ID: 1001024273

View in Genome Browser
Species Human (GRCh38)
Location 5:168210288-168210310
Sequence CTATGTTGGGGGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 571}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001024273_1001024281 25 Left 1001024273 5:168210288-168210310 CCCTTCTCCTTCCCCCAACATAG 0: 1
1: 0
2: 1
3: 46
4: 571
Right 1001024281 5:168210336-168210358 GATGTTCTTAGGAAAGAAGTAGG 0: 1
1: 0
2: 2
3: 17
4: 261
1001024273_1001024280 14 Left 1001024273 5:168210288-168210310 CCCTTCTCCTTCCCCCAACATAG 0: 1
1: 0
2: 1
3: 46
4: 571
Right 1001024280 5:168210325-168210347 AACTGAAAGCAGATGTTCTTAGG 0: 1
1: 0
2: 0
3: 20
4: 238
1001024273_1001024282 30 Left 1001024273 5:168210288-168210310 CCCTTCTCCTTCCCCCAACATAG 0: 1
1: 0
2: 1
3: 46
4: 571
Right 1001024282 5:168210341-168210363 TCTTAGGAAAGAAGTAGGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001024273 Original CRISPR CTATGTTGGGGGAAGGAGAA GGG (reversed) Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903012547 1:20341936-20341958 TTATTTTGGAGTAAGGAGAAAGG - Intronic
903143769 1:21356499-21356521 CTCTGTTGGGGGAAAGAGCTTGG - Intergenic
903406257 1:23099077-23099099 GTAGGCTGGGGAAAGGAGAAGGG - Intronic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
904313522 1:29644984-29645006 CAATCATGGCGGAAGGAGAAGGG + Intergenic
904612866 1:31735096-31735118 CCATGGTGGGGGGAGGAGGAGGG - Intronic
904706761 1:32396651-32396673 CAATGATGGAGGAAGGTGAAAGG + Intergenic
905598527 1:39230171-39230193 GTATGTTTGGGGAAGGAATAAGG + Intronic
906760627 1:48373867-48373889 CTATGTTGTGGGAAGGACCCAGG - Intronic
907474630 1:54697547-54697569 CCATGGTGAGGGAAAGAGAAAGG + Intronic
908098575 1:60766637-60766659 CAATCATGGTGGAAGGAGAAAGG - Intergenic
908626616 1:66051424-66051446 CTATTTTGGGGGAAAGATTAGGG + Intronic
908820519 1:68081387-68081409 CAATGTTGGGGGATGGAGTTTGG + Intergenic
908985377 1:70011446-70011468 CTGTCATGGGGTAAGGAGAAGGG - Intronic
909012798 1:70353932-70353954 CTAGGCTCGGGGAAGGAGAGAGG + Intronic
909101298 1:71352521-71352543 CAATCATGGGGGAAGGAGAAAGG - Intergenic
909919813 1:81367367-81367389 CTATTTGGGGGTCAGGAGAAGGG - Intronic
910176541 1:84436832-84436854 GAATGGTGGGGGAAGAAGAAGGG - Intergenic
910417032 1:87012318-87012340 CAATTATGGGGGAAGGTGAAGGG + Intronic
911082941 1:93951142-93951164 CAATCATGGGGGAAGGTGAAGGG + Intergenic
911419942 1:97628091-97628113 GGATGTTGGGGGAAAGGGAAAGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
914397072 1:147279884-147279906 CTATGATGGGGAGAGCAGAAAGG + Intronic
914909882 1:151776271-151776293 GTATGTGGGGAGGAGGAGAAAGG + Intronic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915318848 1:155044903-155044925 AGATGGTGGGGGAAGGGGAAAGG + Intronic
915444704 1:155967976-155967998 GAGTGTTGGGGGTAGGAGAAGGG - Intronic
915479128 1:156173207-156173229 CTATGGTGGGGGAGGCAGACAGG + Intronic
916054552 1:161059414-161059436 CTAAGTTGGGGGAGGGACCATGG + Intronic
916681659 1:167110236-167110258 CTATGTTGGAGGAAGGATCTGGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918590484 1:186235702-186235724 ATATGTTGGGAGGGGGAGAAAGG - Intergenic
918691622 1:187487734-187487756 CAATCATGGTGGAAGGAGAAAGG + Intergenic
919006633 1:191908005-191908027 CAATCATGGTGGAAGGAGAAGGG + Intergenic
919261232 1:195196817-195196839 TTATGTTTGGGGAAGAAGAAAGG - Intergenic
919946119 1:202320095-202320117 CTGAGTTGGGGCAGGGAGAAAGG + Intergenic
921055121 1:211537620-211537642 CTAGGTTGGGGGGAGCAGAAGGG - Intergenic
921335326 1:214079922-214079944 CTATCATGGTGGAAGGTGAAAGG - Intergenic
921632488 1:217452750-217452772 CTATGTTGGGGGTCGGGGAAGGG - Intronic
921664550 1:217852559-217852581 CTCTGTTGGTGGCAAGAGAAGGG - Intronic
921758472 1:218884993-218885015 CAATCATGGCGGAAGGAGAAGGG + Intergenic
922214914 1:223512275-223512297 CTAGCCTGGGGGAAAGAGAAAGG + Intergenic
922351666 1:224739140-224739162 CAGTGTTGTGGGAAGTAGAAGGG + Intronic
922994847 1:229947703-229947725 CTATGTTCGAGGAAGGAAGAAGG + Intergenic
923275105 1:232388774-232388796 CGATGTTGAGGTTAGGAGAAGGG - Intergenic
924357224 1:243193343-243193365 CTATATGGGGGGAGGGAGAGAGG - Intronic
924619086 1:245644954-245644976 CGATGATGGTGGAAGGTGAAAGG + Intronic
1063024119 10:2160983-2161005 CAATCATGGCGGAAGGAGAAGGG + Intergenic
1063095082 10:2902055-2902077 CGATCATGGGGGAAGGTGAAGGG + Intergenic
1063310100 10:4944253-4944275 CCATGATGGAGGAAGGTGAAGGG - Intronic
1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG + Intergenic
1065345841 10:24747413-24747435 CTCTGAGGGGGGAAGGAAAAGGG + Intergenic
1066018429 10:31271791-31271813 CTATCATGGTGGAAGGTGAAAGG + Intergenic
1067893977 10:50160208-50160230 CTATTTAGGGGAAAGGGGAAAGG - Intergenic
1068749684 10:60577589-60577611 CAATCATGGTGGAAGGAGAAAGG - Intronic
1068750569 10:60587068-60587090 CAATCATGGTGGAAGGAGAAGGG + Intronic
1068878909 10:62027953-62027975 CTTTATGGGAGGAAGGAGAAAGG + Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070441725 10:76452659-76452681 TTATGTTGGGGTAAGGAGTTTGG + Intronic
1070925816 10:80220852-80220874 CTATGGTGGGGGAGGAAGGAGGG - Intergenic
1073612551 10:104958802-104958824 CAATGATGGTGGAAGGTGAAGGG + Intronic
1073785598 10:106885907-106885929 CAATCATGGGGGAAGGTGAAAGG - Intronic
1074317633 10:112373868-112373890 CTACCTCAGGGGAAGGAGAAGGG - Intergenic
1074958864 10:118420433-118420455 GTAGGGTGGGGGAAGGAGACAGG + Intergenic
