ID: 1001035322

View in Genome Browser
Species Human (GRCh38)
Location 5:168292568-168292590
Sequence TCTTCCTAAAGGGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 132}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001035322_1001035343 4 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035343 5:168292595-168292617 TCGGGCGGGGGCGGGGGTTGGGG 0: 1
1: 0
2: 16
3: 182
4: 1728
1001035322_1001035342 3 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035342 5:168292594-168292616 GTCGGGCGGGGGCGGGGGTTGGG No data
1001035322_1001035337 -5 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035337 5:168292586-168292608 GAAGAGAGGTCGGGCGGGGGCGG 0: 1
1: 0
2: 1
3: 46
4: 639
1001035322_1001035340 -2 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035340 5:168292589-168292611 GAGAGGTCGGGCGGGGGCGGGGG No data
1001035322_1001035335 -9 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035335 5:168292582-168292604 TTAGGAAGAGAGGTCGGGCGGGG No data
1001035322_1001035347 29 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035347 5:168292620-168292642 GCGACCTAGCCGGGTGAAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1001035322_1001035346 20 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035346 5:168292611-168292633 GTTGGGGGAGCGACCTAGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 98
1001035322_1001035344 5 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035344 5:168292596-168292618 CGGGCGGGGGCGGGGGTTGGGGG 0: 1
1: 3
2: 31
3: 408
4: 2576
1001035322_1001035339 -3 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035339 5:168292588-168292610 AGAGAGGTCGGGCGGGGGCGGGG 0: 1
1: 0
2: 5
3: 68
4: 609
1001035322_1001035336 -8 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035336 5:168292583-168292605 TAGGAAGAGAGGTCGGGCGGGGG 0: 1
1: 0
2: 2
3: 15
4: 177
1001035322_1001035348 30 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035348 5:168292621-168292643 CGACCTAGCCGGGTGAAGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 20
1001035322_1001035341 2 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035341 5:168292593-168292615 GGTCGGGCGGGGGCGGGGGTTGG 0: 1
1: 1
2: 38
3: 344
4: 2517
1001035322_1001035334 -10 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035334 5:168292581-168292603 TTTAGGAAGAGAGGTCGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 168
1001035322_1001035338 -4 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035338 5:168292587-168292609 AAGAGAGGTCGGGCGGGGGCGGG No data
1001035322_1001035345 19 Left 1001035322 5:168292568-168292590 CCCGCCCGCCCCCTTTAGGAAGA 0: 1
1: 0
2: 1
3: 2
4: 132
Right 1001035345 5:168292610-168292632 GGTTGGGGGAGCGACCTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001035322 Original CRISPR TCTTCCTAAAGGGGGCGGGC GGG (reversed) Intronic
900549880 1:3249183-3249205 TCCTCCTAAAGGAGGCTGGAGGG + Intronic
902289498 1:15427160-15427182 TCTTCCGCAAGGCGGCGGCCGGG + Exonic
903859725 1:26357332-26357354 TCTTCCAGGCGGGGGCGGGCAGG + Intergenic
906355778 1:45105589-45105611 ACTTCCCAGAGGGGGCGGCCAGG - Intronic
