ID: 1001040604

View in Genome Browser
Species Human (GRCh38)
Location 5:168332230-168332252
Sequence CTGATGACTCAGAGCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001040604 Original CRISPR CTGATGACTCAGAGCTGAGA AGG Intronic
900300464 1:1974333-1974355 TGGGTGACTCAGAGCGGAGATGG - Intronic
904251458 1:29227570-29227592 TTGAGGATTCAGACCTGAGAAGG + Intronic
904315987 1:29663815-29663837 CTGATTACACATGGCTGAGAGGG + Intergenic
905657321 1:39692960-39692982 CCCAAGACCCAGAGCTGAGAAGG - Intronic
905793810 1:40804094-40804116 CTGCTGACTCAGAGGACAGAAGG + Intronic
905917987 1:41699116-41699138 CTGCTGACTCAGCCCTGCGATGG - Intronic
906687086 1:47769719-47769741 CTGTTGACTCAGAGCCGATGCGG - Intronic
907131246 1:52099193-52099215 CTGAGGAGTCAGAGATGAGTTGG + Intergenic
909247213 1:73301352-73301374 GTGATGACTCAGAGATATGATGG + Intergenic
913591408 1:120331131-120331153 CTGATGACTTACAGCTGGAAAGG + Intergenic
913651952 1:120923970-120923992 CTGATGACTTACAGCTGGAAAGG - Intergenic
914169151 1:145205100-145205122 CTGATGACTTACAGCTGGAAAGG + Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914524272 1:148449058-148449080 CTGATGACTTACAGCTGGAAAGG + Intergenic
914599404 1:149186815-149186837 CTGATGACTTACAGCTGGAAAGG - Intergenic
914642133 1:149618077-149618099 CTGATGACTTACAGCTGGAAAGG - Intergenic
915236173 1:154484540-154484562 CTGATGACTCATATGTGATAAGG - Intronic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
917494208 1:175525361-175525383 CTGATCAGTCAGAGCTCAAATGG - Intronic
918872206 1:189989924-189989946 CTGATCACTGGGAGCTGAGGCGG + Intergenic
920144977 1:203852231-203852253 CTGTTGAGGCAGAGCTGAGTCGG - Exonic
920495909 1:206454756-206454778 CTGCTGCCTCAGAGCTGTGTGGG + Intronic
921327739 1:214004209-214004231 CAGCAGACTCAGAGCTGGGATGG - Intronic
921820331 1:219609773-219609795 CTGTTGAGGCAGAGCTGAGTCGG + Intergenic
1063629872 10:7723362-7723384 CTGGGGACTCAGAGAAGAGAGGG - Intronic
1064267896 10:13839797-13839819 GTGATGACTCAGGTCTGAGCCGG + Intronic
1064432764 10:15285496-15285518 GTGATAACCCAGAACTGAGATGG + Intronic
1064931989 10:20638631-20638653 CTGATGATTCAGAAGTGAGAGGG + Intergenic
1065487433 10:26248698-26248720 CTCATCACCCAGAGCTGAGTGGG - Intronic
1067905636 10:50287982-50288004 GTGATGACACAGAGCTGGCAAGG + Intergenic
1070277122 10:75017991-75018013 CTCATGAGTCAGAGAGGAGAGGG + Intronic
1070554725 10:77518687-77518709 TTCATGACTTAGAGCTGAGAGGG + Intronic
1070646270 10:78204379-78204401 CTGAGGCCTCAGAGGTGGGAGGG - Intergenic
1071348669 10:84717362-84717384 CTGATGACGCAGGGCTGAGAAGG - Intergenic
1072730700 10:97844330-97844352 CTGATGATTCAGAAAAGAGAGGG - Intergenic
1074632351 10:115272672-115272694 ATGCTGACTCAGAGCTTATATGG + Intronic
1075069706 10:119312871-119312893 CTGAGGACACAGAGCTGGCAAGG - Intronic
1075182093 10:120220587-120220609 CTGAAGCCTCAGAGCTGACTTGG - Intergenic
