ID: 1001043309

View in Genome Browser
Species Human (GRCh38)
Location 5:168352503-168352525
Sequence CCTTAGGTCCTGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001043309_1001043316 23 Left 1001043309 5:168352503-168352525 CCTTCCAGCTGCAGGACCTAAGG 0: 1
1: 0
2: 0
3: 27
4: 233
Right 1001043316 5:168352549-168352571 CTTAGTTTTCATCTGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001043309 Original CRISPR CCTTAGGTCCTGCAGCTGGA AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901163384 1:7197789-7197811 CCCTAGGTCATTTAGCTGGAAGG + Intronic
901528052 1:9836342-9836364 GCTTGCCTCCTGCAGCTGGAAGG - Intergenic
901739352 1:11332033-11332055 CCTTCGGTCATGCAGCTGTGAGG - Intergenic
902306363 1:15542679-15542701 CATCAGGTCCTGCAGGTGAAGGG - Intronic
902950989 1:19882683-19882705 CCCCAGGGCCTGCAGCTGGTTGG - Exonic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
904773916 1:32895335-32895357 CCTCAGCTCCAGCAGCTGGTGGG + Exonic
904815324 1:33192065-33192087 CCTAATTTCCTACAGCTGGAGGG - Intergenic
905434539 1:37947502-37947524 CATTAAGTCCTGCAGCTAGCAGG + Intergenic
907220384 1:52903148-52903170 CTTTGGGCCCTGCAGCTGGTAGG + Intronic
907228933 1:52976843-52976865 CCTTAGGCTCTGCATCTGGGCGG + Intronic
907930096 1:58991036-58991058 TCTTATCTCCTGCAGTTGGAGGG - Intergenic
908879764 1:68717932-68717954 CCCAAGGTCATGCAGCTGGTTGG + Intergenic
910351836 1:86307436-86307458 CCTTTGGTCTTGCAGCGGGTAGG - Intergenic
912691909 1:111810983-111811005 CCTGAGGCCCTGAAGCTGGAGGG - Intronic
920701353 1:208219999-208220021 CCTTAAATTCTCCAGCTGGATGG + Intronic
923362499 1:233225481-233225503 CCATAGATCCTTCAGCTGGTTGG - Intronic
924299795 1:242625822-242625844 CTTTAGCTCCTGGAGTTGGAGGG + Intergenic
924816733 1:247448544-247448566 CCTGAGGGCCCCCAGCTGGAGGG - Exonic
1063084014 10:2798496-2798518 CTTTAGCTCCTGCTGCTGCAGGG - Intergenic
1065943668 10:30587750-30587772 TCTTAGGGCCTGTGGCTGGAGGG + Intergenic
1068706302 10:60079725-60079747 CCTTAGTTCCTGCTGGTGGAGGG + Intronic
1069140182 10:64812312-64812334 CCTTATTTCCTGTAGCTGAAGGG - Intergenic
1069529507 10:69205995-69206017 CTTTAGGGCCAGCTGCTGGATGG + Intronic
1075922767 10:126226558-126226580 CCTAAGGTCCCTCAGCTGGCCGG - Intronic
1076204127 10:128581753-128581775 CTTTAGGTCCTGAAAGTGGAAGG - Intergenic
1076384774 10:130048232-130048254 CCTGCTGTCCTGCAGCTGTAGGG - Intergenic
1076756744 10:132576493-132576515 CCTGAGGCCTTGCAGCTGGGAGG + Intronic
1078507843 11:11965657-11965679 CGTTGGGTCATGCAGATGGAAGG - Intronic
1078625167 11:12948704-12948726 CCTCAGCCCATGCAGCTGGAGGG - Intergenic
1079699567 11:23527000-23527022 CCTTATATCCTGTAGCTGTAGGG + Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1084936384 11:72589178-72589200 GGTGAGGTCCTTCAGCTGGATGG + Exonic
1085115364 11:73926813-73926835 CCCTAGGTCATGCAGCTAGTTGG + Intronic
1086744681 11:90410201-90410223 CCTTGTGTCCTGCAAGTGGAGGG + Intergenic
1086782863 11:90929412-90929434 CCTTAAGTCCTGTAGAGGGAAGG - Intergenic
1088230647 11:107670442-107670464 CCTTAGGGCCTCCAGGTGCAGGG - Intergenic
