATAACGCAAAAATGAAGAAAGG - Intronic
971706698 4:30053180-30053202 CATTATGGAAAATGGCATAGAGG + Intergenic
972944787 4:44241005-44241027 AGTTATGCAAAAATGAAGTGTGG - Intronic
973724489 4:53761480-53761502 CATTATGGAAAACAGTAGAGAGG + Intronic
974719759 4:65723351-65723373 CAGTAAGCAAAATTGGAGAAGGG + Intergenic
974763001 4:66302867-66302889 CAAAATGCAAAAGTGAGGAGTGG - Intergenic
974766342 4:66351424-66351446 CATTAGGGAAAATTGTAGAGAGG + Intergenic
975787675 4:77909700-77909722 CATTATGCAATCTTGATTAGGGG - Intronic
975983165 4:80182203-80182225 AATTATGCAAAATTTAAAACAGG + Intergenic
976098822 4:81538563-81538585 CATTATGCAAAGATAAAGAGGGG - Intronic
977773330 4:100885855-100885877 CATTCTGAAAAATAGAGGAGGGG - Intergenic
978152596 4:105454790-105454812 GATTAGGCAAAATTGATGATAGG - Intronic
978434825 4:108672780-108672802 CATAATACAAAATTGAGAAGAGG + Intergenic
978623636 4:110659915-110659937 CATTCTGCAAAATTGATAAATGG - Intergenic
978742472 4:112152734-112152756 CATTATGAAACAATGAAAAGGGG + Intronic
978837161 4:113164673-113164695 CATAATGAAAAATTGATGAAAGG + Intronic
980312143 4:131144501-131144523 CATTATGGAAAATTGTATGGAGG + Intergenic
981556114 4:145996620-145996642 CATTATGGAAAACAGTAGAGAGG - Intergenic
986072026 5:4294986-4295008 CATTATTTAAGACTGAAGAGTGG + Intergenic
986957592 5:13172967-13172989 CATTATGGAATATAGAATAGAGG - Intergenic
987380949 5:17285503-17285525 CATTATGGAAAATTGCATGGAGG + Intergenic
987453021 5:18109691-18109713 CATTAAACAGAATTGAAGAAGGG - Intergenic
987541912 5:19266597-19266619 TAATATGCAAAATTGTAGTGTGG - Intergenic
987633876 5:20513035-20513057 TATTATGCACAATTTAAGAAAGG - Intronic
988270657 5:29011314-29011336 CATTATTCAAAAATGAAATGTGG + Intergenic
988439809 5:31220019-31220041 AACTATGCAAAATAAAAGAGAGG - Intronic
989440537 5:41467125-41467147 CATTATGGAAAATTGTATGGAGG - Intronic
989756429 5:44960915-44960937 CATGATTTAAAATTGAAGACTGG - Intergenic
990034233 5:51300160-51300182 AATTCTGGAAAAATGAAGAGAGG - Intergenic
990615390 5:57502438-57502460 CTTTGTGCAAAATTGAAAAAGGG + Intergenic
990651684 5:57907106-57907128 CATTATGCAACAGTTAAGAATGG - Intergenic
991159035 5:63473868-63473890 CATAATGCATAATTGAAAACTGG + Intergenic
995669622 5:114587248-114587270 CTTTAAGCAACATTTAAGAGTGG + Intergenic
995673096 5:114629856-114629878 CATATTACAAAATAGAAGAGAGG + Intergenic
995974936 5:118023001-118023023 CATTATGAAAAATAGGATAGTGG + Intergenic
998994317 5:147853741-147853763 CATTAGGTAGAATTGAAGACTGG - Intergenic
999924326 5:156358716-156358738 GATTTGGCATAATTGAAGAGGGG + Intronic
1000810094 5:165850664-165850686 CATTATGCAAAAGGAGAGAGGGG - Intergenic
1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG + Intronic
1001770148 5:174289245-174289267 CATTATGGAAAATAGCACAGAGG - Intergenic
1002281037 5:178130409-178130431 CATTAACCAAAACTGGAGAGAGG + Intergenic
1003804515 6:9712039-9712061 TATTATGCATAATTGATGAGTGG - Intronic
1003891064 6:10564214-10564236 CATTTTGCAAATATGAAGACGGG + Intronic
1004749246 6:18544135-18544157 GAATCAGCAAAATTGAAGAGAGG + Intergenic
1005784739 6:29232026-29232048 CATGATGCAAAATTTAACATGGG + Intergenic
1008838026 6:55861431-55861453 CATTTGGCAAAATAGAAAAGAGG - Intronic
1008847517 6:55985661-55985683 CCTTAGGCAAAATTGAAAAGTGG + Intergenic
1008864853 6:56197773-56197795 CATTATGAAAAATAGTATAGAGG + Intronic
