ID: 1001027862

View in Genome Browser
Species Human (GRCh38)
Location 5:168239208-168239230
Sequence ATCAAATTTCTTTAATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001027862_1001027863 -7 Left 1001027862 5:168239208-168239230 CCTCATAATTAAAGAAATTTGAT 0: 1
1: 0
2: 2
3: 38
4: 479
Right 1001027863 5:168239224-168239246 ATTTGATTAGATTACACAACTGG 0: 1
1: 0
2: 0
3: 13
4: 168
1001027862_1001027864 7 Left 1001027862 5:168239208-168239230 CCTCATAATTAAAGAAATTTGAT 0: 1
1: 0
2: 2
3: 38
4: 479
Right 1001027864 5:168239238-168239260 CACAACTGGCCTGAACTCCTTGG 0: 1
1: 0
2: 3
3: 68
4: 981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001027862 Original CRISPR ATCAAATTTCTTTAATTATG AGG (reversed) Intronic
902351359 1:15857820-15857842 AACAAATTTTTTTAATTAGCTGG - Intronic
903900262 1:26639259-26639281 AATAAGTTTCTTTAATAATGTGG + Intergenic
904639436 1:31912907-31912929 AACACAGTCCTTTAATTATGGGG - Intronic
907207831 1:52790209-52790231 ATCTACTTTCTTTAATTTAGTGG + Intronic
907597944 1:55737094-55737116 ATCAAAATTATTTAATAGTGGGG - Intergenic
908084966 1:60622165-60622187 ATCACATTTCTTTCATTCTGAGG - Intergenic
908130233 1:61068046-61068068 ATAAACTTTCTTGAATTTTGTGG + Intronic
908411024 1:63865524-63865546 AGCAAGTTTATTTAATTTTGTGG + Intronic
908460189 1:64341629-64341651 ATCCATCTTCTTGAATTATGTGG - Intergenic
909036857 1:70603245-70603267 ATCAAATTTATTAACTTAAGTGG + Intergenic
909212287 1:72839521-72839543 AGAAAGTTTCTTAAATTATGTGG + Intergenic
909232671 1:73111060-73111082 GTCAAATTACTTTAATTATGTGG - Intergenic
910649057 1:89545037-89545059 TTCTAATTTGTTTAATTATAAGG + Intronic
910894729 1:92056931-92056953 GTCAAATTTCTGTATATATGAGG - Intronic
912848328 1:113098037-113098059 ATTAAATATTTTTAATTATATGG + Intronic
913484663 1:119322932-119322954 ATTAAATTACTTAAATAATGGGG - Intergenic
913711817 1:121491955-121491977 ATCTAAGGTCTTTCATTATGTGG - Intergenic
915683652 1:157607815-157607837 GATAAATTTCTTTACTTATGGGG - Intergenic
916288520 1:163137636-163137658 ATCAAATTTCCTTGACTCTGTGG - Intronic
917757328 1:178115377-178115399 ATCAATTTTATTTATTTGTGTGG + Intronic
917888111 1:179407875-179407897 ACCAAATTTTTTTTATTCTGGGG - Intronic
918037698 1:180891833-180891855 ATAAAATTTATTTAAATAAGGGG - Intergenic
918352493 1:183671647-183671669 ATCAAATTTCTTGATAAATGTGG - Intronic
918543792 1:185659769-185659791 TTCAAATTTCTTTTAATTTGAGG + Intergenic
918684974 1:187403229-187403251 GTCAAATTTCTTCAAGTATTGGG - Intergenic
919404969 1:197167640-197167662 ATCATATTTTTTTATTTATGTGG - Intronic
919412690 1:197265980-197266002 ATCAAACTTCCTTGATTTTGTGG + Intergenic
920053668 1:203178082-203178104 ATCAATTCTCTTTAGTTCTGGGG + Intergenic
922942318 1:229478229-229478251 ATAAAATTTATTTAATTAAAAGG + Intronic
922990475 1:229905721-229905743 ATTATTTTTCTTTAAATATGTGG - Intergenic
923886954 1:238168238-238168260 ACCTAATTTCTTTCTTTATGAGG + Intergenic
924592527 1:245417272-245417294 ATCACATTTTTTTAATTAGAAGG + Intronic
1063015085 10:2068586-2068608 ATCAAATCTCTAAAATTGTGTGG - Intergenic
1063067526 10:2624209-2624231 TTCTATTTTCTTTAATTTTGGGG + Intergenic
1063148310 10:3315945-3315967 ATAAAATTACTTTACATATGAGG - Intergenic
1063741469 10:8826188-8826210 ATCAATATTCTTTAATTTAGTGG - Intergenic
1064786129 10:18897561-18897583 ATCAAATTTTGTTGATTAGGTGG - Intergenic
1065671416 10:28122920-28122942 ATACAATTTCTATAATTATAAGG - Intronic
1065999613 10:31092080-31092102 ATAAAATTTTTTTAATTAACTGG - Intergenic
1066116735 10:32247229-32247251 ACTAAATTTCTTTATGTATGTGG - Intergenic
1066269099 10:33804607-33804629 ATCACATTTCTTTCTTTCTGGGG - Intergenic
1066998149 10:42582377-42582399 ATGAAATGCCTTTGATTATGGGG + Intronic
1067096745 10:43306418-43306440 AACAAACTTGTTTAATCATGTGG - Intergenic
1068340695 10:55698663-55698685 AGCAAAATTGTTTAATTTTGAGG + Intergenic
1069223907 10:65917416-65917438 TTCAAATTTCTCTAATTAGAAGG + Exonic
1070230992 10:74567414-74567436 ATTTAATTTATTTAACTATGTGG - Intronic
1071557953 10:86620567-86620589 ATCCAGGTTCTTTATTTATGTGG - Intergenic
1071747212 10:88435812-88435834 ATAAAATTGCTTTTATTATAAGG - Intronic
1072177900 10:92947081-92947103 ATCAAAATTATTTAATTAAAAGG + Intronic
1072299443 10:94045160-94045182 AAAAAATTTTTTTAATTATCCGG - Intronic
1074677253 10:115865464-115865486 ATCATATTTATTTCATTATATGG + Intronic
1075096427 10:119474481-119474503 ATAAAATTTGTTTAATTAGCTGG + Intergenic
1075250586 10:120867902-120867924 TTCAAAGTTATTTAATTATGAGG + Intronic
1077733685 11:4765081-4765103 ATCACATTTGTTGAATTAAGAGG - Intronic
1078604026 11:12759075-12759097 ATGGCATTTCATTAATTATGAGG + Intronic
1078786173 11:14495839-14495861 ATGAAAATTTTTAAATTATGAGG + Intronic
