ID: 1001017975

View in Genome Browser
Species Human (GRCh38)
Location 5:168158654-168158676
Sequence ATCAAAAATGTCTCCAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 14, 2: 51, 3: 113, 4: 348}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001017967_1001017975 22 Left 1001017967 5:168158609-168158631 CCTCTACCCACAAGATGCCAATA 0: 2
1: 34
2: 330
3: 833
4: 1364
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017970_1001017975 5 Left 1001017970 5:168158626-168158648 CCAATAGCACCCTCCTCAAATTG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017973_1001017975 -8 Left 1001017973 5:168158639-168158661 CCTCAAATTGTGACAATCAAAAA 0: 3
1: 30
2: 122
3: 416
4: 1188
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017969_1001017975 15 Left 1001017969 5:168158616-168158638 CCACAAGATGCCAATAGCACCCT 0: 1
1: 7
2: 87
3: 318
4: 839
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017966_1001017975 27 Left 1001017966 5:168158604-168158626 CCTGGCCTCTACCCACAAGATGC 0: 8
1: 197
2: 632
3: 1146
4: 1533
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017972_1001017975 -5 Left 1001017972 5:168158636-168158658 CCTCCTCAAATTGTGACAATCAA 0: 1
1: 2
2: 12
3: 80
4: 383
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017965_1001017975 28 Left 1001017965 5:168158603-168158625 CCCTGGCCTCTACCCACAAGATG 0: 10
1: 215
2: 735
3: 1156
4: 1528
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017971_1001017975 -4 Left 1001017971 5:168158635-168158657 CCCTCCTCAAATTGTGACAATCA 0: 1
1: 0
2: 8
3: 72
4: 313
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348
1001017968_1001017975 16 Left 1001017968 5:168158615-168158637 CCCACAAGATGCCAATAGCACCC 0: 1
1: 21
2: 189
3: 612
4: 1143
Right 1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG 0: 1
1: 14
2: 51
3: 113
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001017975 Original CRISPR ATCAAAAATGTCTCCAGACT GGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903710647 1:25321358-25321380 AAAAAAAATGTCTACAGAATCGG + Intronic
904219456 1:28953495-28953517 AACACAAATGTGTCCAGATTAGG - Intronic
904545465 1:31267361-31267383 GTCTAAAATGTCTCCAAAGTGGG + Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906816337 1:48883760-48883782 ATCAAAATAGTCTACAGAGTTGG + Intronic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
907413289 1:54297332-54297354 ATAAAAACTGTCTCAAGGCTGGG + Intronic
907792075 1:57676710-57676732 AGCAAAAATTTCACCAGAATTGG - Intronic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
908022255 1:59910134-59910156 GTCAAAAATATATCCAGCCTTGG + Intronic
909284050 1:73791783-73791805 ATCAATATTCTCTCCAGAGTGGG - Intergenic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910451633 1:87352577-87352599 GTCACAAATGTGTCCAGAGTGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912139717 1:106708647-106708669 ATAAAAACTGTCAACAGACTAGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916391587 1:164336786-164336808 CTGACAAATGTCTCCAGAGTTGG - Intergenic
916537075 1:165713601-165713623 ATCAAAAATTTTTCCACATTCGG + Intergenic
918357266 1:183716946-183716968 ATCAAAAGAGCCCCCAGACTTGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
919597628 1:199583267-199583289 TTTAAAAATTTTTCCAGACTGGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
923431655 1:233927628-233927650 TTCAAAAATGTCTTCTGAATTGG - Intronic
924046205 1:240033743-240033765 TTAAAAAATTTCTCCAGTCTTGG - Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924292016 1:242546341-242546363 ATAAAAAATGACGCCAGAATTGG + Intergenic
1063770053 10:9186751-9186773 AGAAAAAATGTCTACATACTTGG - Intergenic
1063814020 10:9750647-9750669 ATCAGAAATGTCCCCAACCTAGG + Intergenic
1064184670 10:13151047-13151069 ATCAAGAATGTAACCAGACTTGG - Intergenic
1065280847 10:24135987-24136009 GTTAAAATTGTCTCCAAACTAGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067111507 10:43404560-43404582 ATCAAAACTACCTCCAGACTGGG + Intronic