911569732 1:99508157-99508179 ACTTCCTAGATGGGGCGGCCAGG - Intergenic
911650336 1:100380920-100380942 GCTTCCTAAAGGGTGGTGGCTGG - Intronic
914908925 1:151769218-151769240 ACTTCCCAAAAGGGGCGGCCGGG + Intronic
915490774 1:156248927-156248949 TCTTCCCCAAGGGGGTGGGGAGG - Intergenic
916037429 1:160933590-160933612 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
916391356 1:164334162-164334184 TCTTCCTAAATGAGAGGGGCAGG + Intergenic
920430920 1:205918455-205918477 TCTTTCTAAAGGGGGCTTTCGGG - Intronic
921192870 1:212725196-212725218 ACTTCCCAGAGGGGGCGGCCGGG - Intergenic
1067100191 10:43329288-43329310 ACTTCCCAAACGGGGCGGCCGGG - Intergenic
1068536349 10:58244346-58244368 ACTTCCCAGAGGGGGCGGCCGGG - Intronic
1069895377 10:71677273-71677295 TATTTCTAAAGGGGGTGGGTGGG - Intronic
1074352987 10:112756269-112756291 TTTTCCAAAAGGGGTGGGGCGGG + Intronic
1084979442 11:72821553-72821575 TTTTCAGGAAGGGGGCGGGCAGG + Intronic
1084989569 11:72909989-72910011 ACTTCCTAGATGGGGCGGCCGGG - Intronic
1087821256 11:102715249-102715271 TCTGCCTGAAGGGAGGGGGCAGG - Intronic
1089700147 11:120239883-120239905 GCTTCCTAAAAAGGGCGAGCAGG + Intronic
1094073000 12:26439720-26439742 TCATCCTAAAAGGGGCTGCCAGG + Intronic
1097089351 12:56493795-56493817 ACTTCCCAGAGGGGGCGGCCGGG + Intergenic
1097089363 12:56493832-56493854 ACTTCCCAGAGGGGGCGGCCGGG + Intergenic
1097254788 12:57665226-57665248 ACTTCCTAGATGGGGCGGCCAGG - Intergenic
1098375265 12:69807594-69807616 GCTTCCTAGATGGGGCGGCCGGG + Intronic
1098375296 12:69807709-69807731 ACTTCCTAGATGGGGCGGCCGGG + Intronic
1099202175 12:79690244-79690266 TATTCCCAAAGGGGCCGGTCGGG + Exonic
1100983698 12:100185305-100185327 GCTTCCTAAAGGGGGAATGCAGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106579440 13:31004929-31004951 TCTTCCTAAAGAGGGTGAGAAGG + Intergenic
1107463155 13:40624532-40624554 TCTGACTAAAGGGGGTGGGGTGG + Intronic
1110115805 13:71815313-71815335 TCTTAAAAAAGGGGGTGGGCGGG + Intronic
1114372101 14:22100921-22100943 ACTTCCTAGACGGGGCGGCCGGG + Intergenic
1116409188 14:44601669-44601691 ACTTCCCAGAGGGGGCGGCCGGG - Intergenic
1117047612 14:51828809-51828831 TGTTCCTGAAGGGTGAGGGCAGG - Intronic
1118430857 14:65717472-65717494 ACTTCCTAGACGGGGCGGCCGGG + Intronic
1118739767 14:68731095-68731117 TTTTCCCAAAGGGGGAGGGGTGG + Intergenic
1126506442 15:49409284-49409306 TTTTCATAAAGGGGGTGGGGAGG - Intronic
1127606296 15:60591764-60591786 ACTTCCGAAAGCGCGCGGGCCGG - Intronic
1127800280 15:62471816-62471838 TCTTCCCAAAGGCTGCAGGCAGG + Intronic
1128087073 15:64893966-64893988 TCTTCCTGAAGGGGAAGGGTGGG + Intronic
1131907030 15:97153911-97153933 TCTGCCTGAAGTGGGCAGGCAGG - Intergenic
1134627010 16:15729431-15729453 TCTTCCCAAAGAGGCCTGGCTGG + Intronic
1136779432 16:32887115-32887137 TCTTCCTAAAGCTGGAGGGATGG - Intergenic
1136891185 16:33974403-33974425 TCTTCCTAAAGCTGGAGGGATGG + Intergenic
1137506487 16:49058215-49058237 TCTTCCTAGAGGTGGCTTGCAGG + Intergenic
1137743502 16:50803629-50803651 TCTTCCTCAAGGGACTGGGCTGG - Intergenic
1138307300 16:55989318-55989340 GCTTCCCAAACGGGGCGGCCGGG - Intergenic
