ID: 1001032467

View in Genome Browser
Species Human (GRCh38)
Location 5:168272713-168272735
Sequence GATCCCAGCATTCCTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001032458_1001032467 10 Left 1001032458 5:168272680-168272702 CCACCCACTTCTCCCTCATTTCT No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032459_1001032467 7 Left 1001032459 5:168272683-168272705 CCCACTTCTCCCTCATTTCTCCT No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032456_1001032467 12 Left 1001032456 5:168272678-168272700 CCCCACCCACTTCTCCCTCATTT No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032462_1001032467 -3 Left 1001032462 5:168272693-168272715 CCTCATTTCTCCTCACCCAAGAT No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032460_1001032467 6 Left 1001032460 5:168272684-168272706 CCACTTCTCCCTCATTTCTCCTC No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032457_1001032467 11 Left 1001032457 5:168272679-168272701 CCCACCCACTTCTCCCTCATTTC No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data
1001032461_1001032467 -2 Left 1001032461 5:168272692-168272714 CCCTCATTTCTCCTCACCCAAGA No data
Right 1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001032467 Original CRISPR GATCCCAGCATTCCTAAGGA AGG Intergenic
No off target data available for this crispr