ID: 1001034399

View in Genome Browser
Species Human (GRCh38)
Location 5:168287198-168287220
Sequence TGTCCACAAGACCCCCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001034399_1001034410 5 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034410 5:168287226-168287248 GGGCAGGCAATGGGGGATCAGGG No data
1001034399_1001034406 -4 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034406 5:168287217-168287239 GACAGCACTGGGCAGGCAATGGG No data
1001034399_1001034409 4 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034409 5:168287225-168287247 TGGGCAGGCAATGGGGGATCAGG No data
1001034399_1001034405 -5 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034405 5:168287216-168287238 GGACAGCACTGGGCAGGCAATGG No data
1001034399_1001034408 -2 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034408 5:168287219-168287241 CAGCACTGGGCAGGCAATGGGGG No data
1001034399_1001034407 -3 Left 1001034399 5:168287198-168287220 CCCCTTGGGGGGTCTTGTGGACA No data
Right 1001034407 5:168287218-168287240 ACAGCACTGGGCAGGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001034399 Original CRISPR TGTCCACAAGACCCCCCAAG GGG (reversed) Intergenic
No off target data available for this crispr