1075121162 10:119666055-119666077 GCATGTGGGGGGAAGGGGAAAGG - Intronic
1076020899 10:127072132-127072154 CCATGATGGAGGAAGGAGAAAGG - Intronic
1076230968 10:128819870-128819892 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1076442451 10:130489496-130489518 TGAAGGTGGGGGAAGGAGAAAGG - Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1078516973 11:12030851-12030873 CCATGATGGTGGAAGGTGAAGGG - Intergenic
1078653882 11:13220439-13220461 CTATGTTTGGGGGTGGGGAAAGG - Intergenic
1079777526 11:24551430-24551452 CTTGAGTGGGGGAAGGAGAATGG + Intronic
1080101314 11:28462963-28462985 GTTTGTTGGGGGAATGACAAGGG + Intergenic
1080177018 11:29376817-29376839 CTATATTGAGGTAAAGAGAATGG - Intergenic
1080266005 11:30402667-30402689 CTAAGATGGGGGTGGGAGAATGG - Intronic
1081298046 11:41416047-41416069 CTAGGTTTGGGGAAGGAGATAGG + Intronic
1081354552 11:42096232-42096254 CAATCATGGTGGAAGGAGAAAGG - Intergenic
1081659177 11:44877449-44877471 CTGTGTTGGGGATGGGAGAACGG - Intronic
1082122859 11:48398165-48398187 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082556560 11:54569441-54569463 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082985866 11:59170981-59171003 CTCTGTTGGGAGAAAGATAAAGG + Intergenic
1083145223 11:60753062-60753084 CTCGGTGGGGGGAGGGAGAAGGG - Intergenic
1083579545 11:63816079-63816101 CTATGGTGTGGTAAGGAGACAGG + Intronic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1085277968 11:75312138-75312160 CGAGGGTGGAGGAAGGAGAAGGG - Intronic
1085750094 11:79154235-79154257 CAATCATCGGGGAAGGAGAAAGG + Intronic
1086109078 11:83179165-83179187 CAGTGTTGGGTGAAGGAGAAAGG - Intronic
1086869480 11:92019062-92019084 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1087578655 11:100024281-100024303 CAATCATGGGGGAAGGTGAAAGG - Intronic
1088689987 11:112317820-112317842 CAATATTGGGGGGAAGAGAAAGG - Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088979858 11:114852342-114852364 CACTGCTGGAGGAAGGAGAAAGG + Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089600636 11:119612401-119612423 CAATCATGGTGGAAGGAGAAGGG - Intergenic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091118962 11:133040803-133040825 CCAGGATGGGAGAAGGAGAAAGG + Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1092394371 12:8112366-8112388 AAATGTTGGGGGAGGGAGGAAGG - Intergenic
1093120943 12:15270796-15270818 CAATGATGGTGGAAGGCGAAGGG + Intronic
1093350877 12:18102285-18102307 CAATCATGGTGGAAGGAGAAGGG + Intronic
1093426173 12:19031849-19031871 CAATCTTGGGGGAAGGCAAAGGG + Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093485335 12:19646267-19646289 CAATCTTGGTGGAAGGCGAAGGG + Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095257711 12:40059589-40059611 CAATGTATGGGGAAGGAGCACGG + Intronic
1096689273 12:53309510-53309532 ACATCTTGGGGGAAGGAGGAGGG - Intronic
1096801196 12:54111808-54111830 GTATCTTGGAGGAAGGAAAATGG + Intergenic
1097017059 12:55994610-55994632 TTATGTTGGGAGAGGAAGAAAGG - Exonic
1097198942 12:57261810-57261832 TCAGGTTGGGGGAAGGAGCATGG + Intronic
1097669067 12:62514455-62514477 CAATCTTGGAGGAAGGTGAAAGG + Intronic
1098194701 12:67987390-67987412 CAATCATGGTGGAAGGAGAAGGG - Intergenic
1098525696 12:71484303-71484325 CTATCTTGGGGGAAAGAAACTGG + Intronic
1098694068 12:73529039-73529061 CAATCATGGGGGAAGGCGAAGGG - Intergenic
1099017498 12:77361609-77361631 ATATTTTGGGGGATGGGGAAAGG - Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099133267 12:78863458-78863480 CGAGGTTGAGGGAGGGAGAAAGG + Intergenic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1099641631 12:85295770-85295792 CGATGTTGGTGGCAGGAGATAGG + Intronic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100297908 12:93279849-93279871 CTTTGTTGGGGGATGGAACATGG - Intergenic
1101041436 12:100759837-100759859 TTATATGGGGGGAAGAAGAAAGG - Intronic
1101408336 12:104448545-104448567 CTATTTTTAGGGAAAGAGAAGGG + Intergenic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1102316146 12:111889310-111889332 ACAGGTTGGGGGATGGAGAATGG + Intronic
1102575619 12:113854459-113854481 GGTTGATGGGGGAAGGAGAATGG - Intronic
1103071195 12:117944001-117944023 CTATCATGGTGGAAGGTGAAAGG - Intronic
1103916668 12:124379297-124379319 CTAAGCTGGGGGAAGAAGAGTGG - Intronic
1104030047 12:125058499-125058521 CTATTTTGGGGGAAGTTGATTGG + Intergenic
1104263125 12:127203674-127203696 CAATGATGGCGGAAGGTGAAGGG + Intergenic
1104391465 12:128394084-128394106 CAATCGTGGGGGAAGGTGAAAGG + Intronic
1104597931 12:130132653-130132675 CCATGTTCTGGGAAGGAGGAAGG - Intergenic
1105628171 13:22134241-22134263 CTAAATTTGGGGATGGAGAATGG + Intergenic
1105955598 13:25279357-25279379 CAATCTTGGTGGAAGGTGAAGGG - Intronic
1106857369 13:33867742-33867764 CTATGTTGGCTGAAGATGAAAGG + Intronic
1107785203 13:43948749-43948771 GTTTGATGGGGGATGGAGAAGGG + Intergenic
1108174426 13:47777668-47777690 CAATTATGGTGGAAGGAGAAGGG - Intergenic
1110057011 13:70986097-70986119 CTATGTTGTAGCAAAGAGAATGG - Intergenic
1110073690 13:71211595-71211617 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1111018546 13:82414703-82414725 CTAAGTTGCAGGAAGGAAAAGGG + Intergenic
1111772154 13:92610713-92610735 CAATCTTGGTGGAAGGTGAAGGG + Intronic
1112027357 13:95423613-95423635 CAATCATGGCGGAAGGAGAAAGG + Intergenic
1112146727 13:96708542-96708564 CTATGAGGAGGGAAGGAGAGAGG - Intronic