1079860618 11:25666487-25666509 ATCAAAGTTGATTAATTATTGGG - Intergenic
1079926166 11:26494514-26494536 TTCATATTTCTTTAATTTTGTGG - Intronic
1079936162 11:26619102-26619124 TTCAAATTTATTTAAATATTTGG - Intronic
1080653084 11:34238059-34238081 TTAAAATTTATTTAATTTTGTGG - Intronic
1081075109 11:38662700-38662722 ATCAGCTTTATTTAATTCTGAGG - Intergenic
1082682780 11:56198101-56198123 ACATAATTTCTTTAATTAAGAGG + Intergenic
1082869227 11:57928656-57928678 ATTAAATTTGTCTAATTCTGGGG + Intergenic
1082963750 11:58944386-58944408 ATCAAGTTTCTTTATTTGTAGGG - Intronic
1083529688 11:63408590-63408612 ATCATTTTGCTCTAATTATGGGG - Intronic
1085208451 11:74751317-74751339 ATGAAACGTCTTTAATTTTGTGG + Intronic
1085825034 11:79838117-79838139 ATCTAATTTTTTAAATTTTGGGG - Intergenic
1085886604 11:80530405-80530427 CTAAAATGTTTTTAATTATGTGG - Intergenic
1085963472 11:81492157-81492179 ATCAAATTTCTTTATTCTTTTGG + Intergenic
1086290074 11:85298549-85298571 TTCTAATTTCCTTAATTCTGGGG - Intronic
1086646024 11:89221350-89221372 AGGAGATTTCTTTGATTATGAGG - Intronic
1087484202 11:98741239-98741261 AGCAATTTTTTTTTATTATGAGG - Intergenic
1087838796 11:102901482-102901504 ATATAATTTCATTAATTATATGG - Intergenic
1088176804 11:107062154-107062176 ATCATAATTCTTTAATAATGTGG + Intergenic
1088184676 11:107153064-107153086 ATCAAGTTTCTATAATTAGAAGG + Intergenic
1088722714 11:112608685-112608707 ATAAAATATATTCAATTATGAGG + Intergenic
1090236384 11:125151416-125151438 TGCAAATTTCTTTAAATATCTGG + Intergenic
1090504229 11:127293729-127293751 ATCAATTGTCTATAAATATGTGG - Intergenic
1093293362 12:17357151-17357173 TTCAAATTTCTTTTATAATGTGG + Intergenic
1093622375 12:21307244-21307266 ATCAACTTTCTTTGATTTTTAGG + Intronic
1093958296 12:25247809-25247831 AGTAAATCTCTTTAATGATGTGG - Intronic
1094314046 12:29118197-29118219 CTCAAATTTCTTCAAGAATGAGG + Intergenic
1094359186 12:29611625-29611647 ATGAACTTTCTTTATTTTTGTGG + Intronic
1094485229 12:30920830-30920852 ATCAGATTTTTTTAAATTTGAGG - Intergenic
1095372748 12:41489058-41489080 GTAAACTTTCTTAAATTATGAGG + Intronic
1096379542 12:51144518-51144540 ATCAAATTTCTATATATGTGGGG - Intronic
1097471124 12:59993489-59993511 ATCAAATTTGTTTAATTTGGGGG - Intergenic
1098710473 12:73752200-73752222 ATCAAATTTATCTTTTTATGGGG - Intergenic
1099743653 12:86673493-86673515 TTCTTATATCTTTAATTATGTGG - Intronic
1100408682 12:94293778-94293800 AAAAAATTTTTTTAATTATCTGG - Intronic
1100700277 12:97140007-97140029 ATCTAAATTATTGAATTATGTGG + Intergenic
1101536450 12:105622114-105622136 ATGATATTTCTTTAATAATCAGG + Intergenic
1101891121 12:108716297-108716319 ATAAAATTTTATTAATTATTTGG + Intronic
1102312664 12:111858973-111858995 ATCAGTTTTCTTTAATTCTTTGG + Intronic
1103809919 12:123605180-123605202 AGAAAATTTTTTTAATTATGTGG - Intronic
1105617678 13:22034504-22034526 ATCAAATTCCTATATATATGTGG + Intergenic
1106347422 13:28892521-28892543 CACAAATTTTTTTAATAATGTGG - Intronic
1106942073 13:34790613-34790635 ATCCAATTTCTTTCTTTTTGAGG - Intergenic
1107062800 13:36178422-36178444 ATCAAATGACTATAAATATGTGG + Intronic
1107621624 13:42237697-42237719 ATCAAATGTCTTGAATGATTAGG - Intronic
1107636840 13:42400711-42400733 ATCACATTTGTTTAGTTCTGAGG + Intergenic
1108120957 13:47186297-47186319 ATCATGTTTCTTTTATTATGTGG - Intergenic
1108808883 13:54195719-54195741 TTCATGTTTCTTTCATTATGGGG - Intergenic
1109413926 13:62010607-62010629 AACAAATTTCATTAAGTATTGGG + Intergenic
1109473924 13:62852657-62852679 ATCAATTTTATTTACTTTTGAGG + Intergenic
1109643904 13:65227057-65227079 ATCATATTTTTCTAAATATGGGG - Intergenic
1109889968 13:68598579-68598601 ATTTAACTTTTTTAATTATGAGG + Intergenic
1110121733 13:71890309-71890331 ATTTTATTTCTTTTATTATGGGG + Intergenic
1110254133 13:73413201-73413223 ATCACAATTCTTTAATTAAATGG + Intergenic
1110870099 13:80441508-80441530 ATCAATTGTCTGTAAATATGTGG + Intergenic
1110943378 13:81382199-81382221 ATCAATTTTTTTTGTTTATGAGG - Intergenic
1110972568 13:81783528-81783550 CTCATATTTCTCTTATTATGAGG - Intergenic
1111021671 13:82459163-82459185 ATCAAAAATCTTAAAGTATGGGG + Intergenic
1111049128 13:82856222-82856244 CACTAATTTTTTTAATTATGTGG + Intergenic
1111265372 13:85804706-85804728 ATCACAAATATTTAATTATGTGG - Intergenic
1111532218 13:89552692-89552714 ATCTAATTTTTTTAATTGAGAGG - Intergenic
1112126377 13:96472915-96472937 ATCTTATTTCTATAGTTATGAGG + Intronic
1114090303 14:19281504-19281526 ATAATATTTCTTTAAAAATGTGG + Intergenic
1114390042 14:22297834-22297856 TGCCAATTTCTTGAATTATGGGG + Intergenic
1114916312 14:27270818-27270840 ATCGATTTTCTTTACTTCTGGGG + Intergenic
1115050649 14:29058096-29058118 AATAAATTACTTTAATGATGGGG + Intergenic
1115871080 14:37803281-37803303 ATCCACTTTCTTTATTTCTGTGG + Intronic