1068164807 10:53315626-53315648 GTCAAAACTGTCACCAAACTAGG - Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068764602 10:60749062-60749084 ATCAAAACGGTGTCCAGACTTGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069480535 10:68777774-68777796 ATAAAAAATGTATCCGGGCTTGG + Intronic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1070410182 10:76132611-76132633 AGCAAAGATTTCTGCAGACTGGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074887008 10:117701762-117701784 TGCAAAAATCTCTCCAAACTGGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077592565 11:3503981-3504003 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1077682477 11:4255697-4255719 ATTAAACATGTGTCCAGAATAGG - Intergenic
1077687556 11:4311042-4311064 ATTAAACATGTGTCCAGAATAGG + Intergenic
1077692724 11:4362230-4362252 ATTAAACATGTGTCCAGAATAGG + Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1080437324 11:32257254-32257276 AACAAAAATATTTCCATACTAGG + Intergenic
1080750864 11:35148783-35148805 ATTAATAATGTTTCTAGACTTGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081868110 11:46370786-46370808 TTAAAAAATGTGTTCAGACTGGG + Intronic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084177469 11:67430727-67430749 ATCAAAAATGTGTCCATGCCAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084248402 11:67876705-67876727 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1084513346 11:69620099-69620121 ATCAAAAATTATTCCAGAATTGG + Intergenic
1084824420 11:71718776-71718798 GTCAAAGTTGTCTCCAGACCAGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086001413 11:81989921-81989943 ATTCAAAATGTGTCCAGAATTGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086915679 11:92527615-92527637 AACAAGAATTTCACCAGACTTGG - Intronic
1088193524 11:107251970-107251992 TTCAGAAATATCTCCAGCCTAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091390457 12:123107-123129 ATCAAAGATGTCTAGAGGCTGGG + Intronic
1091683307 12:2542192-2542214 ATAAAAAATGACTCCAGAAGGGG - Intronic
1091757702 12:3065828-3065850 ATCTAAAAAGGCACCAGACTTGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092770787 12:11894694-11894716 TTCAAAAATGTATTCAGACTTGG - Exonic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093175996 12:15914083-15914105 CTCAAAAATGTCTTGAGGCTGGG + Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096011168 12:48216663-48216685 ATTATGAATGTATCCAGACTTGG - Intergenic
1096629965 12:52920058-52920080 CTCTAAAATTACTCCAGACTTGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101317116 12:103639405-103639427 CTCAAAAATGTTTCCAGGCTGGG + Intronic
1101349404 12:103914737-103914759 ATCATAAATGTTTTCAGACTTGG + Intergenic
1101461568 12:104901756-104901778 ATAAAATAGGTTTCCAGACTGGG - Intronic
1101587294 12:106095937-106095959 ATCAAAAAAATTCCCAGACTCGG + Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102733594 12:115137097-115137119 ATTAAAAATCTCCCCAGACTTGG - Intergenic
1102795176 12:115683083-115683105 TTAAAAAATGTCTCCAAGCTGGG - Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105855407 13:24367309-24367331 TGCAAAAAGGTCTCCAGTCTAGG + Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1106951622 13:34890822-34890844 CTAAAAAATGTCTACAGACTGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1110523124 13:76504458-76504480 CTCATAAATGTCTCCAGATGAGG - Intergenic
1111519490 13:89381725-89381747 ATCACAAATGTCTTCAGGTTAGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112082961 13:95996164-95996186 AACAAAAATATTTTCAGACTGGG + Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1113971094 13:114189845-114189867 ATAAAGAATATCTCCAGGCTGGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115268435 14:31526105-31526127 AATAATAATGTCTCCAGAATTGG + Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1116250851 14:42481565-42481587 AGTAAAAATGTGTCCAGAATTGG + Intergenic
1116327806 14:43554685-43554707 ATAAAAAAGCTCTCCAGCCTGGG - Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1118139566 14:63065061-63065083 CTTAAAAATGTCTCCAGTTTAGG - Intronic
