ID: 1001039632

View in Genome Browser
Species Human (GRCh38)
Location 5:168324938-168324960
Sequence AGGTGTCTACACATTTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001039632_1001039635 12 Left 1001039632 5:168324938-168324960 CCATCCTAAATGTGTAGACACCT 0: 1
1: 1
2: 3
3: 11
4: 121
Right 1001039635 5:168324973-168324995 CAAATACCTGAATAAATGACTGG 0: 1
1: 0
2: 0
3: 33
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001039632 Original CRISPR AGGTGTCTACACATTTAGGA TGG (reversed) Intronic
902829594 1:19003123-19003145 AGGTGCATACATATTTAGAAGGG - Intergenic
908936262 1:69380536-69380558 AGGTGTCTACATCTTTAGTTAGG - Intergenic
909322512 1:74307588-74307610 AGGTGAATATATATTTAGGATGG - Intronic
909487816 1:76193224-76193246 GGGTGGCTACACATGAAGGAAGG - Intronic
913078014 1:115357785-115357807 AAGTTTCCACACAGTTAGGATGG - Intergenic
916279150 1:163029483-163029505 AGGAGTCTACAGATTTAGGTAGG - Intergenic
916772769 1:167929060-167929082 AAATGTCTATACATTTAGGCCGG + Intronic
916969805 1:170000449-170000471 AGGTGTCTTTACATTTATTACGG + Intronic
918147236 1:181767517-181767539 AGGTGGCAACACAGTTGGGAAGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920694257 1:208169925-208169947 AAAAGTCTAGACATTTAGGAAGG - Intronic
920748982 1:208656259-208656281 AGGTGTCTACCCATCTAGGCTGG + Intergenic
921790535 1:219285026-219285048 TAGTGTCTACACAGTTAAGAAGG + Intergenic
1068494546 10:57770329-57770351 GGGTATTTACACACTTAGGATGG - Intergenic
1069053030 10:63814497-63814519 TGGTGCCTATATATTTAGGATGG + Intergenic
1072018101 10:91369982-91370004 ACTTGTAAACACATTTAGGAAGG - Intergenic
1076730570 10:132436912-132436934 ATGTGTCTTCTCATTTCGGAGGG + Intergenic
1077951058 11:6957522-6957544 AGCTATATACACATTTAAGACGG - Exonic
1079197219 11:18339948-18339970 AGGAATCTATACTTTTAGGATGG - Intronic
1081376272 11:42362348-42362370 AGGTCACTAATCATTTAGGAGGG - Intergenic
1088354218 11:108925194-108925216 AGGTTGCTACACATTGGGGAAGG + Intronic
1092753948 12:11745468-11745490 AGATGTCTTCAAATATAGGAAGG - Intronic
1094666140 12:32523014-32523036 AGCTATCTGGACATTTAGGAAGG + Intronic
1095805104 12:46310747-46310769 AGGTGTATATATATTTAGGATGG + Intergenic
1097431738 12:59517316-59517338 AGATGTATACACGTTTAGAATGG - Intergenic
1097619126 12:61918817-61918839 AGGAGTCTTTACATTTAGCAAGG + Intronic
1099473741 12:83082769-83082791 ATGTCTCTATAAATTTAGGAAGG - Intronic
1099733968 12:86542423-86542445 TGGTGTCTACACAGTTAGAGTGG - Intronic
1100920821 12:99484675-99484697 AGGTGTATATATATTTAGGATGG + Intronic
1103071323 12:117945022-117945044 AAGTGTGTACACATTTAGGATGG - Intronic
1107168767 13:37315205-37315227 GGGTGTATATATATTTAGGATGG + Intergenic
1109066236 13:57696417-57696439 ATTTCTCTACACATTTAAGATGG - Intronic
1111738385 13:92171396-92171418 AGGAGATTATACATTTAGGAAGG - Intronic
1114952750 14:27777566-27777588 AGCTGTCTACATATTGAGTAAGG - Intergenic
1116328685 14:43568046-43568068 AGGTGTCTACATTTCTAGAATGG - Intergenic
1116648736 14:47563426-47563448 AGGTGCATATATATTTAGGATGG + Intronic
1117685954 14:58253378-58253400 AGGTGTCTTTTCATTTAGAAAGG - Intronic
1117711514 14:58534122-58534144 AGAAGTCTTCATATTTAGGAAGG + Intronic
1120596537 14:86445967-86445989 AGATGTCTCCACAGTTTGGATGG - Intergenic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1123817162 15:23991801-23991823 AGGTGACTACACATTTCTGGGGG + Intergenic