1116310219 14:43315955-43315977 AAAAAATTTCTTTATTTCTGTGG - Intergenic
1116574900 14:46560796-46560818 ATCTCATTTCTTAAAATATGTGG - Intergenic
1116758510 14:48979992-48980014 ATAAAATTTCTTTAAAAAAGAGG - Intergenic
1116912995 14:50491264-50491286 AACCAATGTCTATAATTATGTGG + Intronic
1117691643 14:58313564-58313586 AGCAAATTTCTCTAATACTGGGG - Intronic
1118472053 14:66083316-66083338 AACACATTTCTTTAAGTATCCGG - Intergenic
1118833955 14:69462763-69462785 ATCAAATCTCTTTAATTTCCAGG - Intergenic
1119069373 14:71567035-71567057 ATTAAAATTCTCTAATTATCAGG + Intronic
1119279816 14:73396298-73396320 ATCTATTTACTTTAATTATTAGG + Intronic
1120207998 14:81606937-81606959 ACCAAATGTCTTTACCTATGTGG - Intergenic
1120296962 14:82653912-82653934 CTCAAAATGCTTTAATTGTGGGG + Intergenic
1120681250 14:87483624-87483646 ATAATAGTGCTTTAATTATGCGG - Intergenic
1121033681 14:90681507-90681529 AACAAATGTTTGTAATTATGTGG - Intronic
1121948921 14:98151894-98151916 AGACAATTTCTTTAATTATATGG + Intergenic
1122063486 14:99155232-99155254 CTCAAATTTCTTTAATTTTGAGG - Intergenic
1123925472 15:25105647-25105669 ATGAAACTCTTTTAATTATGAGG + Intergenic
1124052568 15:26211379-26211401 AGCAAATTTTTATAATTCTGGGG + Intergenic
1125298972 15:38233940-38233962 CTCCAATTTCTTTATCTATGTGG + Intergenic
1126381522 15:48052547-48052569 ATCAAATTAATGTGATTATGAGG - Intergenic
1126449953 15:48795955-48795977 TTCAAATTTCCCCAATTATGTGG + Intronic
1126604516 15:50461899-50461921 TTCATTTTGCTTTAATTATGTGG + Intronic
1126762821 15:51985179-51985201 ATAAAATTTTTTTAATTAGCTGG + Intronic
1126872540 15:53005011-53005033 ATCATTTTTCTTTTCTTATGGGG + Intergenic
1126896622 15:53264489-53264511 ATGAAAATTCTTGAACTATGGGG - Intergenic
1127091340 15:55470493-55470515 ATAAAATTCCTGTAACTATGAGG - Intronic
1127550700 15:60035205-60035227 ATCAAATGGCTTTAATCATGTGG + Intronic
1127636306 15:60873596-60873618 ATTAATTTTCTTTCATTATCTGG - Intronic
1127971316 15:63964401-63964423 ATTAAATGTCTTTAATTTTTGGG + Intronic
1128196780 15:65764638-65764660 ATTAAATTTAATTAATTATTGGG - Intronic
1128935559 15:71743265-71743287 ATCAAATTTTTTTAATCAAAAGG - Intronic
1129061064 15:72860650-72860672 TTTCAATTTCTTTAACTATGGGG - Intergenic
1129627919 15:77224354-77224376 ATAAAATTTTCTTAATTATCTGG + Intronic
1130552464 15:84899405-84899427 ATGAAATTTCTTTAATCTTTGGG - Intronic
1130619649 15:85448899-85448921 AAAAAATTTTTTTAATTATATGG - Intronic
1130918949 15:88328080-88328102 CTCCAATTTCTTCATTTATGGGG - Intergenic
1131467065 15:92664231-92664253 ATCCAATTCCTTTTATTATGTGG - Intronic
1131932326 15:97457055-97457077 ATCAAGTGGCCTTAATTATGTGG + Intergenic
1138404995 16:56785028-56785050 AGCATAATTTTTTAATTATGGGG + Intronic
1138786779 16:59855776-59855798 ATCAAAGTTCTTAAATCTTGGGG - Intergenic
1139102769 16:63788480-63788502 ATCCTATTTGTTTAATTATGAGG + Intergenic
1139354373 16:66358671-66358693 AAAAAATTTTTTTAATTATCCGG + Intergenic
1139385289 16:66564801-66564823 TTAAAAAATCTTTAATTATGTGG + Intronic
1140632223 16:76867086-76867108 ATCCATTTTCTTGATTTATGTGG - Intergenic
1140776975 16:78258098-78258120 ATAAAATATTTTTAATTATAGGG - Intronic
1142370846 16:89680745-89680767 AGCAAATTTGGTTACTTATGTGG - Intronic
1142739500 17:1922718-1922740 ATCAAAGTTGTTTGAATATGTGG + Intergenic
1143938374 17:10511323-10511345 ATGAAATGTGTTTAATTATTAGG - Intronic
1146195107 17:30805350-30805372 CTGAAAATTGTTTAATTATGAGG + Intronic
1146573835 17:33974957-33974979 ATCTAATTTACTTATTTATGTGG + Intronic
1147779412 17:42929561-42929583 ATCAACTTTTTTTTATTTTGAGG + Intergenic
1148284818 17:46379022-46379044 ATCATTTGTCTATAATTATGTGG + Intergenic
1148307039 17:46596944-46596966 ATCATTTGTCTATAATTATGTGG + Intronic
1148420849 17:47545164-47545186 AAAAAATTTTTTTAATTAGGTGG - Intronic
1149332413 17:55598633-55598655 ATCAATTTGATATAATTATGTGG + Intergenic
1149930984 17:60755060-60755082 CTTAAATTTCTTTAATGATTTGG + Intronic
1149952687 17:61007390-61007412 ATCAAATTTCTAAATTTATTGGG + Intronic
1150169866 17:62982115-62982137 ATCTCAACTCTTTAATTATGTGG + Intergenic
1152231204 17:79114967-79114989 ATCAGATAGCTTCAATTATGTGG - Intronic
1153294509 18:3532880-3532902 ATCAAATTACCTCAATTCTGAGG - Intronic
1153362176 18:4209578-4209600 ATTAAATATATTTAAATATGAGG - Intronic
1155263593 18:24069877-24069899 ACCTAATTCTTTTAATTATGTGG + Intronic
1155866129 18:30967286-30967308 ATCAAAAGTTTTTAATTATGGGG - Intergenic
1156571654 18:38261916-38261938 ATCATACTTCTTTAATTATTTGG + Intergenic
1156660966 18:39346233-39346255 TTCAAATTTCTTTTTTTGTGGGG + Intergenic
1156806925 18:41195758-41195780 AGCAAATTTCTTATTTTATGGGG - Intergenic
1156915129 18:42457003-42457025 ATGAGATATATTTAATTATGTGG - Intergenic