1112971970 13:105272769-105272791 CTATCATGGCGGAAGGAGAAGGG + Intergenic
1112998308 13:105600946-105600968 CAATGATGGTGGAAGGCGAAGGG + Intergenic
1113028648 13:105969836-105969858 CTATGTTGTAGGAGGGAGAAGGG - Intergenic
1113584289 13:111452782-111452804 CTATCATGGCGGAAGGCGAAGGG - Intergenic
1114444890 14:22780885-22780907 TTTTGTTGGGGGAGGGATAATGG - Intronic
1115121554 14:29942794-29942816 CAATCTTGGTGGAAGGTGAAGGG - Intronic
1116120673 14:40718406-40718428 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1116863141 14:50010381-50010403 CTATGATGAAGGAAGGGGAATGG - Intergenic
1116877355 14:50125756-50125778 CTAAGTAGGGGAGAGGAGAATGG - Intronic
1118138059 14:63049522-63049544 CTGAGTTGGGGGGAGCAGAAAGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118475823 14:66115900-66115922 ATATGTTGGGGGCCAGAGAAAGG + Intergenic
1120010045 14:79403397-79403419 CTCAGTAGGGGGAAGGAAAAAGG + Intronic
1120107144 14:80508973-80508995 CAATCATGGCGGAAGGAGAAGGG + Intronic
1120211707 14:81640190-81640212 CAATGATGGCGGAAGGTGAAGGG + Intergenic
1120826744 14:88963052-88963074 CTATCCGAGGGGAAGGAGAAGGG - Intergenic
1121318665 14:92977711-92977733 CAATGATGGTGGAAGGTGAAAGG - Intronic
1121613630 14:95298208-95298230 CTATTGGGGGGGAAGGGGAAGGG - Intronic
1121693207 14:95892540-95892562 CTATGTTTGGGGAAGTGGCATGG + Intergenic
1122040072 14:98981119-98981141 CAGGGTTGGGGGAAGGGGAATGG + Intergenic
1122869228 14:104627888-104627910 CAATCATGGTGGAAGGAGAAGGG - Intergenic
1122877283 14:104674116-104674138 CAATCGTGGGGGAAGGTGAAGGG - Intergenic
1123140415 14:106072196-106072218 CAATGATGGTGGAAGGTGAACGG - Intergenic
1124382922 15:29182703-29182725 CTCTCTTGGAGGAATGAGAATGG + Intronic
1124622097 15:31279608-31279630 CTAGGTTTGGGCAGGGAGAAAGG - Intergenic
1125967526 15:43886397-43886419 ATATCCTGGGGGAGGGAGAAAGG - Intronic
1126216883 15:46165698-46165720 CTATGTTGGAGGATGGACAAAGG + Intergenic
1127197527 15:56605637-56605659 CAATGGTGGTGGAAGGTGAAGGG + Intergenic
1127693238 15:61418535-61418557 CACTGTTGGGTTAAGGAGAAAGG - Intergenic
1128442568 15:67725936-67725958 CTATGTACGGGGAGGGAAAAGGG - Intronic
1128786731 15:70403245-70403267 CTATGTTGGGGGAGAGTGAGGGG - Intergenic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1129585663 15:76861880-76861902 CAATCATGGTGGAAGGAGAAGGG + Intronic
1129600798 15:76996916-76996938 CAAAGTTGGGGGAAGGGGTAGGG + Intronic
1130635804 15:85618828-85618850 TTATTTTTGGGGAGGGAGAAGGG - Intronic
1131332494 15:91514793-91514815 GCATGTGGGTGGAAGGAGAAAGG + Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133517852 16:6527355-6527377 CTTTGTTGGGGGAGGAAGGAAGG - Intronic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1135777868 16:25272673-25272695 CAATAATGGTGGAAGGAGAAGGG - Intergenic
1135817941 16:25652987-25653009 CAATCTTGGTGGAAGGTGAAAGG + Intergenic
1135930561 16:26732790-26732812 CAATCATGGCGGAAGGAGAAAGG - Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136682359 16:31975783-31975805 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136782617 16:32916951-32916973 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136887177 16:33936899-33936921 CTATGCATGTGGAAGGAGAAAGG + Intergenic
1137803370 16:51281799-51281821 CTTTGCTGAAGGAAGGAGAAAGG + Intergenic
1137868925 16:51930806-51930828 CCAAGTTTGGGGAAAGAGAAGGG + Intergenic
1138075194 16:54035486-54035508 GTATTTTGAGGGGAGGAGAAGGG + Intronic
1138114647 16:54350746-54350768 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1138157757 16:54721737-54721759 CAATCATGGTGGAAGGAGAAAGG - Intergenic
1138257183 16:55576133-55576155 CTTGGTTTGGGGAAGGGGAAGGG + Intronic
1138325498 16:56162703-56162725 CTTTGTTGAAGGAAAGAGAAGGG + Intergenic
1138396103 16:56705825-56705847 CAAGGTTGGGGGAGGGAGGAAGG - Intronic
1140343402 16:74188229-74188251 CAATTATGGTGGAAGGAGAAGGG + Intergenic
1140375552 16:74442875-74442897 CAATCATGGGGGAAGGCGAAAGG + Intergenic
1140681415 16:77388759-77388781 CAATGTTCAGGGAAGCAGAAAGG + Intronic
1140871689 16:79112483-79112505 GCAGGGTGGGGGAAGGAGAAGGG - Intronic
1141031588 16:80593947-80593969 CTATCATGGTGGAAGGTGAAAGG + Intergenic
1141115213 16:81302762-81302784 CTAGGTTTTGGGAAGGAGAAAGG - Intergenic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1203085275 16_KI270728v1_random:1180939-1180961 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142698664 17:1646883-1646905 GTATGTTGGGGAAAGGGGAAAGG - Intronic
1143158860 17:4856092-4856114 CTATGGCGAGAGAAGGAGAAGGG - Intronic
1143591570 17:7888350-7888372 GGCTGTTGAGGGAAGGAGAAAGG + Intronic
1145734027 17:27213783-27213805 TCAGGCTGGGGGAAGGAGAAAGG + Intergenic
1146316726 17:31813169-31813191 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1146516481 17:33493718-33493740 CTATCTTGGGGGAAGGATGGCGG - Intronic
1146820524 17:35980781-35980803 ATAGGCTGGGGGATGGAGAAGGG + Intronic
1147142879 17:38469121-38469143 CTATGCATGTGGAAGGAGAAAGG - Intronic
1147169092 17:38607652-38607674 CTGAGTTGGGGGCAGGTGAAGGG - Intergenic
1147188625 17:38726156-38726178 AGATGTTGGGGGCTGGAGAAGGG + Exonic
1147497381 17:40929815-40929837 CTATTTAGGGTGAAGGACAAGGG + Intronic
1147624302 17:41889491-41889513 CTAGCTTGGGTGATGGAGAAAGG + Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148154575 17:45415556-45415578 CTAAGATCGGGGAAGGAGGAGGG - Intronic