1125404169 15:39335562-39335584 AGGTGCCTTAACATTTAGGAAGG - Intergenic
1130997999 15:88914951-88914973 AGGTCTCAACACAGCTAGGAGGG - Intergenic
1131919436 15:97307901-97307923 AAGTGCCTAAACATTAAGGATGG + Intergenic
1131984156 15:98024388-98024410 AGGTGTCTGCATATCTAGAAGGG - Intergenic
1132011468 15:98280279-98280301 AGGTGTGTGGACTTTTAGGAAGG - Intergenic
1134364967 16:13568713-13568735 AGCTATCTCCACCTTTAGGAAGG + Intergenic
1135564271 16:23499807-23499829 AGGTTTCTACACTGTGAGGAAGG - Intronic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1138933382 16:61689295-61689317 AGGTATTTACACATGTAAGATGG + Intronic
1143440933 17:6973081-6973103 AGGTGGCTGCACATGTAGGCTGG - Intronic
1149665176 17:58360197-58360219 AGGGGTCCACACAGTTACGATGG + Exonic
1150705843 17:67486710-67486732 AAGTGTCTATGCATTTAGGGCGG + Intronic
1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG + Intronic
1157481692 18:48059410-48059432 AGTTGTCTGCATACTTAGGAGGG - Intronic
1162095180 19:8306041-8306063 AGGAGCTGACACATTTAGGATGG - Intronic
1163360574 19:16843571-16843593 TGGGGTCATCACATTTAGGAAGG + Intronic
1168704317 19:58460068-58460090 AGGTGACTAGAGATTTATGAAGG + Intergenic
925715228 2:6778927-6778949 AGGTATCTATCCATTTTGGAGGG + Intergenic
931968968 2:67565030-67565052 GGCTGTCTACACATATAGGCAGG - Intergenic
933729394 2:85445815-85445837 AGATGTCCACAAACTTAGGAAGG + Intergenic
939223116 2:139328881-139328903 AGGTGGCTGTATATTTAGGATGG - Intergenic
939845413 2:147239349-147239371 AGGTACATACACATTTAAGATGG + Intergenic
942405531 2:175650005-175650027 AGGTGCATATACATTTAGGATGG - Intergenic
942743832 2:179209174-179209196 AGGTGCATATATATTTAGGATGG - Intronic
945280437 2:208030643-208030665 AGATGTCCCCACATGTAGGAGGG - Intergenic
945878866 2:215306062-215306084 AGGTAGCTGCACCTTTAGGAAGG - Intergenic
1171076273 20:22127474-22127496 AGGAGTCTACACATTTAAACAGG - Intergenic
1172353740 20:34264280-34264302 AGGTATCTTCACAATTATGATGG - Intronic
1174896900 20:54459039-54459061 AGGTCTCTACAGAATGAGGAGGG + Intergenic
1175654161 20:60754079-60754101 TGCTGGCTCCACATTTAGGAAGG + Intergenic
1176106216 20:63389710-63389732 AGCTGACTACACATTTAGGATGG - Intergenic
1182970997 22:34576441-34576463 AGGTCAGTACACATTTAGGGTGG + Intergenic
1184270724 22:43381290-43381312 AGATATCTCCACCTTTAGGATGG + Intergenic
952114025 3:30158158-30158180 AGGTGATGACACATTGAGGATGG + Intergenic
954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG + Intronic
958020805 3:87993443-87993465 AGTTGTTTACACAGTTATGATGG + Exonic
962211587 3:133483702-133483724 AGTTGACTACATATTTTGGAAGG + Intergenic
963123956 3:141798175-141798197 AGGTGTCCAGACATTGGGGAAGG - Intronic
965278177 3:166715021-166715043 AGTTGTATATACATTTCGGAGGG + Intergenic
966601447 3:181779284-181779306 ATGTGTCTTCACATTTGGAAGGG + Intergenic
967285175 3:187862231-187862253 AGGTATCTACACATGTACCATGG - Intergenic
967864237 3:194177261-194177283 ATGTTACTACACATTTAGAATGG - Intergenic
972337971 4:38125166-38125188 AAGTTTCTACATATCTAGGATGG - Intronic
975066382 4:70069956-70069978 AGTTGGCTACAAATTTAAGAAGG - Intergenic
976395706 4:84552865-84552887 AGGTGTATATATATTTAAGATGG - Intergenic
981171688 4:141632637-141632659 TGGTGCCTACACATTAAGGGTGG - Intergenic
982457582 4:155628609-155628631 AGGTGGATACACATTTAGGTTGG + Intergenic