1158051727 18:53229396-53229418 ATATAATTTGTTTAATTATAAGG - Intronic
1158355629 18:56615609-56615631 TTCAAATTCCTTTTATTTTGAGG - Intronic
1158383892 18:56967082-56967104 ATTAAATTTCATTAATTGTAGGG + Intronic
1158425079 18:57332124-57332146 ATCAAATTTCCTGAATCATTGGG - Intergenic
1158760822 18:60384279-60384301 ATGAATTTTCCTTAAATATGGGG + Intergenic
1159112304 18:64073557-64073579 AGCTAATATCTTTAATTATCAGG + Intergenic
1159189669 18:65025397-65025419 ATCAAATTTCTTTTACTTTTTGG - Intergenic
1159290341 18:66410190-66410212 ATTAAAATTGTTTAATTATAAGG + Intergenic
1159359781 18:67384925-67384947 AACATATTTCTTTATTTATTTGG - Intergenic
1159433089 18:68381539-68381561 AGAACATTTCTGTAATTATGAGG - Intergenic
1159438911 18:68452830-68452852 TCCAAATTTCTTTGTTTATGAGG - Intergenic
1159602684 18:70443617-70443639 AACAAATATCTTTAGTTCTGGGG - Intergenic
1159659969 18:71083037-71083059 ATCCTTTTTCTTTAATTATTGGG + Intergenic
1164790634 19:30975544-30975566 ATCAAATTTCTTTTTGCATGTGG - Intergenic
1167121201 19:47518016-47518038 TTAAAATTTTTTTAATTTTGTGG - Intergenic
1167147405 19:47690836-47690858 ATTAAATTTTTTTAATTTTTTGG + Intronic
1168118219 19:54237653-54237675 ATCTATTTCCTTTATTTATGGGG + Intronic
925954156 2:8945008-8945030 GTTAAATTTCTTGAAATATGAGG + Intronic
926779622 2:16457552-16457574 ACAAAATTTCTTAAATTATAGGG - Intergenic
926877502 2:17498306-17498328 GTAAAATTTATTTAATAATGGGG - Intergenic
926948144 2:18211591-18211613 ATCAAATTAGTGTAATTATAGGG + Intronic
928712300 2:34020733-34020755 ATCAACTTTCTATAATTCTGTGG - Intergenic
928741266 2:34356205-34356227 GTCATTTTTTTTTAATTATGGGG - Intergenic
928931309 2:36627648-36627670 AGCAAATTTCTTTATTTTTGTGG + Intronic
928939046 2:36708715-36708737 CTCAAATTTCTTTAATTGGCAGG - Intronic
930345412 2:50174032-50174054 ATCAATTTTTTTTATTTTTGTGG - Intronic
930569602 2:53068496-53068518 TTTTAATTTCTTTAATTATTAGG - Intergenic
931062147 2:58542560-58542582 ATCAAATTATATTAATTATCTGG - Intergenic
932036884 2:68254288-68254310 ATCAAATTATTTTAACTAAGGGG + Intronic
932382368 2:71296866-71296888 ATTAAATTTTTTTCAGTATGTGG + Intronic
932426655 2:71641573-71641595 TTCTAATTTCTTGAATTATCAGG + Intronic
932631412 2:73346465-73346487 TTAAAATGTCTTTATTTATGTGG + Intergenic
932740783 2:74289679-74289701 ATAAAATTTCTTTAAACATTTGG - Intronic
935613065 2:105046217-105046239 ATCACAGTTCTTTGAATATGAGG + Intronic
935984923 2:108663278-108663300 AAAAAATTTTTTTAATTATCTGG - Intronic
936785593 2:116090373-116090395 ATCAATTGGCTTTAAATATGTGG + Intergenic
937464378 2:122117980-122118002 ATCAAATGGCTATAAATATGTGG + Intergenic
938148294 2:128857727-128857749 ATAATAGTTCTTTAATAATGTGG + Intergenic
938606927 2:132903981-132904003 ATCAAATATTTTTAATGGTGTGG - Intronic
939117980 2:138083024-138083046 ATCACTCTTCTTTAATTGTGGGG - Intergenic
939729888 2:145770219-145770241 ATAAAATTTCAGTAATTATCTGG - Intergenic
940518217 2:154708605-154708627 ATTTAATTTATGTAATTATGGGG - Intronic
940549061 2:155128566-155128588 CTCAAATTTATTTCATTATATGG - Intergenic
941140192 2:161770770-161770792 ATGATATTTCTTCAAATATGTGG + Intronic
941140966 2:161781490-161781512 ATTAAAATTATTTAAATATGAGG + Intronic
941459892 2:165757247-165757269 AACAAATATCATTAATTATCAGG - Exonic
941738485 2:169007196-169007218 ATCAATTTACTGTAATTAAGAGG - Intronic
942179207 2:173363969-173363991 ATCTAATTTCTTTATTTGTGTGG + Intronic
942428786 2:175887250-175887272 ATCTATTTTTTTTAATTCTGTGG + Intergenic
942709751 2:178819828-178819850 ATTAAAATTATTTAAATATGAGG - Intronic
943402829 2:187437072-187437094 TTCAAATTTCATTAATTTTTGGG + Intronic
943629128 2:190231360-190231382 ATCAAATGTTTTTAATTTTGAGG - Intronic
943945646 2:194059855-194059877 ATCGAATTACTTAAATTTTGAGG - Intergenic
944406840 2:199394241-199394263 ATTAAATTTATTTATTTATGTGG - Intronic
944676586 2:202037639-202037661 ATTAACTTTCCTTTATTATGAGG - Exonic
944770596 2:202910557-202910579 ATAAAATTTTTTGAAATATGTGG - Intronic
945165894 2:206944669-206944691 ATAAAACATCTTTAATTTTGAGG + Intronic
946052585 2:216876413-216876435 TTCAAATTTCTAAGATTATGTGG + Intergenic
946234332 2:218313747-218313769 ATCAAATTTGTATAATTTTCTGG - Intronic
946659319 2:221982534-221982556 ATCAGATTTCTTAAAGTGTGAGG - Intergenic
947843940 2:233228943-233228965 ATCAAAACTATTGAATTATGAGG - Intronic
947959758 2:234226041-234226063 ATCAAAGTTATCTAACTATGTGG - Intergenic
1169681268 20:8216691-8216713 ATAAGATATCTTTAAATATGAGG - Intronic
1170141191 20:13126485-13126507 ATCAAATGTCTTTTGCTATGAGG + Intronic
1171048225 20:21831337-21831359 AACAATTTTCTTTAAATATCAGG + Intergenic
1171080088 20:22172168-22172190 ACTCAATTTCTGTAATTATGTGG + Intergenic