1148387794 17:47247405-47247427 CTCTGGTGGGGGATGGATAATGG + Intergenic
1148525643 17:48330556-48330578 GAAGGCTGGGGGAAGGAGAAGGG + Intronic
1148758263 17:49985959-49985981 GAATGGAGGGGGAAGGAGAAGGG - Intergenic
1148871195 17:50659555-50659577 CTCTGGTGGGGGCAGGAGAATGG + Intronic
1149310263 17:55386371-55386393 CAATCATGGGGGAAGGTGAAGGG - Intergenic
1149369297 17:55977511-55977533 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1149390527 17:56185670-56185692 TTAAGTTGTGGGAAAGAGAATGG + Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150968435 17:69998664-69998686 CTATGATTGGTTAAGGAGAAAGG + Intergenic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152276481 17:79360858-79360880 TTATGTTGGGGGAAGGGGAGTGG + Intronic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1154100654 18:11470017-11470039 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1154217857 18:12428711-12428733 CCATGCTGGAGGAAGGAGACCGG + Intronic
1155634623 18:27938161-27938183 CAATCTTGGTGGAAGGCGAAGGG - Intergenic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156614878 18:38771880-38771902 CTGTGTTGTGGGACGGAGAGGGG - Intergenic
1157897987 18:51486636-51486658 CTATGAGGAGGGAGGGAGAAGGG + Intergenic
1158131039 18:54153037-54153059 CTATGTGGAGGGATGGAGAGAGG + Exonic
1158245739 18:55430304-55430326 GTAAGTGGGGGGAAGCAGAATGG + Intronic
1158641570 18:59208094-59208116 ATATGTTGGAGAAAGGAGGAAGG + Intergenic
1159695988 18:71556890-71556912 CTAACTTGGTGGAAGGAAAATGG - Intergenic
1160447870 18:78941341-78941363 CAATCATGGGGGAAGGCGAAGGG - Intergenic
1160599278 18:80000360-80000382 CTATGTTTTAGGAAAGAGAATGG + Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1164912028 19:32020677-32020699 CAATGATGGTGGAAGGCGAAAGG + Intergenic
1165030873 19:32997466-32997488 CTATGATGGGTGACAGAGAAAGG + Intronic
1165386578 19:35513683-35513705 CTAGGTTGGGAGAAGGTGACAGG + Intergenic
1166281848 19:41799366-41799388 CAATCATGGTGGAAGGAGAAGGG - Intronic
1166792603 19:45406749-45406771 GTGCGTTGGTGGAAGGAGAAAGG + Intronic
925455241 2:4010456-4010478 CAATCATGGCGGAAGGAGAAAGG - Intergenic
925899156 2:8496103-8496125 CTATGTTGGGGGGGAAAGAATGG - Intergenic
926626534 2:15095332-15095354 CAATCATGGTGGAAGGAGAAAGG + Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
926753651 2:16219309-16219331 CAATGAGGGGGGAGGGAGAAGGG - Intergenic
927462508 2:23311233-23311255 CGAGGTTGGGAGGAGGAGAAGGG - Intergenic
928735144 2:34279868-34279890 CTATCATGGTGGAAGGTGAAAGG + Intergenic
928883132 2:36119875-36119897 TTATAGTGGGGGGAGGAGAATGG - Intergenic
928983468 2:37158242-37158264 GGTTGTTGGGGGATGGAGAAGGG - Intergenic
929400398 2:41573834-41573856 CTCAGTTGGAGGAAGGAAAATGG - Intergenic
930227956 2:48813327-48813349 CAATGATGGTGGAAGGTGAAAGG + Intergenic
930317963 2:49820531-49820553 CAATCATGGTGGAAGGAGAAAGG + Intergenic
930485251 2:52003565-52003587 CTATGTCGTGGGAACTAGAATGG + Intergenic
930508773 2:52318104-52318126 CTAGGCTGTGGCAAGGAGAAAGG - Intergenic
930806021 2:55491620-55491642 CCAAGTTGTGGGAAGGAGAAAGG + Intergenic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
931534516 2:63258301-63258323 TCAGGATGGGGGAAGGAGAATGG + Intronic
932092047 2:68814887-68814909 TTTTATTGGGGGAGGGAGAAAGG + Intronic
932314974 2:70774016-70774038 TTAAGGTGGGGGAAGGAAAAAGG + Intergenic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
933402598 2:81818359-81818381 CAATTTTGGTGGAAGGTGAAGGG + Intergenic
933592159 2:84245097-84245119 CTTTTTTGGGGGGAGGATAAGGG - Intergenic
933877139 2:86630795-86630817 TTCTGTTGGGGCAAGGAGAGTGG + Intronic
934491672 2:94765433-94765455 CGGTGTTGGTGGTAGGAGAATGG - Intergenic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935805077 2:106737602-106737624 CTATCATGGTGGAAGGTGAAGGG - Intergenic
935948872 2:108311275-108311297 CTATGTTTTAGGAAAGAGAATGG + Intergenic
936578661 2:113676399-113676421 CAATCATGGGGGAAGGTGAAAGG - Intergenic
937082410 2:119149868-119149890 TGATGGTGGGGGAAGGAGACAGG - Intergenic
938608821 2:132925126-132925148 CTTTGTTGGGGGGTGGGGAATGG + Intronic
940136064 2:150436845-150436867 CAATCTTGGTGGAAGGTGAAAGG - Intergenic
940219163 2:151333764-151333786 CTATGGTGAGGGAATGAGATTGG + Intergenic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
940619385 2:156092110-156092132 ATAGTGTGGGGGAAGGAGAAAGG - Intergenic
941224320 2:162827251-162827273 CTTTCTTGTGGGAAGGAGAGGGG + Intronic
941452968 2:165681555-165681577 CAATGTAGGGGGGAAGAGAAGGG - Exonic
942972393 2:181971930-181971952 CACTGCTGGGGGATGGAGAAGGG + Intronic
943610311 2:190025348-190025370 TGATGTGGGGGGATGGAGAATGG - Intronic
944272930 2:197804279-197804301 CCAGGTTGGGTGAAGGAGAGGGG - Intergenic
944315939 2:198285882-198285904 CTAGGTAGGGGGAGGGTGAAGGG + Intronic
944952751 2:204770959-204770981 TTCTCTTGGGAGAAGGAGAAAGG + Intronic
945042710 2:205755511-205755533 CTCTGTAGGGAGAAGGAAAATGG - Intronic
945049617 2:205810747-205810769 CAATCATGGGGGAAGGCGAAGGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945119447 2:206443329-206443351 CTTTGTTGGGGGGCGGGGAAGGG - Intergenic
945792221 2:214319087-214319109 ATAAGTGGGGAGAAGGAGAAGGG - Intronic
946473497 2:219985090-219985112 AGATGTGGGGGCAAGGAGAATGG + Intergenic
946788287 2:223272200-223272222 CAATCATGGTGGAAGGAGAAGGG + Intergenic