1075676507 10:124299617-124299639 CTGATGAGCCAGTGCTGAGAAGG + Intergenic
1075973584 10:126675260-126675282 CTGATGATACAGAGATGAAAGGG + Intergenic
1076482802 10:130795945-130795967 CAGATGACTCAGGGCTGCCAGGG + Intergenic
1076575252 10:131461572-131461594 GGGCTGGCTCAGAGCTGAGAGGG - Intergenic
1076625187 10:131817434-131817456 GTGGTGACTCAGAGCTGAAGGGG + Intergenic
1077262016 11:1627484-1627506 CTGATGCCGCACAGCAGAGAAGG - Intergenic
1077731277 11:4732628-4732650 GTGATTGCTCAGGGCTGAGAGGG - Intronic
1078715817 11:13838154-13838176 ATGATGACCCAGAGGTCAGAAGG - Intergenic
1079105381 11:17568876-17568898 CTAAAGACACAGAGCAGAGATGG - Intronic
1081590714 11:44421211-44421233 CTCATCCCTCAGAGCTGAAAAGG + Intergenic
1082117704 11:48345587-48345609 CTGAGGACTCATAGCTCTGAAGG - Intergenic
1082669034 11:56010938-56010960 CTGATAACCCAGAGCTGGGAGGG + Intergenic
1082892508 11:58155133-58155155 CTGAAGACTCAGGGAAGAGATGG + Intronic
1083871824 11:65493037-65493059 CTGGTGATTCAGGGCTGTGATGG + Intergenic
1084903263 11:72326310-72326332 CTGATGACTCAGTGGTGTCATGG + Intronic
1086206067 11:84259397-84259419 GTGATGACTTAGAGCTGGGCTGG - Intronic
1087043017 11:93820021-93820043 CTGCTGCCTCAGAGCAGAGGTGG - Exonic
1087611095 11:100434873-100434895 CTTATGTCTCAGAGCTTAAATGG - Intergenic
1087843169 11:102940917-102940939 CTGATCTCTCAGAGGTGAGTCGG - Intergenic
1090421347 11:126577403-126577425 CTGATAACTCAGAGTGGGGAGGG + Intronic
1091309574 11:134562998-134563020 CTGATGCCAGGGAGCTGAGAGGG - Intergenic
1092819886 12:12343711-12343733 CTTCTAACTCAGAGCGGAGAGGG + Intronic
1095348729 12:41185041-41185063 GGCATGACTCAGAGCTGGGATGG + Intergenic
1096103637 12:48984122-48984144 GTGAGGAATCAGAACTGAGATGG - Intergenic
1096189167 12:49603877-49603899 GGGATGACTCTGAGCTGAGTGGG + Intronic
1099061363 12:77914025-77914047 CTCATGGCTCAGAGGTGAGGGGG - Intronic
1100497184 12:95136544-95136566 CTTTTAACTCAGAGCTGTGAGGG - Intronic
1100667449 12:96770349-96770371 CTGATCACTGAAATCTGAGAAGG + Intronic
1100669374 12:96794199-96794221 CTGATGACTATGTGCTTAGATGG + Intronic
1100885235 12:99062755-99062777 ATGAGGACTCAGGGTTGAGAAGG + Intronic
1101337964 12:103813510-103813532 CAGATAACTAAGAGCTGAGGGGG + Intronic
1101579885 12:106033077-106033099 CTGATGCCTCTTAGCTGGGAGGG - Intergenic
1101951452 12:109179337-109179359 TTCCTGACTCTGAGCTGAGACGG - Intronic
1103308709 12:119988516-119988538 CTGATGACTCAGGGATATGAAGG - Intergenic
1103447048 12:121001321-121001343 CTGATGCATCAGAGCAGAGTGGG - Exonic
1104542186 12:129676098-129676120 CTGCTCACACAGAGCTCAGAAGG + Intronic
1104546890 12:129721252-129721274 CTGATGACTTGGTGATGAGAGGG - Intronic
1104781602 12:131424232-131424254 CTGAGAACTCAAAGCTGAGAAGG + Intergenic
1106505708 13:30368917-30368939 CTGAAGCCTCAGAGAAGAGATGG - Intergenic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1108111803 13:47081835-47081857 CAGATGATTCAGAACTCAGATGG - Intergenic