1119121468 14:72083296-72083318 CACAAAGATGTTTCCAGACTTGG - Intronic
1120171667 14:81252273-81252295 ATCAAAACTGTCTTCTGAATGGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1123671298 15:22661230-22661252 ATCAATAATGTATCTATACTTGG - Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124323337 15:28734459-28734481 ATCAATAATGTATCTATACTTGG - Intronic
1124527223 15:30467618-30467640 ATCAATAATGTATCTATACTTGG - Intergenic
1124771430 15:32540065-32540087 ATCAATAATGTATCTATACTTGG + Intergenic
1124946052 15:34267551-34267573 GTCAGAGATGTCTCCAGGCTGGG + Intronic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1129904386 15:79175932-79175954 ATCAAAAATATCTCCAGGTGTGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130288601 15:82576725-82576747 ATAAAAACTGACTCCAGGCTGGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131205092 15:90437832-90437854 TTCAAAAAATTCTCCAGACTGGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131530164 15:93184063-93184085 ATAAAAAATGTCTCTCGGCTGGG + Intergenic
1131750658 15:95504368-95504390 ATTAAAACTGATTCCAGACTTGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132074435 15:98808338-98808360 TTCAAAAATGTTTCCAGCTTTGG + Intronic
1132258166 15:100396516-100396538 ATCACGCATGTCTCCAGCCTGGG - Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133694939 16:8254025-8254047 ATCAAAAATATTTCCAGCTTCGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134621477 16:15692709-15692731 ATGCAAAATGGCTCTAGACTGGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135232816 16:20725675-20725697 ATCAAAAATGTCCCTAGGCTGGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136368052 16:29818329-29818351 ATCAAGAATGGCTCTAGGCTGGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137757018 16:50910485-50910507 ATCAAAAATGTCTCCTGCAGGGG + Intergenic
1138213324 16:55181169-55181191 ATGAAAAATGTTTCCAGGCCAGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139038078 16:62972197-62972219 ATAAAAAATTACTCCAAACTTGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141204239 16:81921011-81921033 ATAAAGAAGGTCCCCAGACTTGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142164134 16:88576601-88576623 AACAGAAAAGGCTCCAGACTTGG + Intronic
1143737067 17:8918963-8918985 ATATAGAATGTCTCCAAACTGGG - Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144381525 17:14703337-14703359 AGCTCAAATGTCTCCAGATTGGG - Intergenic
1144510852 17:15874923-15874945 ATCAAATATGTATCCAGTATTGG - Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145175016 17:20692614-20692636 ATCAAACATGTATCCAGTATTGG - Intergenic
1146700554 17:34955954-34955976 TTCAAAAATGTCTTCAAGCTAGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1146907623 17:36627969-36627991 TTCAAAAATATGTCCAGGCTGGG - Intergenic
1147507212 17:41030513-41030535 ATAAACAATTTGTCCAGACTTGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148832768 17:50445497-50445519 ATCAAAAGTGTCTACAGGCTGGG + Intronic
1149030258 17:52074305-52074327 ATGTAAAATGTCTCAAGCCTGGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153516506 18:5907620-5907642 TTAAAAAATGTCTGCAGACTGGG - Intergenic
1155775346 18:29754193-29754215 AACAGAAATCTCTCCAGCCTGGG - Intergenic
1157051906 18:44176068-44176090 ATCAAAATGGCCCCCAGACTGGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160012940 18:75120304-75120326 TTAAAAAATGTTTCCAGGCTGGG - Intergenic
1160443856 18:78912671-78912693 TTCAAAAATCTCCACAGACTTGG + Intergenic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162331756 19:10034139-10034161 ATGAAAAAACTCTCCAGACTCGG - Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163317199 19:16548978-16549000 CTCAAAAATGGCTTCAGGCTGGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163454804 19:17400248-17400270 ATTAAAAATGTTTCCAGGCTGGG - Intergenic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1165292401 19:34897992-34898014 GTCAAAAATATCTACAGAATAGG + Intergenic