947014802 2:225607370-225607392 CTATGATGGGGGCAGTGGAAAGG + Intronic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
947950759 2:234145203-234145225 CTAGGTTGGGAGAATGAGAGGGG + Intergenic
948027564 2:234790207-234790229 CTATGCTGGGGGAAGATGAGAGG - Intergenic
948158295 2:235802173-235802195 CGATTTAGGGTGAAGGAGAAGGG + Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948810974 2:240478147-240478169 CAATCATGGCGGAAGGAGAAGGG - Intergenic
949058906 2:241945266-241945288 CTCTGGTGGTGGAAGGTGAAGGG - Intergenic
1169253143 20:4075513-4075535 GTATGTGGGGAGAAGGGGAAAGG - Intergenic
1169388435 20:5170292-5170314 CTTTCTTGTGGGAAGGAGCATGG + Intronic
1169636856 20:7702044-7702066 CTCTGTTGGGGGGAGAAGAGAGG - Intergenic
1169807006 20:9569762-9569784 CAGTGTTGGGGGACTGAGAATGG - Intronic
1170509914 20:17065842-17065864 TGATGTTCAGGGAAGGAGAAGGG + Intergenic
1171795487 20:29562653-29562675 GTATCTTGGAGGAAGGAAAATGG - Intergenic
1171852962 20:30321610-30321632 GTATCTTGGAGGAAGGAAAATGG + Intergenic
1172635693 20:36408221-36408243 CTATGGTAGGGGAGTGAGAAAGG + Intronic
1173216871 20:41093482-41093504 GAATGCTGGGGAAAGGAGAAGGG - Intronic
1174121795 20:48271340-48271362 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1174706228 20:52658999-52659021 CTAAGTTGAAGGAAGGAGAAAGG + Intergenic
1174953469 20:55068180-55068202 GTATATTTGGGGAAGGAAAATGG + Intergenic
1175048742 20:56132895-56132917 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1175295652 20:57907188-57907210 CTATGATTGGGGAAGGAGTGGGG - Intergenic
1175578980 20:60084483-60084505 GTATGTGGGGCAAAGGAGAATGG - Intergenic
1175752834 20:61510884-61510906 CAATGGTGGGGGAAGGTGAGGGG + Intronic
1175865093 20:62171319-62171341 CTTTCATGGGGGCAGGAGAAAGG + Intronic
1177010179 21:15722541-15722563 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1177208782 21:18043825-18043847 CAATCTTGGCGGAAGGCGAAAGG + Intronic
1177418704 21:20827430-20827452 CAATCATGGTGGAAGGAGAAAGG + Intergenic
1178611404 21:34084989-34085011 CTATGTTGTGGTTAGGAGGAAGG - Intronic
1179285646 21:39975420-39975442 TTATCTTGGGGGAAAGAAAATGG - Intergenic
1179889621 21:44328900-44328922 CCATGTCGGGGGAAGTGGAAGGG + Intergenic
1182973264 22:34597731-34597753 CTATGTTTGAAGAAGGTGAAAGG + Intergenic
1184868898 22:47220447-47220469 AGATGTGGGGGGCAGGAGAAGGG - Intergenic
1185214288 22:49589718-49589740 CTGTGCTGGGGGCAGGAGATGGG + Intronic
1185351527 22:50342185-50342207 CCATGGTGAGGGCAGGAGAAGGG + Intergenic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
950127212 3:10517299-10517321 CCAGGCTGGGGGAAGGGGAAGGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
951191114 3:19772678-19772700 CCATGATGGTGGAAGGGGAAAGG - Intergenic
951580367 3:24156894-24156916 GTATGTTGGGGAAAGGCTAAAGG - Intronic
951978573 3:28541549-28541571 CTATGATGAGGGAATTAGAAAGG + Intergenic
952284434 3:31954578-31954600 CTATATTGGGGGCAGGGGGAAGG + Intronic
952387971 3:32856544-32856566 CTCTGTTGGTGGAAGGTGAAAGG + Intronic
952589921 3:34939534-34939556 CTACTTTGGGGAAAAGAGAAGGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952792331 3:37209896-37209918 CTCTGTTGGAGGAGGCAGAAAGG - Intergenic
952890555 3:38037447-38037469 CTATGGTGGGGGGAGGAGGAGGG - Intergenic
953286200 3:41612275-41612297 GTATTTTGAGGGAAGGAGGAGGG - Intronic
953363982 3:42326028-42326050 ATAGGGTGGGGGTAGGAGAAGGG - Intergenic
953606911 3:44418342-44418364 CAATCATGGGGGAAGGGGAAAGG - Intergenic
953677875 3:45017386-45017408 CAAGGTTGTGGGAAGGAGGAGGG - Intronic
955404849 3:58619623-58619645 CTATGATGAGGGAAGCAGATAGG - Intronic
956714016 3:72062474-72062496 CTATCCTGGGGGAAAGAGAGTGG + Intergenic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
958433664 3:94071950-94071972 GTGTGTTGTGGGGAGGAGAATGG + Intronic
959071017 3:101702049-101702071 CCAGCTTGGGGGAAGGAGGAGGG + Intergenic
959330603 3:104999740-104999762 CAATCATGGTGGAAGGAGAAGGG - Intergenic
959337184 3:105080733-105080755 CAATGATGGTGGAAGGTGAAGGG + Intergenic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
962139318 3:132771986-132772008 CAAGGCTGGTGGAAGGAGAAAGG - Intergenic
963285492 3:143430899-143430921 CCATGTTGTGGGAAGGAAAAAGG - Intronic
963603292 3:147394969-147394991 CCATTTTGGGGGCGGGAGAAGGG - Intronic
963835804 3:150056743-150056765 CTTTGTTGTGGCAAGGAGGAGGG + Intergenic
963850442 3:150205650-150205672 ATATATAGGGGGAAGGAGAGAGG + Intergenic
964012229 3:151904705-151904727 CAATGATGGTGGAAGGTGAAGGG - Intergenic
964090822 3:152873909-152873931 CTATTTTGGGGTCTGGAGAACGG + Intergenic
964133404 3:153316512-153316534 CTATGGTGGGGGTGGGGGAAAGG - Intergenic
964264996 3:154885807-154885829 ATATGTAGGGGCATGGAGAATGG + Intergenic
964284139 3:155099084-155099106 CCATGTTGGGGCAAGGTGGAGGG + Intronic
965046608 3:163585909-163585931 CAATCATGGTGGAAGGAGAAGGG + Intergenic
967155196 3:186685467-186685489 CAATGATGGTGGAAGGTGAAGGG + Intergenic
967482050 3:189983925-189983947 CTTTCTTGGGGGAAGGGGAGAGG + Intronic
969140587 4:5067811-5067833 CTATCATGGCGGAAGGCGAAGGG + Intronic
970068452 4:12126671-12126693 CAATCTTGGTGAAAGGAGAAGGG - Intergenic
971144238 4:23959682-23959704 CTATGAAGATGGAAGGAGAAAGG + Intergenic
971341590 4:25774397-25774419 GTTGGTTGGGGGAAGGAGAAAGG - Intronic
971533159 4:27714732-27714754 CAATCATGGTGGAAGGAGAAAGG - Intergenic
971977426 4:33709360-33709382 CAATCATGGTGGAAGGAGAAAGG + Intergenic
