ID: 1001021717

View in Genome Browser
Species Human (GRCh38)
Location 5:168188762-168188784
Sequence ATTCCAGGGCCTGCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001021713_1001021717 2 Left 1001021713 5:168188737-168188759 CCTGAGAATCATGTTTAAAATGC 0: 1
1: 0
2: 8
3: 65
4: 323
Right 1001021717 5:168188762-168188784 ATTCCAGGGCCTGCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001021717 Original CRISPR ATTCCAGGGCCTGCTCCTGG AGG Intronic