1172980176 20:38935603-38935625 AAAAAATTTTTTTAATTATCTGG - Intronic
1173075179 20:39811609-39811631 ATCACCTTTCTTTATGTATGGGG - Intergenic
1173244755 20:41328766-41328788 AAAAAATTTGTTTAATTATCTGG - Intergenic
1174065753 20:47864241-47864263 ATGAAATTTCTTGAATACTGAGG + Intergenic
1176971079 21:15266748-15266770 TTGAATTTTCTTTAATTTTGTGG - Intergenic
1177271848 21:18858575-18858597 CTCAAATCTCACTAATTATGGGG - Intergenic
1177339052 21:19774966-19774988 ATCTAATTTCATTGACTATGTGG + Intergenic
1177620588 21:23586959-23586981 ATTAAATTTCTTTTATAATTTGG - Intergenic
1177897327 21:26869445-26869467 ATAAAATTTCTGTAATTGTTTGG + Intergenic
1178313257 21:31547450-31547472 AGCTAATTGCTTTAATTTTGAGG - Intronic
1179016428 21:37597637-37597659 CTCAGATTTCTTTAATAATAGGG + Intergenic
1179056157 21:37936761-37936783 ATAAAAGGTCTTTAAATATGAGG + Intergenic
1179777510 21:43675811-43675833 ATAAACTTTCTTAAAATATGAGG + Intronic
1182120885 22:27785924-27785946 ATACAATTTCTTTTTTTATGTGG - Intronic
1182210378 22:28671649-28671671 AAAAAATTTCTTCCATTATGTGG + Intronic
1182472017 22:30554651-30554673 ATCAAATTCCTTTACTTCTGAGG + Exonic
1183455423 22:37920147-37920169 AACAACTTGCTTTAAGTATGTGG + Intronic
1184724029 22:46332593-46332615 ACCACATTTCATTAATTTTGTGG + Intronic
949132468 3:521064-521086 ATCACATTTTTTTAATAAAGTGG + Intergenic
949367590 3:3299979-3300001 ATCATATTTCTTTTACTTTGAGG - Intergenic
949553472 3:5132042-5132064 AACAAATTTTTTTAATTAGCTGG - Intronic
949838940 3:8299686-8299708 ATTTAGTTTCTTTAATTTTGGGG + Intergenic
951090633 3:18569445-18569467 AGCAAATATTTTTAAATATGGGG - Intergenic
951114906 3:18848187-18848209 ATCAAATATATTTAAATATTTGG + Intergenic
951207974 3:19944761-19944783 ATCAAATGTTTTTCATTGTGAGG + Intronic
953235919 3:41106707-41106729 ATAAAATTGCTTTAAATATTTGG + Intergenic
953806394 3:46072964-46072986 ATCAATTGTCTCTAAATATGTGG - Intergenic
953936255 3:47045956-47045978 AAAAAATTTTTTTAATTCTGTGG - Intronic
954096697 3:48334286-48334308 CTCAAAATTCTTAAAGTATGGGG - Intergenic
956295474 3:67708176-67708198 ATCAAAGTTTTTTACTTACGAGG + Intergenic
957127962 3:76186633-76186655 AGGATATTTCTTTACTTATGGGG - Intronic
957361543 3:79165857-79165879 ATCAATTGACTTTAATTAAGTGG + Intronic
958831230 3:99092372-99092394 ATCTAATTTATTTAATCAAGAGG - Intergenic
958841180 3:99207440-99207462 GCCAAATTTCCTTAATTATCTGG - Intergenic
959176317 3:102916216-102916238 ATCTAATTTTGTTAATTTTGTGG + Intergenic
959204997 3:103296337-103296359 TTCATATTTCTATAATGATGAGG + Intergenic
959323662 3:104909185-104909207 ATAAAATTTCTTTTAGTATTGGG - Intergenic
959385114 3:105694567-105694589 ATCATATTTCTAAAATGATGTGG + Intronic
959486484 3:106932851-106932873 ATCACATTTCTATATTGATGTGG - Intergenic
959665183 3:108912537-108912559 ATTCAATTTTTTTAATCATGAGG - Intronic
960397217 3:117152140-117152162 ACCAAATGTCTCTATTTATGTGG - Intergenic
960591733 3:119373217-119373239 ATTAATGTTCTTTAATTATAAGG + Intronic
961456201 3:127025420-127025442 AACAAATTTTTTTAAGTTTGTGG - Intronic
962129428 3:132657275-132657297 ATCAAACTTCTATAAATATGTGG + Intronic
962870410 3:139485320-139485342 ATAAAGTTTTTTTAATTGTGGGG + Intergenic
963216734 3:142756682-142756704 ATCAAGTTTCAGTAAGTATGTGG - Intronic
963657819 3:148081210-148081232 ATCAAATTTCTTTGTGTGTGTGG - Intergenic
964002472 3:151792245-151792267 ATGAATTTTCTTTAACTATGAGG - Intergenic
964173293 3:153796450-153796472 GTCAAATATATTCAATTATGAGG - Intergenic
965211859 3:165800953-165800975 ACCAAATTTTTTTAATAATGTGG + Intronic
965633710 3:170759475-170759497 ATCAGCTTTGTTCAATTATGAGG + Intronic
965921663 3:173924148-173924170 ATCAAATGTATTTATTTATTTGG + Intronic
967502460 3:190215275-190215297 ATTAAACTTCTTTGATTATTAGG - Intergenic
969751797 4:9117013-9117035 ATTTAATTTCTTTATTTCTGAGG + Intergenic
970062064 4:12045346-12045368 ATGAAATTAGTTTAGTTATGAGG - Intergenic
970837452 4:20427427-20427449 ACCAAATATCTTTGATTCTGTGG - Intronic
971632250 4:29008437-29008459 ATCTTAGTTGTTTAATTATGGGG - Intergenic
971706788 4:30055053-30055075 ATCAAAATTCTGTATTGATGTGG + Intergenic
971792582 4:31187433-31187455 ATCAAATTTCATTAAATGTAAGG - Intergenic
973218217 4:47695889-47695911 TTCATCTTTCCTTAATTATGTGG - Intronic
973533462 4:51856473-51856495 ATTAAATTACTTTAAGTGTGTGG + Intronic
974390666 4:61262797-61262819 ATCAAATAATTTGAATTATGTGG + Intronic
974862230 4:67536603-67536625 AACAAATTTCATTCCTTATGTGG + Intronic
975900640 4:79147740-79147762 ATGACATTTCTTTAATATTGGGG - Intergenic
976779464 4:88742488-88742510 ATCAAAGATCTTTAAGTCTGAGG + Intronic
977183489 4:93906510-93906532 ATCAAATTTTTTTAATCTTGAGG + Intergenic
977196487 4:94067417-94067439 CTTAAATTTTTTTTATTATGAGG - Intergenic