972179410 4:36444923-36444945 TTATGTTCAGGGCAGGAGAAGGG + Intergenic
972181019 4:36465942-36465964 CTATGTTGGAGGGTGGAGGAAGG - Intergenic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972829749 4:42801769-42801791 CAATATTGGCGGAAGAAGAAGGG + Intergenic
973345167 4:49047356-49047378 CTATGCTGGTGGAGGGAGGATGG + Intronic
973720094 4:53714715-53714737 ATGTGTTGGGGGAATGAGTAGGG + Intronic
974558974 4:63492721-63492743 CCCTGCTGGGGGAAGGAGAGAGG - Intergenic
974606638 4:64160251-64160273 CAATCATGGGGGAAGGCGAAGGG - Intergenic
974923319 4:68269306-68269328 CAATCTTGGTGGAAGGAGAAGGG + Intergenic
975599433 4:76083946-76083968 CTATGCTGGGAGAATGGGAAGGG - Intronic
976444683 4:85117072-85117094 CAATGCTGGTGGAAGGCGAAAGG - Intergenic
976703668 4:87999365-87999387 CAATCATGGCGGAAGGAGAAGGG + Intergenic
976709052 4:88049799-88049821 ATATGTTGGGGAAAGAAAAAAGG - Intronic
977039288 4:91994875-91994897 CAATCATGGGGGAAGGTGAAAGG + Intergenic
977720530 4:100235545-100235567 GTATGGTGGGGGGAGGAAAATGG - Intergenic
977775163 4:100909533-100909555 TTTTGTTGGGGGAAGGAGTATGG + Intergenic
978413069 4:108446358-108446380 TTATGTTGGGGAAATGAGGAAGG + Intergenic
979050754 4:115928657-115928679 CTACGTGGGGGTAAGAAGAATGG + Intergenic
979070422 4:116197089-116197111 TTATGTTGGGTAAAGAAGAAAGG + Intergenic
979244591 4:118486264-118486286 CTATATGGGGGGAGGGAGAGAGG + Intergenic
979682690 4:123478989-123479011 ATATGTTGGGGGCAGGGCAAGGG + Intergenic
980430031 4:132682984-132683006 CAATCATGGTGGAAGGAGAAGGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
980635949 4:135503218-135503240 CAATCATGGTGGAAGGAGAAGGG + Intergenic
980726485 4:136768153-136768175 TTATGTTAGTAGAAGGAGAAAGG + Intergenic
981915595 4:150029684-150029706 CAATCTTGGCGGAAGGTGAAAGG - Intergenic
981941012 4:150281623-150281645 ACATGTTGGGGGCAGGAGTAGGG - Intronic
982233160 4:153227755-153227777 TCATGGTGGGGGAAGGGGAAGGG + Intronic
982341470 4:154303544-154303566 CCATGATGGGGGAGGTAGAAAGG + Intronic
982536661 4:156615455-156615477 GAAAGTTGGGGGAAGGGGAAAGG + Intergenic
982754843 4:159205725-159205747 CAATCATGGGGGAAGGCGAAGGG - Intronic
983906436 4:173187631-173187653 CTATGTTGGGGTAAAGAACAGGG - Intronic
984087630 4:175332052-175332074 CTATGTCCAGGGCAGGAGAAGGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984761887 4:183369535-183369557 CTATTTTGGGGGATTTAGAAAGG + Intergenic
986118192 5:4801506-4801528 CAATCATGGCGGAAGGAGAAAGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986548189 5:8922953-8922975 CAATGATGGTGGAAGGAAAAGGG - Intergenic
987097009 5:14559100-14559122 CTGGCTTGGGGGAAGGAGAGGGG + Intergenic
987269702 5:16294024-16294046 CTATGTTGGAGGAACGTGATTGG - Intergenic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
987378360 5:17259133-17259155 CAATCATGGGGGAAGGTGAAAGG + Intronic
987416349 5:17665848-17665870 CTATGTGGGGGAAAGGATATAGG - Intergenic
987651083 5:20740740-20740762 CAATGATGGTGGAAGGTGAAAGG + Intergenic
987927328 5:24359650-24359672 CTATGTTAGGACAAAGAGAAAGG - Intergenic
988491350 5:31708073-31708095 CTAGGTTGGGGGAGGCAGGAAGG + Intronic
988665290 5:33320529-33320551 AGAGTTTGGGGGAAGGAGAAGGG - Intergenic
988744478 5:34120726-34120748 CAATGATGGTGGAAGGTGAAAGG - Intronic
988995972 5:36715267-36715289 GCATGTTGGGGGAAGGAGTTGGG - Intergenic
989113947 5:37933565-37933587 AAATGCTGGGTGAAGGAGAACGG + Intergenic
989147264 5:38261225-38261247 CTATCTTGGGGTGAAGAGAAAGG - Intronic
989638886 5:43564344-43564366 CAATCATGGAGGAAGGAGAAAGG + Intergenic
990181931 5:53170789-53170811 CTAGGTGAGGGGGAGGAGAAGGG - Intergenic
990527266 5:56640289-56640311 CAATCATGGTGGAAGGAGAAGGG - Intergenic
991340891 5:65607516-65607538 CAATCATGGGGGAAGGCGAAGGG - Intronic
991425731 5:66489796-66489818 CTATGATTGGGGAAGTAGTATGG - Intergenic
991514722 5:67422355-67422377 CAATTGTGGGGGAAGGTGAAGGG + Intergenic
992023079 5:72644086-72644108 ATTGGTTGGGGGAAGGACAAGGG + Intergenic
992778378 5:80107259-80107281 CAATCTTGGTGGAAGGTGAAAGG - Intergenic
993096125 5:83480266-83480288 TTTTGTTGGGGAGAGGAGAATGG - Intronic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
993707770 5:91190705-91190727 CTTTGTGGGGGAAAGGAAAATGG - Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994772743 5:104003769-104003791 CTATCTAGGGGGAATGTGAAAGG + Intergenic
995144899 5:108776194-108776216 ATATGTTGGGGGAAGAATGAAGG + Intronic
995655815 5:114424974-114424996 ATATAATGGGGGAAGAAGAAAGG + Intronic
996184648 5:120461087-120461109 CAATCATGGGGGAAGGTGAAGGG - Intergenic
996189498 5:120521818-120521840 CTATGGTGGGGTAAGGGAAAGGG - Intronic
996201455 5:120679837-120679859 CTGAGTTGGGGGACAGAGAATGG + Intronic
996309535 5:122088901-122088923 CTATGTAAGGGCAAAGAGAAGGG - Intergenic
996313454 5:122134192-122134214 CTATGTTGGGAGCAGCAGAGAGG + Intronic
996653046 5:125904713-125904735 CTATGAAGGAGAAAGGAGAATGG + Intergenic
996764191 5:127019327-127019349 GTATGTTGGGGGATGGGGTAGGG - Intronic
997039754 5:130238048-130238070 TTATCTTGGGTGAAGGGGAAGGG - Intergenic
997119235 5:131157235-131157257 TTATGTTGAGGGAAGGTGTAGGG - Intergenic
997658491 5:135572792-135572814 CTAGGTTGGAGGAAGTAGAAGGG - Intronic
998800557 5:145864672-145864694 CAATCTTGGTGGAAGGTGAAGGG - Intronic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000400842 5:160825459-160825481 CAATGTTGGTGGAAGGTGAAAGG - Intronic