1110306989 13:73999784-73999806 CTGATGAGTCAAAGGAGAGAGGG - Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1112285894 13:98104211-98104233 CAGATGACACAGAGATGGGAAGG + Intergenic
1114665039 14:24372694-24372716 CTGCAGGGTCAGAGCTGAGAGGG - Intronic
1116613927 14:47109617-47109639 ATGAATACTCAGAGCTTAGATGG - Intronic
1119666470 14:76488676-76488698 CTGGGAACTCAGAGCTGGGATGG + Intronic
1120980078 14:90281430-90281452 CTTATGACTCAGACCTGAGCTGG + Intronic
1121641969 14:95490877-95490899 CGGATGATGCAGAGCTGAGTGGG - Intergenic
1121820543 14:96962304-96962326 CTGGTGTCTCTGAGATGAGAAGG + Intergenic
1123411963 15:20067961-20067983 CTCATTTCTCAGAGCTGAGAGGG - Intergenic
1123521307 15:21075080-21075102 CTCATTTCTCAGAGCTGAGAGGG - Intergenic
1123578392 15:21695162-21695184 CTCATTTCTCAGAGCTGAGAGGG - Intergenic
1123615017 15:22137644-22137666 CTCATTTCTCAGAGCTGAGAGGG - Intergenic
1124077684 15:26461616-26461638 CTGTTGAAACAGAGCTCAGAGGG + Intergenic
1124162058 15:27280475-27280497 CAGCTAACTCAGTGCTGAGAGGG - Intronic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1126148348 15:45499145-45499167 CTCAGGAAGCAGAGCTGAGATGG - Intronic
1126482866 15:49145915-49145937 GTAATGACTTAAAGCTGAGAAGG - Intronic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1128580269 15:68805104-68805126 CTGATGCCTCTGACCAGAGATGG - Intronic
1128767874 15:70262060-70262082 CTGATGGCCTAGAGGTGAGAAGG - Intergenic
1131248551 15:90816604-90816626 CTGGGGACTCAGTCCTGAGAGGG + Intergenic
1202987262 15_KI270727v1_random:429407-429429 CTCATTTCTCAGAGCTGAGAGGG - Intergenic
1133345385 16:5066191-5066213 CTGGAGAATCAGGGCTGAGAAGG - Intronic
1137842968 16:51657023-51657045 CTGATGAAGCAGAGCTCAGAAGG + Intergenic
1138353533 16:56359959-56359981 CTAATGACTCAGAGCTCTTAAGG + Intergenic
1138551481 16:57751252-57751274 CTGATGTCCCAGAGCTGTGGGGG - Exonic
1138952324 16:61928400-61928422 CTCATGTCTTAGAGCTGACAAGG - Intronic
1139131003 16:64144975-64144997 CTGAAGACTCTCAGCTGAGCTGG - Intergenic
1139471702 16:67181353-67181375 CAGATGGCTCAGAGGAGAGAGGG - Intronic
1140273932 16:73491852-73491874 CTGACGATTCACAGTTGAGATGG - Intergenic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1141548795 16:84790463-84790485 CTGATGACTCAGTGAGTAGATGG - Intergenic
1142941381 17:3382412-3382434 CTGAAGTCTCTGGGCTGAGATGG + Intergenic
1143028265 17:3953475-3953497 CTGCCCACTCAGAGCTGGGATGG + Intronic
1143106446 17:4532792-4532814 CTGCTGTCTCAGTGCTGGGAGGG + Intronic
1143757457 17:9077336-9077358 CAGATAAATCAGAGGTGAGAGGG + Intronic
1147158084 17:38554913-38554935 CTGATGACACAGAGCTTTAAGGG - Intronic
1147324173 17:39662540-39662562 CTCAGGACTCAGAGGTAAGAAGG - Intronic
1154027667 18:10723860-10723882 CAGATGGCTCAGAGGAGAGAGGG + Intronic