1009281796 6:61761736-61761758 CATTTTACAAAATGGAATAGTGG - Intronic
1009286941 6:61830467-61830489 CATTAGGGAAAGTTGAAGACAGG - Intronic
1010726372 6:79338536-79338558 CAATAAGGAAAATTGAAGGGAGG + Intergenic
1010835281 6:80579456-80579478 CATTATGCCACTTTTAAGAGAGG - Intergenic
1011220499 6:85049901-85049923 CCTTATGTAAAATGGAACAGAGG - Intergenic
1011368505 6:86606677-86606699 CATTATGGAAAATGGTATAGAGG + Intergenic
1012345666 6:98182437-98182459 CAAAATGCAAAATTATAGAGAGG - Intergenic
1012896615 6:104956408-104956430 CATTTTGGAAAATTTTAGAGGGG - Intergenic
1013125542 6:107180745-107180767 CAAAATGGTAAATTGAAGAGTGG + Intronic
1014207112 6:118668010-118668032 CTTTTTGCAAAATTGAGGAGAGG - Intronic
1014647224 6:123989262-123989284 CTTTAAGCAAAATTTCAGAGAGG + Intronic
1015168185 6:130222604-130222626 CATTGAGAAAAATTTAAGAGTGG - Intronic
1015220172 6:130795418-130795440 CATTAACCAAAAATAAAGAGTGG + Intergenic
1015346105 6:132161606-132161628 CATTATGGAAAACAGAATAGAGG - Intergenic
1015362817 6:132359888-132359910 CATTTTGTAATATTGAAGGGAGG - Intronic
1015680400 6:135801327-135801349 CATTAACCAAAATTGAATAAAGG - Intergenic
1015808625 6:137139285-137139307 CATTATGCAAAATAATACAGAGG + Intergenic
1016327926 6:142923992-142924014 CATTTAGCAAAGCTGAAGAGAGG - Intronic
1016444171 6:144116206-144116228 CATTATGAAAAACAGTAGAGAGG - Intergenic
1018516764 6:164589397-164589419 CATTATGTATAAATTAAGAGTGG - Intergenic
1022955987 7:35380833-35380855 CATTATGCAACCTTGAAAAAAGG + Intergenic
1022988239 7:35681705-35681727 CATTATGCTAAGTTAAAGATAGG + Intronic
1024897536 7:54278171-54278193 CTTGATTCAAAATTGAATAGGGG - Intergenic
1026047848 7:66920109-66920131 CATTATGTAAAATTCAAAACAGG - Intergenic
1029062134 7:97809599-97809621 CATTATGAAAAATAGTATAGAGG + Intergenic
1032849205 7:135778972-135778994 CACTATGGAAAACTGAATAGAGG + Intergenic
1033512697 7:142075854-142075876 CATTATGGAAAATAGAATGGAGG + Intronic
1033896741 7:146080741-146080763 CATCATGCACAGCTGAAGAGTGG - Intergenic
1034606708 7:152323097-152323119 CATTATGGAAAATGGTAAAGAGG + Intronic
1035913013 8:3589160-3589182 CATTATGGAAAATAGTATAGGGG + Intronic
1035999569 8:4585322-4585344 GATTAGGCAAAGTTGAAAAGAGG + Intronic
1036481428 8:9143077-9143099 CATTATGGAAAATAGTAGGGAGG - Intronic
1037038208 8:14196072-14196094 CAGTATCCAAAATTCAGGAGAGG + Intronic
1037422442 8:18717542-18717564 CATGAAGCAAAATTGCAGAAAGG + Intronic
1038116894 8:24566558-24566580 CATTAAACAAAATACAAGAGAGG - Intergenic
1038897207 8:31797532-31797554 CATTATGGAAAATAGTAGAGAGG + Intronic
1039120355 8:34139264-34139286 CATTATTCAAAATTAAATTGTGG + Intergenic
1040516028 8:48135892-48135914 CATTACGTAAAAGGGAAGAGTGG - Intergenic
1040746205 8:50645240-50645262 GTTTATACACAATTGAAGAGAGG - Intronic
1041320780 8:56610487-56610509 CAATATGTAAAAGTGAAAAGTGG - Intergenic
1042095043 8:65205562-65205584 TTTTATGCACAATTGAATAGAGG - Intergenic
1043828479 8:84959008-84959030 CATTATGCAAAAATGTATGGAGG + Intergenic
1043890653 8:85649133-85649155 CATGATACAAAATTTCAGAGAGG + Intergenic
1043893835 8:85721370-85721392 CATGATACAAAATTTCAGAGAGG - Intergenic
1043898487 8:85757356-85757378 CATGATACAAAATTTCAGAGAGG + Intergenic
1043900099 8:85769550-85769572 CATGATACAAAATTTCAGAGAGG + Intergenic