1000999713 5:167994327-167994349 TTATGTTGAGGGAAGGGGCAAGG - Intronic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001148583 5:169206128-169206150 CTATGTTGGGGGCAGGGAAGAGG + Intronic
1001461636 5:171920364-171920386 ATATGTTCGGTGAAGGAGGATGG + Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1004712695 6:18187525-18187547 TTATTTTGGGGGAGGGATAAGGG + Intronic
1005965171 6:30721678-30721700 CCAGCTTGGGGGAAGGAGAGCGG + Intronic
1006185480 6:32179293-32179315 GTTTGTTGGGGAGAGGAGAAAGG + Intronic
1006305472 6:33215770-33215792 CTATATTAGGGGGAGGAGAAGGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006461556 6:34162117-34162139 CTCTGATGGGGGAAGGAGTTGGG + Intergenic
1007400575 6:41600191-41600213 CCAGCCTGGGGGAAGGAGAAAGG + Exonic
1007407836 6:41645055-41645077 TCATGTTGGGAGAAGGAGCAAGG - Intronic
1007761313 6:44135190-44135212 CTTTGCTGGGGGGATGAGAAGGG + Intronic
1007811917 6:44492266-44492288 CAATCTTGGCAGAAGGAGAAAGG - Intergenic
1008395524 6:51002446-51002468 CTATATTGGGGAAAAGAGAGGGG - Intergenic
1008505243 6:52223893-52223915 TTTTCTTGGGGGAAGGAAAAAGG - Intergenic
1009377793 6:62993533-62993555 CAATCTTGGTGGAAGGTGAAAGG + Intergenic
1009500005 6:64400408-64400430 CTATGTTGCAGGAAGATGAAAGG + Intronic
1010949962 6:82023892-82023914 CTATGATGGGGGAAATGGAAAGG - Intergenic
1011096778 6:83674737-83674759 TTATATTTCGGGAAGGAGAAAGG + Intronic
1011509325 6:88082589-88082611 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1011748211 6:90428484-90428506 ATATGTTGGGGGAGAGAGAAGGG - Intergenic
1012125660 6:95425210-95425232 TTTTGTTGGGGAAAGGAGAATGG - Intergenic
1012479654 6:99652288-99652310 CAATGATGGTGGAAGGTGAAGGG - Intergenic
1012997577 6:105988994-105989016 CTCTGATGGGGGAAGTACAAAGG - Intergenic
1014231568 6:118908881-118908903 TTATGTTGAGGAAAGGAAAAGGG + Exonic
1014444865 6:121515249-121515271 CTGTGTTGGGGTAAAGAGAAAGG + Intergenic
1014489838 6:122048666-122048688 GCATTATGGGGGAAGGAGAATGG - Intergenic
1014698859 6:124658225-124658247 CGATCTTGGTGGATGGAGAATGG + Exonic
1014715849 6:124863430-124863452 CAATCTTGGTGGAAGGTGAAAGG + Intergenic
1015518514 6:134108586-134108608 CAATCCTGGGGGAAGGTGAAAGG + Intergenic
1015831639 6:137376445-137376467 CAATGATGGCGGAAGGCGAAAGG - Intergenic
1015858369 6:137649716-137649738 CTATCTTGGGGAAATGAAAAGGG - Intergenic
1016999099 6:149983304-149983326 CAAGGTTGTGGGAAGGAGACTGG + Intergenic
1017272046 6:152518484-152518506 CAATCATGGCGGAAGGAGAAGGG - Intronic
1017419096 6:154254347-154254369 CGATCATGGTGGAAGGAGAAGGG + Intronic
1017953494 6:159158738-159158760 CTATCATGGCGGAAGGCGAAGGG + Intergenic
1021761091 7:23903791-23903813 CAATCTTGGTGGAAGGTGAAGGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022477866 7:30723537-30723559 TTATGGTGGGGGGAGGAGATGGG + Intronic
1022980353 7:35599808-35599830 CTATATTGGGAGATGGATAAAGG + Intergenic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1024389076 7:48786578-48786600 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1026650308 7:72210548-72210570 CAATCATGGGGGAAGGCGAAGGG + Intronic
1026772389 7:73210833-73210855 CTATGATGGGGAAAGAGGAAGGG + Intergenic
1027013257 7:74764232-74764254 CTATGATGGGGAAAGAGGAAGGG + Intergenic
1027074783 7:75181802-75181824 CTATGATGGGGAAAGAGGAAGGG - Intergenic
1027442671 7:78236869-78236891 CAATCATGGTGGAAGGAGAAAGG + Intronic
1027714007 7:81646122-81646144 ATATATTGTGGGAAGGAGAGTGG + Intergenic
1029773380 7:102669737-102669759 TTATGTTGGCGTAAGAAGAAAGG - Intronic
1031001062 7:116415237-116415259 CTTTGGTGGGCTAAGGAGAAGGG + Intronic
1031204584 7:118740381-118740403 CAATTATGGCGGAAGGAGAAAGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032103668 7:129005645-129005667 CAATCATGGGGGAAGGTGAAGGG - Intronic
1032544305 7:132728880-132728902 GTAGGTTGAGGGGAGGAGAATGG - Intergenic
1032867019 7:135936107-135936129 CTATGTTGAGGGCAGGAACAAGG + Intronic
1032900563 7:136302455-136302477 TGATTTTGGGGGAAGGTGAATGG - Intergenic
1033048389 7:137982627-137982649 CAATCTTGGTGGAAGGTGAAAGG - Intronic
1033503316 7:141975950-141975972 CAATGTTGGGGGAGAGACAACGG + Intronic
1034033792 7:147798802-147798824 CGATTTTGGGGGAAGGAAAAAGG + Intronic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1035578301 8:723139-723161 CTATGGTGAGGGAGGGAGAGCGG - Intronic
1035644754 8:1210456-1210478 GTGTGTGGGGGGAAGGAGAGGGG + Intergenic
1036023274 8:4872509-4872531 CAATGATGGTGGAAGGTGAAAGG - Intronic
1036099017 8:5756973-5756995 CGATTTTGGGTGAAAGAGAATGG + Intergenic
1036673515 8:10809981-10810003 CAATCATGGTGGAAGGAGAAGGG + Intronic
1037134119 8:15441950-15441972 CTATTTTGGGGGAATGAGACCGG - Intronic
1037800815 8:22034271-22034293 CTAAGGTGGGGGAAGGAGCGTGG + Exonic
1038067914 8:23982906-23982928 CAATCGTGGCGGAAGGAGAAAGG + Intergenic
1039175318 8:34797815-34797837 CTATAATGGGGGCAGGAAAATGG + Intergenic
1039808523 8:41024132-41024154 CAATCTTGTTGGAAGGAGAAGGG - Intergenic
1040288129 8:46110780-46110802 TTATGTTGAGGGAAGCAGAGGGG - Intergenic
1040482898 8:47842259-47842281 CTGTGCTGGGGGTAGGGGAAGGG - Intronic
1040704235 8:50106194-50106216 CAATCATGGTGGAAGGAGAAGGG + Intronic
1041250781 8:55932959-55932981 CTAAAGTGGGGGAGGGAGAAGGG + Intronic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041772934 8:61491946-61491968 CTATCATGGGGGCAGGAGGAGGG + Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042316975 8:67435415-67435437 AGATGTTGGGGGCTGGAGAAGGG + Intronic