977373915 4:96175733-96175755 ATGAAATTACTTAAATTATTAGG - Intergenic
977724128 4:100275054-100275076 ATCATATTTCTTTTATGATCTGG + Intergenic
978011628 4:103692559-103692581 ACCAACTTTCTGTAATTAAGAGG + Intronic
978634498 4:110788208-110788230 ATCAAGTTTCTATAATTTTGTGG - Intergenic
978672880 4:111272380-111272402 CTCAAATTTATTTATTTATTTGG - Intergenic
978944440 4:114478399-114478421 ATCAAAATTCATAAATGATGTGG - Intergenic
979737865 4:124110500-124110522 ATAAAATTTCTTTAGTTGTCAGG + Intergenic
979769281 4:124502688-124502710 ATCAAATTTCTTCCATTACAAGG - Intergenic
980309974 4:131114316-131114338 ATGAAAATTCATTAATTATCAGG - Intergenic
980396676 4:132224049-132224071 TTCAAATTTCTTTTATCATAAGG - Intergenic
980434855 4:132757606-132757628 ATAAAATTTTCTTAATTAAGTGG + Intergenic
980508225 4:133751496-133751518 ATAAAATGTCTTTAAATTTGGGG - Intergenic
980871793 4:138620408-138620430 ATTAAATTTCTTTAAAACTGTGG + Intergenic
981071107 4:140539664-140539686 AATAAATATCTTTAATGATGAGG - Intronic
981681635 4:147406297-147406319 ATCAAATATCTTCAGTTATTAGG - Intergenic
981877412 4:149564244-149564266 TTCAAAATTATTTAATTATTTGG + Intergenic
981967080 4:150617236-150617258 ATCATATTTGTTTCTTTATGAGG - Intronic
981983328 4:150824065-150824087 ATGAAATATCTTTCATTTTGGGG + Intronic
982322242 4:154089556-154089578 ATAAAAGTTCTTTAAAAATGTGG - Intergenic
982682108 4:158443734-158443756 GTGTAATTTCTTTAATTATTAGG - Intronic
983009955 4:162535744-162535766 ATTAAATTTATTTAATAATTAGG - Intergenic
983091844 4:163513196-163513218 TTCATATTTATTTAATGATGTGG + Intronic
983095806 4:163559948-163559970 CTCAGATTTCTTTATTTATGTGG + Intronic
983104184 4:163665144-163665166 ATCAATTTGCCTTAATTCTGTGG - Intronic
983325412 4:166249041-166249063 ATCATATTTATTTTATTATTCGG + Intergenic
983510796 4:168607670-168607692 ATCAAATTACCTTAGTTCTGTGG - Intronic
984058736 4:174964717-174964739 ATTAAATTTCTTAATTTATCCGG - Intronic
984144129 4:176040584-176040606 ATCACATTTATTGATTTATGTGG + Intergenic
984447988 4:179861941-179861963 TTCAAATTCCTTGAGTTATGTGG - Intergenic
984667595 4:182445792-182445814 ATCAAATATATTGAATTATGTGG - Intronic
984906577 4:184633182-184633204 ATCAAATTTACTCAATTCTGAGG - Intronic
985360028 4:189164158-189164180 ATAAAATGTCTTTAATTAATTGG + Intergenic
987719321 5:21614509-21614531 AACAAATTTCATTGATTAAGAGG - Intergenic
989966078 5:50467166-50467188 ATCTAAGATCTTTCATTATGTGG + Intergenic
990264969 5:54065112-54065134 CTCAAATTTATTTAATTCTGTGG - Intronic
991170621 5:63621083-63621105 ATCTAAAATATTTAATTATGAGG + Intergenic
991314581 5:65286564-65286586 ATAAAATTTCTTTGATTTTGTGG + Intronic
991334527 5:65531998-65532020 ATAAAATTAGATTAATTATGGGG + Intronic
993206239 5:84883057-84883079 ATTTCATTTATTTAATTATGTGG - Intergenic
993321965 5:86481788-86481810 CTCAAATTTCATTAATTAGTTGG - Intergenic
993838719 5:92848823-92848845 ATTAATTTTCTTTATTTATCTGG - Intergenic
993990760 5:94655230-94655252 ATCAGTTTGCTTTAAATATGTGG + Intronic
994258319 5:97627223-97627245 ATAAAAGTTCCTAAATTATGAGG - Intergenic
994366467 5:98923331-98923353 AGCATATTTCTTTAATTATTCGG - Intronic
994663282 5:102678732-102678754 ATTAAACTCCTTTAATCATGAGG - Intergenic
994734492 5:103535566-103535588 ATGAAATCTCTTTTATTTTGTGG + Intergenic
994783318 5:104120711-104120733 ATCAAATTTCTTTTCTTATATGG - Intergenic
994805721 5:104445556-104445578 ATCAAGTTTCCTTATTCATGTGG - Intergenic
995089893 5:108161700-108161722 ACCAAATTTCTTTACATATGTGG - Intronic
995346536 5:111126556-111126578 ATCAAACTTTTTTTATTATAAGG - Intronic
995497447 5:112761715-112761737 ATCAAATTTCTTTCTATATATGG - Intronic
996280002 5:121718561-121718583 ATTAATTTACTTTAAATATGTGG + Intergenic
996441529 5:123496725-123496747 AAAAAATTTTTTTAATTATTTGG - Intergenic
997922703 5:137997879-137997901 TTCAAATTTCTTAAATTGGGAGG + Intronic
998699872 5:144685819-144685841 ATCTAATTTCTTAAAATATAAGG + Intergenic
999445439 5:151635067-151635089 ATCAAATTACCTGGATTATGGGG - Intergenic
1000643103 5:163728564-163728586 ATCAACTATCTTTAATTGTTTGG + Intergenic
1000668218 5:164025669-164025691 ATTGAAATTCTGTAATTATGTGG + Intergenic
1000887677 5:166766073-166766095 ATCAGAATTATTTAATCATGTGG + Intergenic
1001027862 5:168239208-168239230 ATCAAATTTCTTTAATTATGAGG - Intronic
1001358113 5:171052237-171052259 CTCAAGATTCTTTAATTTTGAGG + Intronic
1001373780 5:171234627-171234649 ATCAAATTTCTTGATTCATTGGG + Intronic
1001790321 5:174451345-174451367 ATCAATTTTCTGTAAGTTTGTGG - Intergenic
1003826381 6:9957269-9957291 TTCCAATTTCTTTAATTTAGAGG - Intronic
1004844871 6:19629498-19629520 AGCAAATAATTTTAATTATGAGG - Intergenic
1005130376 6:22500438-22500460 ATCAAATTTCTGTCTTTATCTGG - Intergenic