1043902061 8:85784825-85784847 CATGATACAAAATTTCAGAGAGG + Intergenic
1043903671 8:85797018-85797040 CATGATACAAAATTTCAGAGAGG + Intergenic
1043905282 8:85809212-85809234 CATGATACAAAATTTCAGAGAGG + Intergenic
1043906892 8:85821399-85821421 CATGATACAAAATTTCAGAGAGG + Intergenic
1046076964 8:109324478-109324500 CATTATGGAAAATAGTAAAGAGG + Intronic
1046199321 8:110901554-110901576 CATTATGCTAAATTGATGGCTGG - Intergenic
1046645717 8:116783409-116783431 CATTATGTAAATTTGATGTGTGG + Intronic
1047125661 8:121957058-121957080 CAGTCTGCAAGATTGAAAAGAGG - Intergenic
1048725743 8:137381755-137381777 AATTATGACAAATTGAAGATCGG + Intergenic
1050242711 9:3654903-3654925 TATTCTAAAAAATTGAAGAGGGG - Intergenic
1050708229 9:8428548-8428570 TTTTATGCAAAGTGGAAGAGTGG - Intronic
1050964552 9:11781997-11782019 CATTTTGTAAATTTTAAGAGAGG + Intergenic
1052477957 9:28985433-28985455 CATTATGGAAAATTGTATAGTGG - Intergenic
1052523685 9:29584811-29584833 CAGAAGTCAAAATTGAAGAGGGG + Intergenic
1053613251 9:39737056-39737078 TCTAATGCAAAATAGAAGAGTGG - Intergenic
1053871294 9:42495004-42495026 TCTAATGCAAAATAGAAGAGTGG - Intergenic
1054240264 9:62605344-62605366 TCTAATGCAAAATAGAAGAGTGG + Intergenic
1054554397 9:66639870-66639892 TCTAATGCAAAATAGAAGAGTGG + Intergenic
1055442825 9:76353533-76353555 GATTATGTCAAATAGAAGAGTGG + Intronic
1055822549 9:80284692-80284714 TGTTATGGAAAATTGTAGAGTGG - Intergenic
1056411920 9:86337346-86337368 AATTATGCAAAATTTAATTGTGG + Intronic
1056594969 9:88000133-88000155 TATTATCCCCAATTGAAGAGGGG - Intergenic
1058339023 9:103871419-103871441 CATTATGTAAAACTGAAATGTGG + Intergenic
1058399933 9:104603982-104604004 CATTTTGCAAAATTAAAAATGGG - Intergenic
1058400772 9:104616551-104616573 CATTTTGCAAAATTAAAAATAGG - Intergenic
1059881820 9:118699117-118699139 CTTTATTCAGAATTGAAGTGGGG + Intergenic
1059903922 9:118960564-118960586 CATTATGCAAAGAAAAAGAGAGG - Intergenic
1061653398 9:132069012-132069034 CCTTATGCAAAATTGCACATTGG - Intronic
1186458998 X:9733526-9733548 CATTATGAAAAATTGTAAAAAGG + Intronic
1187427039 X:19187361-19187383 TATTTTGCCTAATTGAAGAGTGG - Intergenic
1187786254 X:22890306-22890328 CATTATGCATAATAGCAAAGAGG + Intergenic
1188902943 X:35757495-35757517 CATTATGGAAAACTGTATAGAGG - Intergenic
1189257684 X:39653189-39653211 CATTATGCAAATGTGAGAAGCGG - Intergenic
1190434858 X:50413778-50413800 CATTATGGAAAATGGTATAGGGG + Intronic
1190863657 X:54366753-54366775 CATTATGGAAAATGGTAGGGAGG + Intergenic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1192507216 X:71695196-71695218 CATATTTCAAAATAGAAGAGAGG + Intergenic
1192519481 X:71786356-71786378 CATATTTCAAAATAGAAGAGAGG - Intergenic
1192714380 X:73624315-73624337 CATAATGCAAAACAGAACAGAGG + Intronic
1193530399 X:82648591-82648613 GATTCTGGAAAATTGATGAGAGG - Intergenic
1193651124 X:84133669-84133691 TATTAAGCAAAAATGAAAAGAGG + Intronic
1195296172 X:103480065-103480087 CATTCTTCAAAATTAATGAGCGG + Intergenic
1195770411 X:108345256-108345278 TAGTATGTAAAAATGAAGAGTGG + Intronic
1198589087 X:138156191-138156213 CATATTGCAAATTTGAAAAGAGG - Intergenic
1198783585 X:140262480-140262502 CATTAAGCAAAAATCAAAAGTGG - Intergenic
1199703929 X:150407401-150407423 CAACATGCATAATTGAAGAAAGG + Intronic
1200967802 Y:9116715-9116737 CATGATTCAAAAATGAAAAGAGG - Intergenic