1155909461 18:31491761-31491783 CTTATGACTCAGAGAGGTGAAGG - Intergenic
1157435872 18:47668628-47668650 CTAATGATTTAAAGCTGAGAGGG + Intergenic
1157993589 18:52527638-52527660 CTGCAGACTGAGAGATGAGATGG - Intronic
1158023345 18:52869316-52869338 CTGATAACTCTCAGCAGAGAGGG + Intronic
1158763965 18:60425369-60425391 CTGATGGCACATAGATGAGATGG - Intergenic
1158999055 18:62954160-62954182 GAGATAACTCATAGCTGAGAAGG - Intronic
1160097667 18:75890108-75890130 CTGAGAGTTCAGAGCTGAGAAGG - Intergenic
1160237454 18:77097372-77097394 CAGGTGACTGATAGCTGAGAGGG - Intronic
1161053248 19:2176552-2176574 CAGATGACTCACAGGTGTGAGGG - Intronic
1162109544 19:8392614-8392636 CTGATGAGGCACAGCTGTGAAGG - Intronic
1162979018 19:14226531-14226553 GTGATGACCCAGAACTGAGCTGG + Intergenic
1164030248 19:21397168-21397190 CTGAGGACACAGAGCAGTGAAGG - Exonic
1166729300 19:45049599-45049621 CTGCTGGCTGAGGGCTGAGATGG + Intronic
1166780274 19:45338637-45338659 CTGATGACCCAGAGTTGGCAGGG + Intronic
1166823401 19:45594636-45594658 ATGAGGACTGAGAGCAGAGATGG - Intronic
1167163417 19:47781778-47781800 CTGATGAGTCAGAGGTGTGCAGG + Intronic
1167612152 19:50512781-50512803 CTGGTCACTTAGAGCTGAGGGGG + Exonic
1167707003 19:51086988-51087010 CTGAAGACTCACAGCTCAGGGGG + Intergenic
925225606 2:2181945-2181967 CTGAGGTCACAGAGCTGGGATGG + Intronic
925296047 2:2778200-2778222 CTGGAGACCCAGCGCTGAGAAGG + Intergenic
925803365 2:7624659-7624681 CTGATGAGGCAGTGCTGGGAAGG - Intergenic
927041558 2:19235780-19235802 GTCTGGACTCAGAGCTGAGAAGG + Intergenic
929087494 2:38182908-38182930 CTCAGAACTCAGAGCAGAGAAGG - Intergenic
929226067 2:39512827-39512849 CTGATGACTCAAATCTAGGAAGG + Intergenic
931179225 2:59883122-59883144 GTGGGGTCTCAGAGCTGAGAGGG - Intergenic
931375922 2:61708247-61708269 CAAATGACTCAGATCAGAGAAGG + Intergenic
932400902 2:71480677-71480699 CTGATGTCCCAGAGCTGAGAGGG + Intronic
932720348 2:74134292-74134314 CAGTTGTATCAGAGCTGAGAAGG - Intronic
932869454 2:75382542-75382564 CAGAGGACTCAGAGCTGCAATGG - Intergenic
934750221 2:96789198-96789220 CCGATGGCACAGAGCTGTGAAGG + Intronic
937250023 2:120517716-120517738 GTGGGGACTCAGAGCAGAGAGGG - Intergenic
937378136 2:121351984-121352006 CTCAGGCCACAGAGCTGAGAAGG + Intronic
939327298 2:140710181-140710203 CTGCTGAGTCAGTGCTGAGCTGG + Intronic
941038571 2:160595081-160595103 CAGATAAATCAGTGCTGAGAGGG + Intergenic
946234703 2:218316804-218316826 CATATGACTCAGGGCTGCGATGG - Intronic
947350178 2:229235386-229235408 CTGTTGACTAAGACCTCAGAAGG + Intronic
947408574 2:229808621-229808643 CTGAAGTCTCAGGGGTGAGAAGG - Intronic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
948353354 2:237358866-237358888 GTAATGTGTCAGAGCTGAGAGGG + Intronic
948598187 2:239093747-239093769 GTGCAGACTCAGAGCTGAGGGGG - Intronic
1169494383 20:6100424-6100446 ATGATTACTCAGGGCTGGGAGGG + Intronic
1171239248 20:23551727-23551749 CTCATGACTTAGGGCTGAGAGGG - Intergenic