1139372964 16:66479933-66479955 TCTGCCTGAGGGGGGCTGGCAGG - Intronic
1139563284 16:67757264-67757286 TCTGCCCAAAGGGAGCGGGTAGG + Intronic
1203081848 16_KI270728v1_random:1149203-1149225 TCTTCCTAAAGCTGGAGGGATGG - Intergenic
1143041053 17:4036852-4036874 TCTTCCCAGTGCGGGCGGGCGGG - Intronic
1149655877 17:58309356-58309378 TCTCACAAAAGGGGTCGGGCTGG + Exonic
1151022800 17:70638415-70638437 TCTACCTAAAGGGTCCCGGCTGG - Intergenic
1154003474 18:10506347-10506369 TCCTCCCAGAGGGGGCGGCCGGG + Intergenic
1154003588 18:10506763-10506785 TCCTCCCAGAGGGGGCGGCCGGG + Intergenic
1154192696 18:12243587-12243609 ACTTCCTAGATGGGGCGGCCGGG - Intergenic
1160505294 18:79423408-79423430 TCTTCCCAAAGGCGGCGTCCTGG + Intronic
1165947534 19:39453338-39453360 TCTACCTACAGGGGTCAGGCAGG - Exonic
1167913306 19:52721070-52721092 ACTTCCTAGACGGGGCGGCCAGG + Intronic
924998089 2:382346-382368 GCTTCCTAAACGGGGAGGCCTGG + Intergenic
927277338 2:21273097-21273119 TTTTCCTAAAGGGGGCAGACAGG + Intergenic
927443356 2:23135877-23135899 TCTTCCTAAAAGTGGAGGGGAGG - Intergenic
927737483 2:25535829-25535851 TCCTCCCAAACGGGGCGGCCGGG + Intronic
930867523 2:56136573-56136595 TCATCTCAAAGGTGGCGGGCGGG - Intergenic
931554307 2:63483184-63483206 TCTTACTATAGGTGGCAGGCTGG + Intronic
933868285 2:86544943-86544965 ACTTCCTAGACGGGGCGGCCGGG + Intronic
938598552 2:132813479-132813501 TCTTCCTAAAAGGGGTGGCTGGG + Intronic
942277897 2:174336089-174336111 TCTTCCTAGAGTGGGTGGGATGG - Exonic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
948904537 2:240972337-240972359 TGTTCCTGAAGTGGGCGGGGTGG + Intronic
1169420191 20:5453130-5453152 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG + Intronic
1171194559 20:23187100-23187122 TCTTCCTGAGGGTGGCTGGCAGG + Intergenic
1171389257 20:24790630-24790652 GCTCCCTAAAGGGCTCGGGCAGG - Intergenic
1173150617 20:40563651-40563673 TCATCCTAAAGGCAGCGGCCAGG + Intergenic
1173994551 20:47327720-47327742 TCTACCCAAAGTGGGCAGGCGGG - Intronic
1174386337 20:50190442-50190464 TCCTCCAGCAGGGGGCGGGCCGG + Intergenic
1176797545 21:13380807-13380829 ACTTCCCAGAGGGGGCGGCCGGG - Intergenic
1176852820 21:13935550-13935572 TCTTCCAAGACGGGGCGGCCAGG + Intergenic
1178840803 21:36136105-36136127 TCTTCCTTAAGGAGAGGGGCGGG + Intronic
1179597390 21:42452071-42452093 GCTTCCTGGAGGGGGTGGGCTGG - Intergenic
1184256855 22:43291986-43292008 TCTTCCTAGAGTGGGGGGTCTGG - Intronic
1185218356 22:49616421-49616443 TCTCCCTAAAGGTGGGGAGCAGG + Intronic
964485292 3:157179477-157179499 GCTTCCTAGACGGGGCGGCCGGG + Intergenic
966659084 3:182394107-182394129 TCTTGCTTAAGGGGACAGGCAGG + Intergenic
968511112 4:996353-996375 TCTCCCTAAAGGAGGCAGGGAGG + Intronic
974848619 4:67380817-67380839 ACTTCCTAGACGGGGCGGCCAGG - Intergenic
975927597 4:79477235-79477257 TCTTCCTGAAGGTGGAGGGTGGG - Intergenic
986848356 5:11781419-11781441 GCTTCCTAAAGGGCGGAGGCTGG - Intronic
988477068 5:31596124-31596146 TCTTTCAAAAGGGGGGAGGCCGG - Intergenic
988532694 5:32040354-32040376 ACTTCCTAGACGGGGCGGCCAGG - Intronic
997433562 5:133858110-133858132 ACTTCCTAGACGGGGCGGCCAGG + Intergenic