1165501961 19:36196676-36196698 TTCAAAAATGAGTCCAGGCTGGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1167057452 19:47120989-47121011 AAAAAAAATGTCCCCAGGCTGGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926577338 2:14596676-14596698 ATTAAACATGGCTTCAGACTTGG + Intergenic
927724727 2:25412819-25412841 ATCTGAACTGTTTCCAGACTAGG + Intronic
928617765 2:33056517-33056539 TGCAAAAATGTGTCCAGATTTGG + Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929327671 2:40636935-40636957 ATCAAAGCTGTGGCCAGACTGGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930841345 2:55849910-55849932 AACATAAATTTCTCCAGCCTGGG - Intergenic
935451184 2:103211419-103211441 AACAAAACTGTTTTCAGACTGGG + Intergenic
935483636 2:103624641-103624663 ATAAAAACTGTCTACAGATTAGG + Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937787424 2:125918452-125918474 TTCCAAAATGTCACCATACTAGG - Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938941178 2:136170923-136170945 TTCAACAATGTCTCCAGTCCAGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941091954 2:161187128-161187150 ATCAAAAATTGTTCCAAACTGGG + Intronic
941427796 2:165369950-165369972 ATCATAAATGACTGCTGACTGGG - Intronic
941562294 2:167061920-167061942 ATAAAAAATGATTACAGACTTGG - Intronic
941819944 2:169834329-169834351 ATTTAAATTGTTTCCAGACTTGG + Intronic
942021256 2:171868138-171868160 ATGAAAAATGTATTCAGGCTGGG - Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
946311004 2:218882605-218882627 GGCAAATGTGTCTCCAGACTGGG + Intronic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947131361 2:226929460-226929482 ATAAAAAATGTCAACAAACTAGG + Intronic
947221930 2:227802152-227802174 TTCAAAAGTATCTCAAGACTGGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947922725 2:233892375-233892397 ATAATAAATATCTCCAGTCTGGG - Intergenic
948335467 2:237203710-237203732 ATAACAAATTTCTCCACACTTGG + Intergenic
948583611 2:239004583-239004605 ATAAAAAATGACCCCAAACTGGG - Intergenic
1169170144 20:3458172-3458194 GTCAAAAATGTCTTGAGGCTGGG + Intergenic
1169359103 20:4932943-4932965 ATCAAAAATATCACAATACTAGG + Intronic
1169836879 20:9890288-9890310 AATAAAAACATCTCCAGACTGGG + Intergenic
1170210463 20:13841927-13841949 ATCAAAAAAGTTGCCAGGCTGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173612788 20:44382871-44382893 TTCAAACATTTCTCCAGGCTGGG + Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174755372 20:53153231-53153253 AGCATAAATGTCCCCAGCCTGGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175629286 20:60519686-60519708 CCCAAATATGTCTCCAGCCTTGG + Intergenic
1175690312 20:61060624-61060646 CTCAAAAATCTCTGCAGTCTGGG + Intergenic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182934990 22:34212390-34212412 ATCATGAATTTCTCCAGATTAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
950345750 3:12290294-12290316 ATCCAAAAAGTCTTCAGCCTGGG - Intronic
950897696 3:16468392-16468414 GTCAAAAATGTCCCCACCCTGGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952125529 3:30295725-30295747 AAAAAAATTGTCTCTAGACTAGG + Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955090645 3:55747174-55747196 ATGAAAAATGTCAGCAGAATGGG - Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956280969 3:67556287-67556309 ATCAACACTGTTTCCTGACTTGG + Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961896362 3:130171328-130171350 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963437292 3:145288173-145288195 ATCAAAAACTTCTACAGCCTAGG - Intergenic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
963914752 3:150848722-150848744 TTAAAAAATTTCTCCAAACTGGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
965634880 3:170770842-170770864 ATCCCTAATGTCTCCAGACTAGG - Intronic
965641064 3:170829449-170829471 ATTAAAATGGTGTCCAGACTTGG - Intronic
966447755 3:180022687-180022709 TTGAAAAGTGTCTCCACACTGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969691011 4:8704188-8704210 ATGAAAAATGTCACCCGTCTCGG - Intergenic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971400586 4:26272018-26272040 CTTAAAAATGTCTCCTGACTAGG + Intronic