1173167747 20:40697866-40697888 CTGATCACACAGAGCAGGGAGGG + Intergenic
1175100038 20:56572762-56572784 CTGATGCCTCTGCACTGAGATGG + Intergenic
1175170777 20:57079931-57079953 CTGAGGACTCAGATCTAAGGTGG - Intergenic
1176125939 20:63474672-63474694 CAGATGCACCAGAGCTGAGATGG + Intergenic
1178031905 21:28537575-28537597 ATGATGACTAATAGCTGAAAAGG + Intergenic
1178548788 21:33517266-33517288 CTGATTACTTAGAGCTAAAAGGG - Intronic
1179882247 21:44297753-44297775 CTGATGAGAGAGTGCTGAGAAGG + Exonic
1182265705 22:29113622-29113644 TTGATGAAACTGAGCTGAGAAGG + Intronic
1182515116 22:30853831-30853853 CCGAGGAGGCAGAGCTGAGATGG - Intronic
1183726340 22:39592003-39592025 CTGGGGTCTCAGAGCTGAGCAGG - Intronic
1183740355 22:39665418-39665440 CTGGTGACTCTGGGCTGAGTAGG + Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
1185284225 22:49993225-49993247 CTCATGACACACAGCTGAGCAGG - Intergenic
951721675 3:25705811-25705833 CTGATGACACAGTGGTGGGAGGG + Intergenic
952018627 3:28989920-28989942 CTGATGACTCAGGGCAGGAAAGG - Intergenic
952220561 3:31319972-31319994 CTGTTTAATCAGAGATGAGAGGG - Intergenic
952474868 3:33698050-33698072 CTTAAGACTAAGGGCTGAGAAGG + Intronic
952834882 3:37594132-37594154 CTGCTGACCCAGAGCTCAGATGG - Intronic
954326283 3:49866022-49866044 CTGAAGCCTCAAGGCTGAGATGG + Intronic
954966234 3:54613593-54613615 CTTAAGACTCAGAGGTAAGATGG - Intronic
955724776 3:61921333-61921355 ATGATGACAGAAAGCTGAGATGG + Intronic
955899886 3:63741256-63741278 CTGGTGTCTCTGAGCTGAAAAGG + Intergenic
956884742 3:73547770-73547792 CTGCAGACTCAGACCAGAGATGG + Intronic
959724821 3:109531438-109531460 CTATTGACTCAGAGCACAGAAGG + Intergenic
960311447 3:116121043-116121065 GTGATGGCTTAGAGTTGAGAAGG + Intronic
961741239 3:129034279-129034301 CTGAGGACTCAGGGCTGCGGTGG + Exonic
962013062 3:131412060-131412082 CTGATGACTATGTTCTGAGACGG - Intergenic
962444366 3:135451605-135451627 CAGATGATGCAGAGCTGAAAGGG + Intergenic
963251944 3:143111807-143111829 CTGATGACTGGGTGCTTAGAGGG - Intergenic
964344794 3:155744839-155744861 CTGAACACTCAAAGCTGAGGAGG - Intronic
966233966 3:177680247-177680269 CTGATGATTGAGACATGAGATGG + Intergenic
967829673 3:193908426-193908448 CTGGTGCCTTAGAGCTGAGCTGG - Intergenic
968790538 4:2658251-2658273 CTGATGTCCCAGAGCTGGAATGG + Intronic
970300449 4:14675949-14675971 CTGAAACCTCAGTGCTGAGAAGG - Intergenic
972436933 4:39044419-39044441 CTGTTGTCTCAGAGCTTAAAGGG - Intergenic
977369252 4:96114399-96114421 CTGGTTTCTCAGACCTGAGAAGG - Intergenic
978422137 4:108544027-108544049 CTCATGATACAGAGCTGTGAAGG + Intergenic
981532492 4:145765668-145765690 TGAATCACTCAGAGCTGAGAGGG + Exonic
983357601 4:166683554-166683576 CTGATGAATAAAACCTGAGATGG + Intergenic
984599968 4:181714499-181714521 CAGATGACTCAGAGCCATGATGG + Intergenic
984768980 4:183421348-183421370 CAGATGCTTTAGAGCTGAGAAGG - Intergenic
