ID: 1001037852

View in Genome Browser
Species Human (GRCh38)
Location 5:168310727-168310749
Sequence TTGTGGAATGCTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6921
Summary {0: 1, 1: 1, 2: 22, 3: 412, 4: 6485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001037847_1001037852 -6 Left 1001037847 5:168310710-168310732 CCTGTGGTTCCATCATCTTGTGG 0: 1
1: 0
2: 1
3: 19
4: 245
Right 1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG 0: 1
1: 1
2: 22
3: 412
4: 6485
1001037845_1001037852 13 Left 1001037845 5:168310691-168310713 CCAGGCATAGTAGTGCATGCCTG 0: 18
1: 532
2: 6503
3: 20656
4: 62636
Right 1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG 0: 1
1: 1
2: 22
3: 412
4: 6485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001037852 Original CRISPR TTGTGGAATGCTGAGGTGGA AGG Intronic
Too many off-targets to display for this crispr