1005323904 6:24681141-24681163 ATCAAAAATCTTAAAGTATGGGG - Intronic
1006883278 6:37357994-37358016 ATCATATTTCTTCAGTTATTAGG - Intronic
1008200142 6:48576558-48576580 ATCAAAGTTCTTTCATTTTCAGG - Intergenic
1008247859 6:49201269-49201291 ATCAAATTGTTTTATTTCTGTGG + Intergenic
1008373828 6:50768639-50768661 ATTAGATTACTTTAATTATTTGG + Intronic
1008521786 6:52368411-52368433 ATCAGATTTTTTTAATTTTTGGG + Intronic
1008956256 6:57219655-57219677 ATCAATTGTCTTTATTTGTGAGG - Intronic
1009246318 6:61243040-61243062 ATGAAATGTCTTTAATTACAAGG + Intergenic
1010562287 6:77365306-77365328 ATCATATTTCTATATTTATTTGG - Intergenic
1010622640 6:78095362-78095384 ACCAACTTTATTAAATTATGGGG - Intergenic
1010738539 6:79470506-79470528 TACTAATTTATTTAATTATGAGG + Intergenic
1011540146 6:88419787-88419809 ATCAAAAATCTTAAAGTATGGGG - Intergenic
1011559549 6:88600708-88600730 AACAAATGTCTTCAATTAGGCGG - Intergenic
1011979473 6:93354735-93354757 ATCAAATTTCTGTAAGTTTCTGG - Intronic
1012489334 6:99763345-99763367 ATTTAATTTATTTAATCATGAGG + Intergenic
1013960634 6:115895344-115895366 ATCAAGAGTTTTTAATTATGTGG - Intergenic
1014144132 6:117977834-117977856 ATCAAAATTTTTTAATGATAGGG + Intronic
1014349421 6:120321108-120321130 GTCAGTGTTCTTTAATTATGTGG - Intergenic
1014443361 6:121498466-121498488 ATAAAATTTAAATAATTATGAGG - Intergenic
1014577220 6:123088661-123088683 ATCAAAATTATTTAATTGTCAGG - Intergenic
1014593800 6:123307277-123307299 AGGAAATTTTTTTAATTAAGAGG - Intronic
1014630807 6:123787781-123787803 ATGAAATGTCTTTAATAATTTGG + Intergenic
1014742966 6:125167980-125168002 ATTAAATTCATTTGATTATGGGG + Intronic
1014821506 6:125993173-125993195 ATAAAATTTGTATAATTATTTGG + Intronic
1015649930 6:135445732-135445754 AAAAAATTTTTTTAATTAGGTGG - Intronic
1015768885 6:136749031-136749053 GTCAAATTGCCTTAATTATTAGG + Intronic
1016753479 6:147658015-147658037 ATAAAATATCTTTAAAAATGTGG + Intronic
1017181642 6:151558691-151558713 ATCAGATGGCTATAATTATGTGG + Intronic
1017224987 6:152010635-152010657 ATCCAAATTCTCTAATTAAGTGG + Intronic
1017930380 6:158948940-158948962 CTCCATTTTCTTTACTTATGTGG + Intergenic
1018601530 6:165548929-165548951 ATCAAATTTATTCAAATATATGG - Intronic
1022228274 7:28386214-28386236 TTCAAATTTCTTTAATTGAGTGG + Intronic
1022294918 7:29041585-29041607 ATTAAATATATTTAATGATGTGG - Intronic
1022707141 7:32812780-32812802 ATCAAAATTCTTCAGTTATAAGG + Intergenic
1022915730 7:34949853-34949875 ATCAAAATTCTTTAGTTATAAGG - Exonic
1024364262 7:48503246-48503268 AACAAATTGTTTTAATTATCAGG - Intronic
1024793912 7:53000562-53000584 ATCAAATTTCATTGATTAAAAGG + Intergenic
1025155174 7:56598657-56598679 AGCCAATTTCTGGAATTATGGGG - Intergenic
1025717944 7:63980990-63981012 AACAAATTTTTTTTAGTATGTGG + Intergenic
1026554676 7:71396415-71396437 ATCAACTTACTGTAAATATGAGG + Intronic
1026668408 7:72364782-72364804 ATCAATTTTATATATTTATGGGG - Intronic
1027630773 7:80602547-80602569 AGCAAATTTCTTTAACCATTTGG - Intronic
1028168302 7:87564669-87564691 AACAAATTTCTTAAATTCTTTGG - Intronic
1028539140 7:91923209-91923231 ATAAATTTTCTTTCACTATGTGG - Intergenic
1028642134 7:93054258-93054280 ATATAATTTATTTATTTATGGGG - Intergenic
1029108838 7:98200991-98201013 GTTAAATTTCTTTAATTAGAAGG - Intronic
1029412093 7:100419877-100419899 ATCACATTTCTTTCAGAATGTGG - Exonic
1030543820 7:110867526-110867548 ATAAAATGTCTTTATGTATGTGG + Intronic
1030804402 7:113897342-113897364 ATTAAAACTCTTTAAATATGAGG + Intronic
1030858792 7:114596869-114596891 TTCAAATTTGTTTACTAATGAGG - Intronic
1031185619 7:118476160-118476182 ATGAAATCTTTTCAATTATGAGG + Intergenic
1031214091 7:118868704-118868726 ATCTATTCTCTATAATTATGTGG + Intergenic
1031481742 7:122286126-122286148 ATCAAGTTTGTTTATATATGAGG + Intergenic
1031840615 7:126734536-126734558 ATCAAATTTTTTTAGTGATGTGG - Intronic
1031886136 7:127247937-127247959 ATCAGATTTTTTAAAATATGAGG - Intronic
1032211578 7:129919498-129919520 ATTAAGTTTCTTGAATAATGTGG + Intronic
1033167330 7:139051566-139051588 AACAAATTTTTTTAATTACCTGG - Intronic
1033754720 7:144388907-144388929 ATAAAATTTCTGTAGTTATCTGG - Intergenic
1033868941 7:145725647-145725669 ACCAAATCTATTTATTTATGTGG - Intergenic
1033945872 7:146716897-146716919 ATAAAATGTCTTTAATAATCAGG + Intronic
1034114345 7:148570505-148570527 ATCAAGTCTCTATAAGTATGGGG - Intergenic
1036490353 8:9219437-9219459 ATCCCATTTCTTGAATTATTAGG - Intergenic
1036908269 8:12727016-12727038 ACCAAAATTCTTCAATTGTGTGG - Intronic
1038245090 8:25848004-25848026 AGAAAATTTCATTAATTTTGGGG - Intronic
1039894013 8:41703646-41703668 AAAAAATTTTTTTAATTATGTGG - Intronic
1041464414 8:58144441-58144463 AACAATTTCCTTTAATTGTGCGG - Intronic
1042594684 8:70434418-70434440 TTCACATTTCATTAATAATGTGG - Intergenic