1042711470 8:71722204-71722226 TTATGTTGGAGGAAAGTGAAAGG + Intergenic
1045109059 8:98922015-98922037 CTCTGTAGTGAGAAGGAGAAAGG - Intronic
1045447827 8:102285913-102285935 CTATTTTGGGGAGAGGAGTATGG + Intronic
1045761581 8:105614734-105614756 AGATTTGGGGGGAAGGAGAAAGG - Intronic
1045970206 8:108071510-108071532 CTATGCTGGGTGAAGGAGGGCGG + Intronic
1046010597 8:108542229-108542251 CTATGTGGGAGGGAGGACAAAGG - Intergenic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1046760518 8:118015605-118015627 AGATGTTGGGGGAAGGAACACGG + Intronic
1047177947 8:122559133-122559155 CTACTTGGGGGGAAGGAGACAGG + Intergenic
1047248203 8:123162162-123162184 TTCTGTGGGGGGAAGTAGAATGG - Intergenic
1047787629 8:128169112-128169134 CTATTTTGGTGGAGGGAGAGTGG - Intergenic
1048069718 8:131008886-131008908 CTATGTTTTGGCAAGGAGATTGG + Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049457613 8:142701376-142701398 CAATCATGGGGGAAGGCGAAGGG + Intronic
1050264646 9:3877543-3877565 CAATGTTGAGTGGAGGAGAAGGG - Intronic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1051554216 9:18364774-18364796 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1052358039 9:27526560-27526582 CTATCCTGGAGGAAAGAGAATGG + Intronic
1052446319 9:28565873-28565895 CTAACTTGGGGAAAGGTGAAAGG + Intronic
1053073186 9:35112953-35112975 CTAGGGTGAGGTAAGGAGAAGGG - Intronic
1053790762 9:41684909-41684931 GTATCTTGGAGGAAGGAAAATGG + Intergenic
1054154396 9:61629863-61629885 GTATCTTGGAGGAAGGAAAATGG - Intergenic
1054474175 9:65560983-65561005 GTATCTTGGAGGAAGGAAAATGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054894099 9:70287729-70287751 GTATGTTGGGAGAAGGGGATTGG + Intronic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055516466 9:77038593-77038615 TTTTGTTGTGGAAAGGAGAAAGG - Intergenic
1055726356 9:79233770-79233792 ATGTGGTGGGGGCAGGAGAAGGG + Intergenic
1056444630 9:86653873-86653895 CAATCATGGTGGAAGGAGAAGGG + Intergenic
1056932195 9:90888540-90888562 CTATGTTAGAGAAAGGAGAGCGG + Exonic
1057109101 9:92449785-92449807 CAATGATGGCGGAAGGAGAAGGG - Intronic
1058424704 9:104866305-104866327 CTATGTTGCTGGCAGGAAAATGG + Intronic
1058649189 9:107159230-107159252 CTGTGTTGTGGGAAGGACAGGGG + Intergenic
1059104052 9:111496335-111496357 CAATCTTGGTGGAAGGTGAAGGG - Intergenic
1059811781 9:117863033-117863055 CAATCTTGGTGGAAGGAGAAGGG - Intergenic
1060514926 9:124259585-124259607 CCTTGATGGGGGAAGGAGAGGGG - Intronic
1060960147 9:127675043-127675065 CAATGTGAGGGGAAGCAGAATGG + Intronic
1062483945 9:136764961-136764983 CCATGTTGGGGGTGAGAGAAGGG - Intronic
1186145015 X:6616001-6616023 CTATGATGGCAGAAGGTGAAGGG - Intergenic
1186336586 X:8596206-8596228 CCATGTTGGGGGAGGGGGCAGGG - Intronic
1186347892 X:8713261-8713283 CCAAGCTGGGGGATGGAGAATGG + Intronic
1187541056 X:20195618-20195640 CTATTTTGAGGGAAGAAGAAAGG + Intronic
1187857791 X:23654045-23654067 CCATGTTGGGGGCTGGTGAAAGG - Intergenic
1188485599 X:30678460-30678482 CTAAGTTGTGGGATGGGGAATGG + Intronic
1188531210 X:31143379-31143401 CAATCATGGGGGAAGGTGAAGGG - Intronic
1189143025 X:38626550-38626572 GTGTGTTGGGTGTAGGAGAAAGG + Intronic
1189231289 X:39454308-39454330 CTTTGTTGGGGTAAGGAGGGAGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1189863426 X:45297350-45297372 CTATGTTTTGGGAAAGACAAAGG + Intergenic
1190382155 X:49849667-49849689 CTGTGTTGGAGAGAGGAGAATGG + Intergenic
1192256880 X:69468853-69468875 CAATCTTGGGAGAAGGGGAAGGG - Intergenic
1192839141 X:74836069-74836091 CCATGGTGGGGGAAGGAGGAGGG + Intronic
1193216482 X:78870386-78870408 CTATTTTTGGGGGAGGAAAATGG + Intergenic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1193463138 X:81813667-81813689 CAATGATGGTGGAAGGTGAAGGG - Intergenic
1193634368 X:83930193-83930215 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1194143225 X:90231162-90231184 CTCTGTTATGGGAATGAGAAAGG + Intergenic
1194178735 X:90687561-90687583 CAATTATGGGGGAAGGTGAAAGG + Intergenic
1194220598 X:91184290-91184312 CAATGATGGTGGAAGGTGAAAGG - Intergenic
1194288109 X:92036530-92036552 CAATCTTGGTGGAAGGTGAAGGG - Intronic
1194809633 X:98374879-98374901 CTTTGAAGGGTGAAGGAGAATGG + Intergenic
1194868894 X:99102479-99102501 CTCTGCTGGAGGAGGGAGAAAGG - Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195627312 X:107017650-107017672 CTGTGTTGTGTTAAGGAGAAAGG + Intergenic
1195667690 X:107445556-107445578 ATATGGTGGGTGAAGGAAAAGGG - Intergenic
1195946177 X:110214644-110214666 GTGTTTTGGGGGAAGGAAAAAGG - Intronic
1195962599 X:110401572-110401594 CTGTGTTGTGGTAAGGGGAAGGG + Intronic
1196053092 X:111326151-111326173 ATGAGTTGGGGGAAGGGGAATGG + Intronic
1196433282 X:115651033-115651055 CTCTGTTGGGGTGGGGAGAAGGG + Intergenic
1196982837 X:121233974-121233996 CTATTATGGTGGAAGGTGAAGGG + Intergenic
1197061214 X:122184068-122184090 CAATCATGGTGGAAGGAGAAAGG + Intergenic
1197813801 X:130476155-130476177 CTATCATGGTGGAAGGTGAAGGG + Intergenic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1197959552 X:131989301-131989323 GTAGGCTGGGGGAAAGAGAATGG - Intergenic
1199512502 X:148638306-148638328 CAATCATGGTGGAAGGAGAAGGG + Intronic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1200488977 Y:3800484-3800506 CTCTGTTACGGGAATGAGAAAGG + Intergenic
1201417911 Y:13766364-13766386 CCAAGCTGGGGGATGGAGAATGG - Intergenic