985991966 5:3569728-3569750 CTGATGGAACAGAGATGAGACGG - Intergenic
987382887 5:17302239-17302261 GTGATGACCCAAAGCTGAGAAGG - Intergenic
987997160 5:25298519-25298541 CAGATGACATAGAGGTGAGAGGG - Intergenic
988010078 5:25470611-25470633 CTGATGAGGCAGAGCTCAGATGG - Intergenic
989169839 5:38463161-38463183 CTGCTGACTCATGGCTGAGGGGG + Intronic
990386546 5:55269567-55269589 CTGATCACTTGGAGCTGAGGAGG + Exonic
990879417 5:60522735-60522757 CTGATGATTCAGACCAGAAATGG - Intergenic
997326106 5:133022814-133022836 CAGTTGACACAAAGCTGAGAGGG + Intronic
997350823 5:133230273-133230295 CTGATTCCTAAGATCTGAGATGG + Intronic
997354053 5:133251106-133251128 CTCATGACTCGGAGATGGGAGGG - Intronic
997893246 5:137693904-137693926 CTGAGGACTCAGAGCTGTCTTGG - Intronic
998267459 5:140676942-140676964 CTGAAGCCCCAGAGCTCAGAAGG + Intronic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1001085604 5:168698186-168698208 CTGATGACTAAGACCTGTTATGG + Intronic
1001636121 5:173211544-173211566 CTGATGACTGGAGGCTGAGAAGG + Intergenic
1001877527 5:175214349-175214371 CTGGTGAGTCAGAATTGAGAAGG + Intergenic
1002111196 5:176914276-176914298 CAGAGGACACATAGCTGAGAAGG - Intronic
1004755996 6:18611006-18611028 CTGTTGAATTAGATCTGAGATGG + Intergenic
1005138411 6:22598511-22598533 ATGATGTCACAGAGCTGAGGTGG + Intergenic
1005360868 6:25029543-25029565 CTGATGCCTCACAGATGAGCAGG + Intronic
1006331606 6:33395337-33395359 CTGATGGTGCAGAGGTGAGAAGG + Intronic
1007661385 6:43488970-43488992 CTGATGACTCAGGGCAAAAAGGG - Intronic
1008103708 6:47420577-47420599 GGGATGACTCAGAGTTTAGAAGG - Intergenic
1009565306 6:65304789-65304811 CTGTTGAGGCAGAGCTGAGTCGG - Intronic
1011552659 6:88544282-88544304 GTGAGGACTTAGAGCTGAGCTGG + Intergenic
1013368498 6:109451883-109451905 CTGAGGACTTAGAGCAAAGAGGG + Intronic
1014968454 6:127784716-127784738 CAGATGAGGTAGAGCTGAGATGG + Intronic
1018902011 6:168056382-168056404 CTGAGGCCTCATGGCTGAGATGG + Exonic
1019567047 7:1689355-1689377 CTGAGGGCTCAGAGCTCAGATGG + Intronic
1021259661 7:18439470-18439492 CTGATGAAGCAGACGTGAGATGG - Intronic
1021655183 7:22867661-22867683 CTGTGGCCTCAGAGATGAGAAGG + Intergenic
1022625601 7:32032803-32032825 CTGATCCCGCAGAGCTGGGATGG - Intronic
1023505050 7:40890486-40890508 CTGATGACTGAGTCCTCAGATGG - Intergenic
1026048840 7:66927881-66927903 CTGATGAATGAGTGCTGAGATGG + Intronic
1026272647 7:68850091-68850113 GTGGTGTCTCAGAGCTGAGAGGG - Intergenic
1026641631 7:72131371-72131393 CTGATGATTCAGCACTGAAACGG + Intronic
1026829614 7:73602896-73602918 CTGGTGACTCAGGGATGAGAGGG - Intronic
1027910809 7:84247847-84247869 GTGATGACTCAGTGTTTAGAAGG + Intronic
1029118362 7:98249950-98249972 CTGAAGACTCAGACCTGAAAGGG - Intronic
1029193215 7:98786352-98786374 CTGCTGAGTCAGAGAGGAGAAGG - Intergenic
1029924257 7:104298837-104298859 CAGATTACTCAGAGCAAAGATGG + Intergenic