983636687 4:169904895-169904917 AGGTGTCTACTAATGTAGTAGGG + Intergenic
983749692 4:171251014-171251036 AGGTGCATAAATATTTAGGATGG + Intergenic
989259549 5:39403797-39403819 AGGTGGGTACAAAATTAGGATGG - Intronic
991025013 5:62019753-62019775 ATGTGTCTTCACATTGCGGAAGG - Intergenic
992532878 5:77669592-77669614 AGATGTCTACAAAATTGGGAAGG + Intergenic
996590349 5:125139728-125139750 GGGTGTAGACACATTTAGGTAGG + Intergenic
997354773 5:133255205-133255227 ATGTGTCTACACACTGAGGCTGG + Intronic
998292752 5:140930618-140930640 AGGTGTGTAGAAATTAAGGAAGG + Intronic
999120474 5:149205886-149205908 ATGTGTCTGCAAATCTAGGAAGG - Intronic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1001564359 5:172689947-172689969 AGGGGTGTCCACAGTTAGGAAGG + Exonic
1005365219 6:25069807-25069829 AGTTGTCTCCATTTTTAGGAAGG - Intergenic
1009895093 6:69739092-69739114 AGGTGTTTATACAACTAGGAGGG + Intronic
1011373262 6:86663413-86663435 AGGTGCCTATATATTTAGGATGG + Intergenic
1011838022 6:91457879-91457901 AGGTGTCAACATATTAATGAAGG + Intergenic
1013336157 6:109164694-109164716 TGTTTTCTATACATTTAGGAAGG + Intergenic
1013941634 6:115670384-115670406 AGGTTTCTACCTATTTGGGAGGG - Intergenic
1014877228 6:126675868-126675890 GGGTGCATATACATTTAGGATGG - Intergenic
1017923391 6:158890209-158890231 AAGTGCACACACATTTAGGATGG + Intronic
1019005597 6:168794034-168794056 AGCTGTGTGCACATTTAGCAAGG + Intergenic
1024008049 7:45241732-45241754 TGGGGTCCACACATTAAGGATGG + Intergenic
1024363614 7:48495746-48495768 ATGTGTGTACACATTTGGCATGG + Intronic
1030536391 7:110772212-110772234 TGGAGTCTACACATTGAGAATGG + Intronic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1032918758 7:136522060-136522082 AGGTGTCCCCTCATTTAGTAAGG - Intergenic
1035160894 7:156949497-156949519 AGGTGCCTTCACATTTAAAAGGG - Intergenic
1035831767 8:2702567-2702589 ATGTGGCTACACATTTAGCTTGG + Intergenic
1038471932 8:27831375-27831397 AGGTACATACACATTTAGGATGG - Intronic
1038682451 8:29681523-29681545 ATATGTGTACACATTTATGAGGG + Intergenic
1040758658 8:50810956-50810978 TGGTGTCTAAACATTTATCATGG + Intergenic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1042541341 8:69909970-69909992 GGGTGCGTATACATTTAGGAAGG - Intergenic
1043626309 8:82264193-82264215 ACGTGCTTACACATTAAGGATGG + Intergenic
1043667009 8:82826822-82826844 AGGTCTCCCCACATTCAGGAGGG + Intergenic
1047335196 8:123929298-123929320 AAGTGTTTTCACATTTAGGTGGG + Intronic
1049858554 8:144880946-144880968 AGGACTCCACACACTTAGGATGG + Exonic
1050489559 9:6173436-6173458 AGGTTTCTGCACATGTGGGATGG - Intergenic
1050839274 9:10126697-10126719 AGCTGTCTAGATATTTAGAAGGG + Intronic
1060398008 9:123329639-123329661 AGGTGTCACCACAATAAGGAGGG + Intergenic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1188729220 X:33625812-33625834 TTGTGTTTACTCATTTAGGAAGG - Intergenic
1189629810 X:42941075-42941097 AGGTGATTATACATTTGGGAAGG - Intergenic
1191633901 X:63354987-63355009 AGGTGTCAGCAAATTTGGGATGG + Intergenic
1191999419 X:67132641-67132663 AGGTCTCTAGATTTTTAGGAAGG + Intergenic
1192866150 X:75134277-75134299 AGGTGCATATATATTTAGGATGG - Intronic
1193591856 X:83398223-83398245 GGGTGTATATATATTTAGGATGG - Intergenic
1194930638 X:99882971-99882993 AGGTGCATATATATTTAGGATGG - Intergenic
1197507701 X:127328509-127328531 AGATTTCTACACATTTTTGATGG - Intergenic