971691487 4:29842030-29842052 CTCAAAAAGGTCTCCAACCTTGG + Intergenic
972424252 4:38917835-38917857 ATCACAAAAATCTCCAGGCTAGG - Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
973747643 4:53980129-53980151 GTCAAAAATTTCTTCAGGCTGGG + Intronic
974591820 4:63959295-63959317 ATCAAATATGTCTACATATTAGG - Intergenic
975089447 4:70384420-70384442 ATTTAAAATGTCTCAACACTTGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977376894 4:96216967-96216989 GTAAAAAATGTCTCCAAACGTGG + Intergenic
979161116 4:117462704-117462726 ATTTAAAATGTCTTCAGGCTGGG + Intergenic
979392908 4:120148086-120148108 ATCAAAAAAGAATTCAGACTGGG + Intergenic
980254368 4:130358550-130358572 AATAAAAATATTTCCAGACTGGG - Intergenic
981595426 4:146415993-146416015 TTTTAAAATTTCTCCAGACTTGG - Intronic
981689241 4:147488318-147488340 ATCTGGAATGTCTCCAGATTTGG + Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
982186845 4:152811151-152811173 AAGAACAATGTCTCCAGAGTGGG - Intronic
983122224 4:163900582-163900604 ATCAAAAATGTTTACATATTAGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984573811 4:181424156-181424178 ATAAAAAAATTCTCAAGACTTGG - Intergenic
984773920 4:183463734-183463756 CTTAAAAGTGTGTCCAGACTTGG + Intergenic
986329590 5:6707712-6707734 ATCCAAAGCGTCTCCAGACGTGG + Intergenic
986668864 5:10126231-10126253 GTGAGAAATGACTCCAGACTGGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987040307 5:14055953-14055975 ATGAAAAATGTCTCCAGGTGGGG - Intergenic
987062566 5:14256591-14256613 AGCAAAATAGTCCCCAGACTTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988046750 5:25965791-25965813 AATAAAAATGTCTTCAGAATTGG + Intergenic
988163783 5:27556218-27556240 ATCAAGAATGTATCCAAAATAGG + Intergenic
988373172 5:30399463-30399485 AGCAAAAATGTCTTCAAAGTAGG + Intergenic
989023123 5:37033861-37033883 ATCAAAAATATATTCAGGCTGGG - Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990189262 5:53240377-53240399 ATGAAAAATGTTTCCATACCTGG - Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992561786 5:77959269-77959291 TGCTAAAATGTTTCCAGACTAGG - Intergenic
992633181 5:78701183-78701205 TTCAAAATTGTCTCTAGGCTGGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
996980474 5:129486546-129486568 ATCAAAACTGTCAACAAACTAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998243895 5:140478515-140478537 ATCAAAATTGACTCTAGAATAGG + Intronic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004087667 6:12467240-12467262 TTCAAAGATGTTTCCATACTTGG - Intergenic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004710997 6:18170195-18170217 ATTTAAAATGATTCCAGACTTGG - Intronic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005392306 6:25345910-25345932 ATCAAGAATGACACCAGACTGGG - Intronic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006715458 6:36116374-36116396 ATAAAAAAGTTCTCCAGGCTGGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010042150 6:71397450-71397472 AATAAAAAGGTCTCCAGCCTGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014697932 6:124647249-124647271 ATTAAAAATGACTTCAGTCTGGG + Intronic
1015435878 6:133187449-133187471 AGCTAAAATCTCTCCAGATTTGG + Intergenic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1017508157 6:155087777-155087799 ATAAAAAATTTGTCCATACTGGG + Intronic
1017600324 6:156073434-156073456 CTCAAAATTATCTCCAGAGTTGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020327066 7:6982964-6982986 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1020717240 7:11690173-11690195 ATCCAAAAAGTAACCAGACTTGG + Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023119117 7:36891695-36891717 ATCAAAAATGTCTACATCATTGG - Intronic
1023217386 7:37878145-37878167 ATAAAAATTCTCTCCAAACTAGG - Intronic
1023296518 7:38720730-38720752 ATTAAAAATGACTCCAGGCCTGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026031984 7:66802187-66802209 TTTAAAAATGTCTCCAGGCCTGG - Intronic