1031860553 7:126975014-126975036 CAGATGCCTCAAAGCTGAGAGGG + Intronic
1032447850 7:132000001-132000023 TTGAAGACTGAGAGCTGAGGTGG + Intergenic
1034731758 7:153393003-153393025 CTGATGGCTCTGAGCTGAAAGGG + Intergenic
1034846703 7:154452737-154452759 CTGATGACGCAGACCTGGAAGGG + Intronic
1041710849 8:60892890-60892912 TTCATGACTAAGAGCTGAGCAGG + Intergenic
1043052402 8:75400350-75400372 CTGGTAAGTCAGAGCTGATATGG - Intergenic
1043430716 8:80191803-80191825 ATGATGCCTAAGAGCTGTGAAGG - Intronic
1043994189 8:86792338-86792360 TTGAAGACTCAGAGGTGAAACGG + Intergenic
1045272466 8:100673779-100673801 ATCAAGACTCAGAGCTGAAAGGG - Intergenic
1045332723 8:101169684-101169706 CTAAAGACACAGAGCTGACAGGG + Intergenic
1047314769 8:123722783-123722805 ATGATGACTCAGGGCTGGCAGGG + Intronic
1048965161 8:139609598-139609620 CTGATGACTCACAGCTCAACTGG + Intronic
1049004102 8:139844018-139844040 CTGGAGACCCAGAGCTGAGTGGG - Intronic
1049092798 8:140529411-140529433 CTGATGATTCAGAGTTTAAATGG - Intergenic
1049363726 8:142226503-142226525 ACGAGGACTCAGAGCTGGGAGGG + Intronic
1049724807 8:144140783-144140805 CTGATGTCTGAGTGCTAAGAGGG - Exonic
1050410715 9:5362456-5362478 CAGATGGCTCAGAACAGAGAAGG + Intronic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1055014966 9:71606352-71606374 CTGATGCCTCAGAGAGGAGGAGG + Intergenic
1055683692 9:78745547-78745569 CTCATGACTCAGTGATGACAAGG + Intergenic
1055765405 9:79657651-79657673 GTAATGATTCAGAGCTGTGAAGG + Intronic
1056332392 9:85531999-85532021 CCGGAGGCTCAGAGCTGAGAGGG - Intergenic
1058638996 9:107064866-107064888 ATGAGCACTCAGATCTGAGAGGG - Intergenic
1059426756 9:114226002-114226024 CTGCAGCCTCAGAGGTGAGAGGG + Intronic
1059588080 9:115627802-115627824 CTAATTACTCAGGGATGAGAGGG - Intergenic
1060036675 9:120261756-120261778 CTTAGGACTTAGAGGTGAGAAGG - Intergenic
1060272090 9:122151325-122151347 CTGATTGCTCAGGCCTGAGATGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060564183 9:124575087-124575109 TTGATGTCCCAGAGCTAAGAGGG - Intronic
1060599478 9:124868754-124868776 CTGATGACTGAGGGATGAGTAGG - Exonic
1060992478 9:127856937-127856959 GTGAGGATTCAGAGCTGATAAGG - Intergenic
1062183639 9:135204717-135204739 CTGATCTCTAGGAGCTGAGACGG - Intergenic
1062722370 9:138051080-138051102 CTGAGGACTCAGGACTGAGTGGG - Intronic
1187017605 X:15345796-15345818 CTGATTACTCAGAGCAGATGAGG - Exonic
1189224296 X:39399555-39399577 CTGTTGACTGGGAGCTGAGCTGG + Intergenic
1190020799 X:46872622-46872644 ATAATGACACAGAGATGAGAAGG - Intronic
1190414991 X:50172281-50172303 ATGAGGCCTCAGAGCTGAGGTGG - Intergenic
1198997398 X:142589527-142589549 CTGATGAGTCAGAGATGAGATGG - Intergenic
1199221093 X:145316361-145316383 CTGATGACTGGCAGTTGAGATGG - Intergenic
1199259538 X:145755423-145755445 CTGATGAATCAAATCTGATAGGG - Intergenic
1201050975 Y:9934928-9934950 CTGAAGAAACAGAGATGAGAAGG + Intergenic