1042789131 8:72583871-72583893 ACCCATTTTTTTTAATTATGAGG + Intronic
1043656105 8:82668374-82668396 ATAAAATTTGTTTAATTTAGGGG - Intergenic
1044027635 8:87193760-87193782 ATCAAATTTGTTTAATTTGAAGG - Intronic
1044305141 8:90631375-90631397 ATTAAAATTTTTTAATTGTGTGG - Intronic
1045279420 8:100736791-100736813 ATTATGTTTGTTTAATTATGAGG - Intergenic
1045614263 8:103889203-103889225 ACAAAATTTCTTTAACTATTAGG - Intronic
1045852120 8:106714757-106714779 ATCAAATTTTTTTATTCATTGGG + Intronic
1045885668 8:107095147-107095169 AACAAATGTCTTTAACTAAGGGG + Intergenic
1046365464 8:113225178-113225200 ATCAAATTTGATTAATAATTAGG + Intronic
1046477888 8:114772586-114772608 AACAAATATCTTAAATTAAGTGG + Intergenic
1046798409 8:118397582-118397604 ATGTAATTTCTTTACCTATGTGG - Intronic
1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG + Intergenic
1047877192 8:129151877-129151899 ATTATATTTCTGTAATTTTGAGG + Intergenic
1047979047 8:130160982-130161004 ATCAAATGTCTGTATTTATCAGG + Intronic
1047996782 8:130344198-130344220 TTCAAATTTCTTTTAATCTGTGG - Intronic
1049932068 9:467157-467179 ATCAAGTTTCTCTAATTTTCAGG - Intergenic
1050676936 9:8066585-8066607 ATCAAATCTCATTATTAATGAGG - Intergenic
1050966794 9:11814490-11814512 ATTAAATTTCTTGGATTTTGTGG + Intergenic
1051063501 9:13073524-13073546 AGCAAATGTCCTTAATTTTGTGG - Intergenic
1051147110 9:14038905-14038927 ATCATATTTCTTAAATTATAAGG + Intergenic
1052022276 9:23538996-23539018 TTCAAGTTTCTATAATTTTGGGG - Intergenic
1052638931 9:31139010-31139032 GTCAAATTTCTTTGGCTATGTGG - Intergenic
1053396708 9:37781595-37781617 ATCAATTTTTTCTAATTATGGGG - Intronic
1053814157 9:41888074-41888096 ATCTAATTTCTGTCATTTTGGGG - Intergenic
1054616439 9:67299366-67299388 ATCTAATTTCTGTCATTTTGGGG + Intergenic
1054770952 9:69083469-69083491 ATCACATTTTTTTAATGTTGAGG - Intronic
1055702835 9:78964630-78964652 TACACATTTCTTTAATTTTGGGG + Intergenic
1056141579 9:83685637-83685659 ATCATATTTCTTTAAGTCTAAGG - Intronic
1056143336 9:83706233-83706255 ATCAAGTTCATTTAATTTTGGGG - Intronic
1056306166 9:85292642-85292664 AACAAATTGCTTTATTTATTTGG - Intergenic
1056500703 9:87205913-87205935 CTCTAATTTATTTAATGATGTGG + Intergenic
1057348295 9:94272053-94272075 AACAAATTCCTTTAATCATAAGG - Intronic
1057932376 9:99205948-99205970 ATCAATTTGCTGTAAGTATGTGG + Intergenic
1058300576 9:103367027-103367049 TTCCAATTTATTTAATTCTGTGG - Intergenic
1058443600 9:105033369-105033391 ATTAAAATTCTTAAATTCTGTGG - Intergenic
1060033081 9:120232355-120232377 ATTAATTTTCTTTAATTTTTAGG - Intergenic
1061650529 9:132044834-132044856 ATGAAATTTATTTAATTCAGTGG + Intronic
1185714326 X:2329045-2329067 ATAAAAATTATTTAATTATTCGG + Intronic
1186679725 X:11859672-11859694 AGCAAAATTCTTAAAATATGTGG - Intergenic
1187419805 X:19123982-19124004 ATGAAAATTCTTTAGGTATGAGG - Intergenic
1188233592 X:27698180-27698202 ATAAACTTTCTTTAATATTGAGG + Intronic
1189664431 X:43338731-43338753 ATGAAATTTGTTTATTTTTGTGG + Intergenic
1189919149 X:45886507-45886529 AAAAAATTTTTTTAATTATCTGG + Intergenic
1190130679 X:47746045-47746067 ATCCCATTGCTTTAATTATAGGG - Intergenic
1191088822 X:56598132-56598154 ATAAAATTATTTTAATTAGGTGG - Intergenic
1191947112 X:66546804-66546826 ATTAAGTTTCTTTAATGATTGGG + Intergenic
1192373811 X:70538618-70538640 ATAAAATTTTTTTAATTGAGAGG - Intronic
1193092205 X:77506615-77506637 ATCAGATTTATTTAATTGGGTGG - Exonic
1193184565 X:78496961-78496983 GGCAAATTTCTTTAATATTGTGG - Intergenic
1193223107 X:78950342-78950364 ATCATATTATTTTAATAATGAGG + Intronic
1193856906 X:86613644-86613666 AAAAAATTTGTTTAATTTTGGGG + Intronic
1193993202 X:88334565-88334587 CTAAAATTTTTTAAATTATGTGG - Intergenic
1194212504 X:91085130-91085152 ATCCAATTTACTTAATTACGTGG - Intergenic
1194388864 X:93291566-93291588 ATCAAATTTTTTAAAGTCTGGGG - Intergenic
1195590084 X:106614556-106614578 ATTTAATTTTTTTAATTTTGTGG + Intronic
1195633147 X:107081316-107081338 ATCAATTTACTGTATTTATGTGG + Intronic
1197609071 X:128618216-128618238 ATAATATTTCTTTGGTTATGAGG - Intergenic
1197655302 X:129110419-129110441 GTCAAATTTCCTTACTTATCTGG - Intergenic
1197851967 X:130871926-130871948 CTCTAATTAGTTTAATTATGTGG + Intronic
1199353886 X:146837647-146837669 ATCAAATTTCATTATTTACATGG + Intergenic
1199380864 X:147170406-147170428 ATGAAATTTCTTCATTCATGAGG + Intergenic
1199409231 X:147500799-147500821 ATCAAATCGCTGTAAGTATGTGG - Intergenic
1199813508 X:151374926-151374948 AGCAAATCTTTTTAATTTTGAGG - Intergenic
1201292400 Y:12433572-12433594 ATCATTTTTGTTTAATTAGGGGG + Intergenic
1201322815 Y:12719231-12719253 TTTTAATCTCTTTAATTATGAGG + Intronic
1202596195 Y:26543140-26543162 TTCAAAATTCTTTATTCATGAGG + Intergenic