999309836 5:150544930-150544952 TCTGCCTCTAGGGGGCGAGCTGG - Intronic
1001035322 5:168292568-168292590 TCTTCCTAAAGGGGGCGGGCGGG - Intronic
1002222737 5:177696018-177696040 ACTTCCTAGATGGGGCGGCCGGG + Intergenic
1002222779 5:177696174-177696196 ACTTCCTAGATGGGGCGGCCGGG + Intergenic
1008803126 6:55394332-55394354 TCTTACTTAAGGGGAGGGGCAGG + Intronic
1008965727 6:57311382-57311404 ACTTCCCAGAGGGGGCGGCCAGG + Intergenic
1008965767 6:57311535-57311557 ACTTCCTAGAGGGGGCGGCGGGG + Intergenic
1017855628 6:158348783-158348805 ACTTCCTATACGGGGCGGCCGGG + Intronic
1022683582 7:32573320-32573342 TCTTCCTAGATGGCACGGGCTGG + Exonic
1023393621 7:39732954-39732976 TTTTCCTAACGGGGGAGGGTGGG - Intergenic
1025260188 7:57413391-57413413 CCTTCCCAAGGGGGGTGGGCTGG - Intergenic
1026185873 7:68082291-68082313 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1026185946 7:68082551-68082573 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1026186088 7:68083113-68083135 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1026186147 7:68083337-68083359 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1028548171 7:92027127-92027149 ACTTCCTAGATGGGGCGGCCAGG - Intronic
1032179585 7:129663633-129663655 ACTTCCCAGACGGGGCGGGCGGG + Intronic
1033185698 7:139225622-139225644 ACTTCCTAGACGGGGCGGCCAGG - Intergenic
1039862329 8:41469450-41469472 TCTTCCTAAAGGGTGTGGTCTGG + Intergenic
1040834669 8:51719091-51719113 ACTTCCTAGAAGGGGCGGCCGGG - Intronic
1043823401 8:84896077-84896099 GCATCCTCAAGGGGGAGGGCAGG - Intronic
1046703629 8:117427042-117427064 ACTTCCTAAATGGGGCAGCCAGG - Intergenic
1046703702 8:117427306-117427328 GCTTCCTAGACGGGGCGGCCGGG - Intergenic
1046958297 8:120083912-120083934 TCTTTCTAAAGAGGGCAGGTAGG + Intronic
1049234642 8:141506500-141506522 TCCCCATAGAGGGGGCGGGCAGG + Intergenic
1049578130 8:143398854-143398876 TCTTCCCAGAGGGTGTGGGCAGG + Intergenic
1050417581 9:5433142-5433164 ACTTCCCAGAGGGGGCGGCCAGG - Intronic
1052259243 9:26493212-26493234 TCTTCCCAGACGGGGCGGTCGGG - Intergenic
1054846018 9:69799591-69799613 ACTTCCTAGACGGGGCGGCCGGG - Intergenic
1057838271 9:98464353-98464375 ACTTCCCAGAGGGGGCGGCCAGG - Intronic
1058049724 9:100393290-100393312 ACTTCCCAGAGGGGGCGGCCGGG - Intergenic
1058861374 9:109120144-109120166 TCTTCCTGGAGGGGGGGGGGGGG + Intergenic
1062212041 9:135370418-135370440 GCTTCCTACAGGGGGTGGGGCGG + Intergenic
1062354057 9:136153583-136153605 CCTTCCAGAAGGGGGCGGCCAGG - Intergenic
1185996338 X:4954055-4954077 TCTACCTGAAGGGGGTGGGTAGG + Intergenic
1187215860 X:17275694-17275716 ACTTCCTAGATGGGGCGGCCGGG + Intergenic
1190232506 X:48593198-48593220 TCTTCCTAAATGGGGTGAGTGGG - Intronic
1191068869 X:56380032-56380054 ACTTCCCAGAAGGGGCGGGCGGG + Intergenic
1191645399 X:63475305-63475327 ACTTCAAAAAGGGGGTGGGCTGG - Intergenic
1192349989 X:70349184-70349206 ACTTCCCAGAGGGGGCGGCCGGG + Intronic
1192663630 X:73068050-73068072 ACTTCCCAGAGGGGGCGGCCAGG - Intergenic
1192663921 X:73069066-73069088 ACTTCCCAAATGGGGCGGCCAGG - Intergenic
1195119866 X:101738940-101738962 ACTTCCTAGACGGGGCGGCCGGG - Intergenic