1026555359 7:71403953-71403975 ATCAAATTTGTCTACAGGCTGGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027915040 7:84306931-84306953 AAAAAAAAAATCTCCAGACTTGG - Intronic
1029335137 7:99892423-99892445 TTCAAAAATGTCCCCAGATGTGG - Exonic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032635328 7:133701188-133701210 ATAAAAAATTTCTCAAGTCTAGG - Intronic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036369564 8:8151123-8151145 CTCAAAGTTGTCTCCAGACCAGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036474327 8:9079483-9079505 ATTTAAAATGTGTCCAGAATGGG + Intronic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036881324 8:12514521-12514543 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1039942395 8:42102372-42102394 ATAAGAAATGTCTCCAGGCCAGG + Intergenic
1040965397 8:53076707-53076729 CTCCAAAATGTGTCCAGAATTGG + Intergenic
1041878859 8:62723007-62723029 ATCAGAACTGTTTCCAGCCTTGG + Intronic
1042291796 8:67176585-67176607 AAGAAAAATGCCACCAGACTGGG - Intronic
1042449126 8:68923726-68923748 ATAAAAAATGTTTCCTGAATTGG - Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1045367752 8:101492763-101492785 ATCAAACATGTCACAAGAGTCGG + Exonic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047063646 8:121255599-121255621 ATAAAAAATTTCCACAGACTTGG - Intergenic
1047612300 8:126533006-126533028 ATAAAAAATTGCTGCAGACTGGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050073890 9:1843890-1843912 ATCACAAATTGCTGCAGACTGGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050916971 9:11148475-11148497 TTCACAAATGTCTTCAGGCTGGG - Intergenic
1051229527 9:14941059-14941081 TGCAAAAATATCTCCAGTCTGGG - Intergenic
1051680395 9:19601565-19601587 AGTAAAAATGTATCCAGAGTTGG - Intronic
1051925601 9:22321134-22321156 ATCAAAACTGTCTGCAGGTTTGG - Intergenic
1052608588 9:30738821-30738843 AGCCAAAATCTCTCCAGAGTCGG - Intergenic
1052791769 9:32881769-32881791 ATAAAGAATGGTTCCAGACTGGG - Intergenic
1053208077 9:36204960-36204982 ATTAAAAATATCCCCAGGCTCGG - Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1056961055 9:91123693-91123715 AACAAAAATGTGTTCTGACTAGG + Intergenic
1057034084 9:91799238-91799260 ATCAAAAATGTCTTCGGCTTTGG - Intronic
1057636749 9:96776477-96776499 ATCAGAAACGTCTCCAGGCCGGG + Intronic
1058542106 9:106022249-106022271 ATTAAAAATCTCTCCTGACTTGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059787413 9:117600522-117600544 GTCAAAAATGTCCCAAGTCTTGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061769542 9:132907789-132907811 TTAAAAAATGGCTGCAGACTGGG + Intronic
1062431058 9:136527055-136527077 CTCAAAACTTTCTCCAGGCTCGG - Intronic
1185646924 X:1622578-1622600 TTTAAAAATGTCTCCTGGCTGGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186644411 X:11491091-11491113 TTCAAATTTGTCTCTAGACTTGG + Intronic
1186716192 X:12254492-12254514 ATCAAGAATCTCTAGAGACTAGG - Intronic
1187293749 X:17979328-17979350 TTTAAAAATGTCCCCAAACTTGG + Intergenic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187779466 X:22802448-22802470 AACAAAACTGTCTGCAAACTAGG - Intergenic
1188281120 X:28270863-28270885 ATCAAAAATGTTCCTAGATTAGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189448302 X:41102320-41102342 ATAAAAAATGTTACTAGACTGGG + Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1191067762 X:56368181-56368203 AAAAAAAATGTCTCTGGACTAGG - Intergenic
1193439841 X:81526271-81526293 ATTAAAAATTTCAACAGACTAGG - Intergenic
1193805012 X:85984899-85984921 ATGAAAAATATCACAAGACTGGG + Intronic
1193816050 X:86106440-86106462 ATAAAAAACTTCTCAAGACTGGG + Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1194670015 X:96720257-96720279 TACAAAAATCTCTCCAGCCTTGG + Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195709842 X:107765065-107765087 ATCAAAAGTGTCCCCACACCAGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1199114486 X:143975005-143975027 AACATAAATGTCACCAGCCTTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200904241 Y:8465050-8465072 ATCCAAAATGTCTCAACACCTGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic