ID: 1001040692

View in Genome Browser
Species Human (GRCh38)
Location 5:168333041-168333063
Sequence GGTGGGGCTTGAGACTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001040692_1001040705 27 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040705 5:168333091-168333113 GGGATGGCACCCCCGGTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 159
1001040692_1001040704 20 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040704 5:168333084-168333106 ATCTCTGGGGATGGCACCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 184
1001040692_1001040699 5 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040699 5:168333069-168333091 CCTCCTGACTTCAGCATCTCTGG 0: 1
1: 0
2: 0
3: 33
4: 242
1001040692_1001040701 7 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040701 5:168333071-168333093 TCCTGACTTCAGCATCTCTGGGG No data
1001040692_1001040700 6 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040700 5:168333070-168333092 CTCCTGACTTCAGCATCTCTGGG 0: 1
1: 0
2: 2
3: 28
4: 302
1001040692_1001040703 11 Left 1001040692 5:168333041-168333063 CCCTTCAAGTCTCAAGCCCCACC 0: 1
1: 0
2: 2
3: 26
4: 157
Right 1001040703 5:168333075-168333097 GACTTCAGCATCTCTGGGGATGG 0: 1
1: 0
2: 2
3: 34
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001040692 Original CRISPR GGTGGGGCTTGAGACTTGAA GGG (reversed) Intronic
901357457 1:8663760-8663782 GGTGAGGCTGGAGAGGTGAAGGG - Intronic
904461690 1:30684551-30684573 GGTGGGACGTGAGAGATGAAGGG - Intergenic
905927684 1:41763457-41763479 GGTGGGGCATCCAACTTGAATGG - Intronic
908180994 1:61605747-61605769 GGTGGTGTTTGAGATTAGAAAGG - Intergenic
910205072 1:84741890-84741912 GATGGGGCTTGTTACATGAAAGG + Intergenic
913156272 1:116102388-116102410 AGTGGGAGTTGAGAGTTGAAAGG + Intergenic
915526094 1:156477103-156477125 GGTGGGGGTGGAGACTTGGCAGG + Exonic
915636936 1:157194140-157194162 GGGAGGGCTTGATACTTGGAAGG + Intergenic
921293119 1:213677227-213677249 GGTGAGGAGTGAGAGTTGAATGG - Intergenic
922070188 1:222184492-222184514 GGTGAGGCTGGAGAACTGAATGG - Intergenic
1063981965 10:11461042-11461064 GGTGGGGCTTTAAACTTTCAAGG - Exonic
1068229178 10:54148992-54149014 GGTGGGGCTGGAAAATTAAAAGG - Intronic
1068640668 10:59402636-59402658 GGTGGGGCCTGATACTTGAGTGG + Intergenic
1069691219 10:70354202-70354224 GCTGGGGCTTGGGAATGGAAGGG + Intronic
1072203189 10:93179382-93179404 GGTGGTGTTTGAGACTTGAATGG + Intergenic
1074446423 10:113524844-113524866 GGCTGGGCTTCAGACTTGAAGGG + Intergenic
1075535292 10:123266573-123266595 GGTAGAGCCTGAGTCTTGAAGGG - Intergenic
1076246985 10:128954964-128954986 GCTGGGGCTTGGGAATTGGAAGG + Intergenic
1076260807 10:129064164-129064186 GGTGGGGCTGAAGGCTTTAAGGG + Intergenic
1076808982 10:132876948-132876970 GCTGGGCTTTGAGACTAGAAAGG + Exonic
1077823894 11:5782894-5782916 GGATGGGCTAGTGACTTGAAGGG + Intronic
1077924873 11:6671563-6671585 AGTGGGGCCAGAGACTTGGATGG + Intergenic
1078505504 11:11939001-11939023 GGTGAGGCTGTAGACTTGACAGG + Intronic
1079725728 11:23878271-23878293 GATGGGGATTGAGAATTAAAAGG + Intergenic
1079955153 11:26852940-26852962 GAAGGGGCCTGAGACATGAAAGG + Intergenic
1080664249 11:34321760-34321782 TTGGGGTCTTGAGACTTGAATGG - Intronic
1080922386 11:36722067-36722089 GGTGTGGCTGGAGTCTTGACAGG - Intergenic
1083071214 11:59984288-59984310 TGTGAGGCATCAGACTTGAATGG - Intergenic
1084193414 11:67509217-67509239 TGTGGGGAGTGAGACTTGAGGGG - Intergenic
1084922124 11:72479623-72479645 GATGGGCCTTGAGATTTCAAAGG + Intergenic
1084952590 11:72674840-72674862 GATGGGGCTGGGGACTTGAGGGG + Intergenic
1085042619 11:73335412-73335434 GGTGGGGCTTGAGAAGTAGATGG - Intronic
1088433373 11:109782957-109782979 TGTGGTGCATGAGACTTCAAAGG - Intergenic
1089446601 11:118557800-118557822 GGTGGCACTTGAGACTTGCAGGG + Exonic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092902724 12:13075034-13075056 GATGGGACTTGAGACTTGGCAGG - Intronic
1095687430 12:45051299-45051321 TGTGGGGCTGGTGACATGAATGG - Intergenic
1096290320 12:50336741-50336763 AGTGGGGGATGAGACTGGAATGG + Intronic
1097811190 12:64021008-64021030 GGAGGAGCTTGAGTCTTGGAAGG - Intronic
1098153446 12:67572379-67572401 GATAGGGCTTGAGACTTGAGTGG - Intergenic
1099291474 12:80781574-80781596 TGTGGGGCTTCAGAATTCAAGGG - Intergenic
1100002967 12:89859540-89859562 GGTGTGGCTTGAGGCATGAATGG + Intergenic
1101846756 12:108369062-108369084 GGAGGGGCTGGAGACTTGGAGGG - Intergenic
1101953934 12:109197380-109197402 GGTGGGGATTCAGAGCTGAACGG + Intronic
1101990221 12:109477837-109477859 GGTGGGGCTGGGGACTTTGAGGG + Exonic
1106181241 13:27371575-27371597 GATGGGTTTTCAGACTTGAAGGG - Intergenic
1106603637 13:31208553-31208575 GGTGGGGGGTGAGACGGGAAGGG - Intronic
1107312185 13:39091007-39091029 GGTGGAGCTTGTGACTTGAAAGG - Intergenic
1107501603 13:40983926-40983948 AATGGGGCTTGAGCATTGAATGG - Intronic
1109099595 13:58163778-58163800 GGAGGGGCATGAGACTGTAAAGG + Intergenic
1118818834 14:69331570-69331592 GGTGGGGCTGTAGACATGAAAGG + Intronic
1119208236 14:72810476-72810498 TGTGGGGTTAGTGACTTGAAGGG + Intronic
1119383586 14:74243476-74243498 AGTAGGGACTGAGACTTGAATGG + Intronic
1120034572 14:79681626-79681648 GGTGGGCCGTGAGACTTGCTTGG - Intronic
1120752360 14:88209675-88209697 GGTGGGGCTGGAGAAGTGGAGGG - Intronic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1120819270 14:88896914-88896936 GGTGAGGCATGAGACTTGCTCGG + Intergenic
1124901768 15:33829848-33829870 GGAGGGGTTTGAGACTTCAGTGG + Intronic
1126670302 15:51110171-51110193 GGTGGGGCTGGAGAGTGAAAAGG + Intergenic
1127109720 15:55654948-55654970 GCTGAGGGTTGAGATTTGAAGGG - Intronic
1127731100 15:61802534-61802556 GCTGGGGCTAGAGGCTGGAAGGG - Intergenic
1128252447 15:66172605-66172627 GCTGGGGCCTCAGACCTGAAGGG - Intronic
1132756667 16:1488519-1488541 GGTGGGGCCAGAGGCTAGAAGGG - Intronic
1133046271 16:3089951-3089973 GGTGGCGCTTGAGGCTGGAGCGG + Exonic
1135091907 16:19524102-19524124 GAGGGGGCTTGAGCCTTGACGGG + Intronic
1136124967 16:28172437-28172459 CGTGGGGCTAGAGACTTAAGGGG - Intronic
1136275804 16:29178883-29178905 GCTGAGGCTTGAGAATTGCATGG - Intergenic
1136368358 16:29820388-29820410 GGTGGGGCTTGGGAGTTAAAGGG - Exonic
1136616092 16:31399439-31399461 GGTGGGGCTTCAGACCAGAGAGG + Intronic
1137735279 16:50719171-50719193 GCTGAGGCTGGAGACCTGAAAGG + Intronic
1139952927 16:70680733-70680755 GGTGGGCCTGGAGGCTGGAAAGG - Intronic
1142080175 16:88144947-88144969 GCTGAGGCTTGAGAATTGCATGG - Intergenic
1142299362 16:89247561-89247583 GGCGGGGCCTGAGTCGTGAAGGG + Intergenic
1142319814 16:89373884-89373906 GGTGGGGCCTGAGTCTTGGCAGG + Intronic
1145855356 17:28151244-28151266 GCTGGGGATTGAGACTTCAGAGG + Intronic
1146692302 17:34884709-34884731 AGTGAGGCTTGAGAGGTGAAGGG - Intergenic
1148482777 17:47970973-47970995 GGCGGGGCTTGAGGCCTGAGTGG + Intronic
1148851999 17:50560106-50560128 GGTGGGGCTTCAGGCTGGAGGGG - Intergenic
1148853215 17:50564828-50564850 GCTGGGGCTGGAGAATTGAATGG + Intronic
1151467480 17:74296731-74296753 CTTTGGGCATGAGACTTGAAAGG + Intronic
1156349944 18:36295495-36295517 GGTGGGGGCAGAGCCTTGAATGG + Intergenic
1156492881 18:37506685-37506707 TTTGGGGCTGGAGAGTTGAATGG - Intronic
1157132926 18:45024486-45024508 GGTGGGGCTTGAGCTAAGAAAGG - Intronic
1157183296 18:45516922-45516944 AGTGGAACTTGAGCCTTGAAAGG + Intronic
1157230128 18:45907762-45907784 GGTGGGGCTGGAGATTCAAAAGG + Intronic
1160796354 19:947516-947538 GGTGGGGGCTGAGACATGGATGG - Intronic
1162797346 19:13093828-13093850 GGTGGGGCTGGAGCCTTGGATGG + Intronic
1165154609 19:33779428-33779450 GGAGGGGCTTGAGGTGTGAAAGG - Intergenic
1166664970 19:44673953-44673975 GGTGGGGCTTGGGCCTGGCACGG + Intronic
1166703803 19:44897185-44897207 GTTGGGGCATGAGACTAGAGAGG + Intronic
1166980673 19:46630267-46630289 GCTGGGGTTTGAGACTGGAATGG - Intergenic
1167458629 19:49612393-49612415 GGTGGGGCTTGGGGATTGACTGG + Intronic
926306468 2:11640533-11640555 GGTGGGGCGTTTGACTGGAATGG + Exonic
928211621 2:29327998-29328020 GGTGGGGAATGGGACTTGGAAGG + Intronic
928726682 2:34182038-34182060 TGAGGGGTTCGAGACTTGAATGG + Intergenic
929869574 2:45746947-45746969 GGCGGGGACTGAGGCTTGAAAGG - Intronic
931097013 2:58952069-58952091 TGTGGGGCTTGACACTTAGAGGG - Intergenic
931697320 2:64880946-64880968 GTTGGGGCTAGAGATTTTAAGGG - Intergenic
932186010 2:69696438-69696460 TGTGGGGTCTGAGACTTCAATGG - Intronic
932286565 2:70538548-70538570 TGAGGGGTTTGAGACTTCAATGG + Intronic
934791783 2:97068288-97068310 GGTGGAGCTTGAGGCTTATATGG + Intergenic
936375928 2:111941624-111941646 GGTGGGGCTGGAGACTGGAGGGG - Intronic
937206122 2:120238244-120238266 GGTGGAGCTTGAGGCTTGAGTGG - Intergenic
938542536 2:132296409-132296431 GGTGGTGCTGGAGAATTGAAGGG - Intergenic
944966032 2:204934826-204934848 GGAAGGGCAAGAGACTTGAAGGG + Intronic
945154685 2:206826370-206826392 GTTGGGGCTGGTGAATTGAAGGG + Intergenic
947938713 2:234029371-234029393 AGTGGATCTTGAGACCTGAAAGG - Intergenic
1170363556 20:15574722-15574744 GGTGTGGCTTCAGCCTTCAAGGG + Intronic
1171330148 20:24330299-24330321 GGTAGGGCTGGAGAGTTGATAGG + Intergenic
1171871416 20:30529256-30529278 GGTGACGCTGGAGAATTGAAGGG - Intergenic
1174348299 20:49948140-49948162 GGTGGGACTAGAGACTGAAAAGG - Intronic
1175546750 20:59783180-59783202 GTTGGGGCTAGAGATTTGAAAGG + Intronic
1175725456 20:61315205-61315227 GGTGGGGCTTGTGATCTGGATGG + Intronic
1176686885 21:9857075-9857097 GGGGGTGCCTGAGACTTGAATGG - Intergenic
1181050160 22:20234563-20234585 GGTGGGGTTGGAGGCTGGAATGG + Intergenic
1183731800 22:39622476-39622498 GGTGGGGCATGAGGCTGGAGAGG + Intronic
949928686 3:9061323-9061345 GGTGGAGCTTGAGAAGTGGATGG - Intronic
950011732 3:9728929-9728951 GGTGGGGAGGGAGACTGGAAAGG - Intronic
950012077 3:9731258-9731280 GGCGGGGCTGGAGACTAGACCGG - Intergenic
951069220 3:18306712-18306734 TGTGGGGCTTGAGAAGTGTAAGG + Intronic
953372137 3:42397816-42397838 GGTGGGGCTAAAGAGTTGGAAGG - Intronic
955778713 3:62461512-62461534 GTTGGGGGTGGAGACTTGACTGG - Intronic
960043135 3:113170453-113170475 GCTGAGACTTGAAACTTGAATGG - Intergenic
963110285 3:141682825-141682847 GGTGGGGCCTTAGACTCAAAAGG + Intergenic
964697992 3:159531352-159531374 GGTGAGACTTGAGTCTTGCAAGG - Intronic
965124849 3:164612857-164612879 GGTTGGGCTTGAGAATTAAATGG - Intergenic
969536945 4:7762152-7762174 GGTGGCGCTTGAGGCCTGCAAGG - Exonic
969898517 4:10327126-10327148 GGTGGGTCTTCTGACTTGCAAGG + Intergenic
977612368 4:99049188-99049210 GTTGGGGGTTGAAGCTTGAAGGG + Intronic
980350272 4:131675224-131675246 GAGGGTGCCTGAGACTTGAATGG - Intergenic
980886114 4:138764625-138764647 GGTGGGGCTTCAGACCTGATGGG + Intergenic
981393805 4:144221972-144221994 GCTGAGGCTTGAGACTCAAAAGG - Intergenic
983582571 4:169324073-169324095 GGTGGGGCTTTGGACAAGAATGG - Intergenic
984060386 4:174982762-174982784 GGTGGGGCTTTGGACAGGAATGG + Intergenic
985119671 4:186627537-186627559 GGTGGGGCTTGAGGCAGCAAGGG - Intronic
986449665 5:7851418-7851440 GCTGGAGATTGAGCCTTGAACGG + Exonic
987017762 5:13837610-13837632 GGAAGTGCTGGAGACTTGAAAGG + Intronic
987245112 5:16041103-16041125 AGTGGGGCTTGGCACTTGATAGG - Intergenic
987488982 5:18553270-18553292 AATGGAGCTTGAGACTTGAGAGG - Intergenic
991993153 5:72361547-72361569 GGGGGGGCTTGGGACTTTAGTGG - Intergenic
994188098 5:96838021-96838043 GGTGGAGCTTGGGGCTTTAATGG + Intronic
998204425 5:140148767-140148789 GGTGGGGCTTCAGGCTTGTGCGG + Intergenic
998404719 5:141867863-141867885 GGTGGGGCTGGGGACTGGGAGGG - Intronic
1001040692 5:168333041-168333063 GGTGGGGCTTGAGACTTGAAGGG - Intronic
1001053915 5:168434051-168434073 GATGGGGGTGGTGACTTGAAGGG + Intronic
1001788582 5:174435307-174435329 GGTGGAGTTTGAGACTCTAAGGG - Intergenic
1005872447 6:29985099-29985121 TGTAGGTCTTGAGACTTAAAGGG + Intergenic
1006176031 6:32122160-32122182 GGTGAGGCATGAGAATGGAAGGG - Intronic
1006900535 6:37497763-37497785 GGTGGGGGTGAACACTTGAATGG + Intronic
1008869926 6:56261134-56261156 GGTGGGGCATGAGAACTGAGAGG - Intronic
1009613839 6:65980161-65980183 GGTGCTGCTTGAGATTTGATTGG - Intergenic
1011220350 6:85048508-85048530 GGCTGGCCTTGTGACTTGAATGG + Intergenic
1012408700 6:98930769-98930791 GTTAAGGATTGAGACTTGAATGG - Intronic
1012701814 6:102467202-102467224 GGTGGCACTTGAGGCTAGAATGG - Intergenic
1019150233 6:170000646-170000668 GGTGGGGGGTGAGAGTTGCATGG - Intergenic
1021617860 7:22520948-22520970 GGTTGGTTTTGAAACTTGAAAGG + Intronic
1021697366 7:23287787-23287809 GGTGGGGCTTGAGGGTGGAGAGG - Intergenic
1022927451 7:35070422-35070444 GGTTGGTTTTGAAACTTGAAAGG + Intergenic
1027266041 7:76495779-76495801 GGTGGGGCGGGAGGCTTGGAGGG + Intronic
1028374824 7:90135159-90135181 GGTTGGTTTTGAAACTTGAAAGG - Intergenic
1032459728 7:132101756-132101778 GCTGGGGCTGGAGAGATGAAGGG + Intergenic
1033619326 7:143048399-143048421 GCAGGGGCTTGGGAATTGAAAGG - Intergenic
1034717464 7:153256730-153256752 GGTGGGGCTGCAGCCCTGAAGGG + Intergenic
1037768479 8:21785856-21785878 TCTGGGGCTTGAGACTTGGTGGG - Intronic
1037980372 8:23249139-23249161 GGGGGAGCTAGAGACTGGAATGG + Intronic
1038219611 8:25594805-25594827 GGTGGGGATGGAGACTTCGATGG + Intergenic
1039901822 8:41758195-41758217 GCGGGGGCCTGGGACTTGAACGG - Intronic
1041251767 8:55941154-55941176 GGGGGGCCTTGAGACTTCAAGGG - Intronic
1041641867 8:60211578-60211600 GGTGAGGCCTGGGGCTTGAAAGG - Intronic
1044602871 8:94023463-94023485 GGTGTGGGTTCAGACTGGAAAGG + Intergenic
1045892504 8:107173853-107173875 TGGGGCACTTGAGACTTGAATGG - Intergenic
1047775516 8:128067310-128067332 TGTGGGGCTAGAGAGTAGAAGGG + Intergenic
1049334594 8:142076478-142076500 GGTGGGGCATGAGGCTAGAATGG - Intergenic
1049544958 8:143226230-143226252 GGTGGGGCTGGAGTATGGAAAGG - Intergenic
1049579076 8:143402899-143402921 GGTGGGGGTGGAGACATGAATGG - Intergenic
1053782437 9:41624487-41624509 GGGGGTGCCTGAGACTTGAATGG + Intergenic
1054170392 9:61834644-61834666 GGGGGTGCCTGAGACTTGAATGG + Intergenic
1054667145 9:67746171-67746193 GGGGGTGCCTGAGACTTGAATGG - Intergenic
1055399361 9:75906667-75906689 GGTGGAGCTTGAGATTAGAGAGG + Intronic
1058321572 9:103637491-103637513 GATGAGGCTTCAGACTTGAGAGG - Intergenic
1059581665 9:115555994-115556016 TGTTGGGCTTCAGACTTGCATGG - Intergenic
1060005570 9:119996745-119996767 GTTGGGCCTTGAGGGTTGAAAGG + Intergenic
1061537408 9:131258601-131258623 GGTGGGGCTGGAGACCAGAATGG - Exonic
1190936718 X:55004422-55004444 GGTGGGGCTGGAGAGTTGTTGGG + Intronic
1193377187 X:80775292-80775314 GATGGGAGTTGAGACTGGAAAGG - Intronic
1194572920 X:95574858-95574880 TGTGGGGTTTCAGACTTGCATGG + Intergenic