1089103538 11:115983602-115983624 CCTCAGGTCCTGCAAAGGGAAGG - Intergenic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1089775497 11:120832675-120832697 CCTAAGCTCCTGGAGTTGGAGGG + Intronic
1091195837 11:133730062-133730084 CCTTTATTCCTACAGCTGGAAGG - Intergenic
1092949244 12:13485861-13485883 CCTGAGGTCATGCAGCTAGAAGG - Intergenic
1094855984 12:34403046-34403068 CCCTAGGCCCTGCAGATGCATGG - Intergenic
1095600363 12:44006096-44006118 CTTTAGGCCCTGCAGCAGTATGG + Intronic
1095600532 12:44008023-44008045 CCTTAGGCCCTGCAGCAGTATGG + Intronic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1096704700 12:53412045-53412067 CCTTAGTTCCAGCAGCAGAATGG + Intronic
1098196426 12:68006756-68006778 CCATTGGTTCTGCAGCTGCAAGG + Intergenic
1101216929 12:102594773-102594795 CCTTAAGTCCTGCAGAGAGAAGG + Intergenic
1101253398 12:102956327-102956349 CCAGACGTCCTGAAGCTGGACGG + Intronic
1101448825 12:104757603-104757625 AATTACGTCCTGCAGCTGGCAGG + Exonic
1102261341 12:111445230-111445252 CCTTAAGGCCTGCAGCTAGGGGG + Intronic
1102889923 12:116550621-116550643 CCCAAGGTCATGCAGCTAGATGG - Intergenic
1102913568 12:116737170-116737192 CCTTGGTCCCTGCAGCGGGAAGG - Intronic
1103850457 12:123929701-123929723 CCTTGGGTCCCGTTGCTGGAAGG - Exonic
1104830502 12:131747622-131747644 CAGGAGGTGCTGCAGCTGGAGGG + Intronic
1105661535 13:22501139-22501161 CCCGAGGTCCTGCAGCTGACTGG + Intergenic
1106079352 13:26487745-26487767 CCAGAGGTCCTGCAGGTGGAGGG - Intergenic
1106080777 13:26498682-26498704 CCTGAGGTCCAGCAGCAGGTAGG - Intergenic
1109792760 13:67270930-67270952 ACTTAGGACCTGCTACTGGAAGG + Intergenic
1110177422 13:72573772-72573794 CCATAGGTCTGGCAGCTGCAAGG - Intergenic
1110602415 13:77389613-77389635 CCTTAGGTCCTACAGTTTGGGGG + Intergenic
1110860049 13:80338512-80338534 CCTTAGATTCTGCAGCTAAAAGG + Intronic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1113964395 13:114144488-114144510 CCTTGGGTCCTGGACCTGGGTGG - Intergenic
1118123071 14:62867791-62867813 GCATAGCTCCTGCAGCAGGAGGG - Intronic
1119194059 14:72703847-72703869 CCTTAGATCCTGCAGCAGCTAGG + Intronic
1120591156 14:86374462-86374484 ACATAGGGCCTGCAGCAGGAAGG + Intergenic
1121000747 14:90450519-90450541 CCTGAGGTCATGCAGCTAGTGGG - Intergenic
1121017283 14:90556410-90556432 GCTTGGGTCCTGCTGCTGGGGGG + Intronic
1121310973 14:92934853-92934875 CCGTAGTGCCTGCAGCTGGTGGG - Exonic
1121879123 14:97484258-97484280 CTTTAGGTCCTGTGGCTTGAGGG - Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1123027135 14:105431120-105431142 TATTAGGTTCTGCAGCTGAAGGG + Intronic
1124359433 15:29024904-29024926 CCTTGGGGCTTGCAGGTGGACGG + Intronic
1125957422 15:43800005-43800027 GCTTAGGTCCACCAGATGGAAGG + Exonic
1126069673 15:44854919-44854941 CCTGAGGTCACGCAGCTGGTGGG - Intergenic
1126088858 15:45034243-45034265 CCTGAGGTCACGCAGCTGGTGGG + Intronic
1126222887 15:46235341-46235363 CCTTATCTCCTGCAGCCAGAAGG - Intergenic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1127570619 15:60237565-60237587 CCTGTGATGCTGCAGCTGGATGG + Intergenic
1130549958 15:84884172-84884194 GCTGAGGTCCCACAGCTGGAGGG + Intergenic
1130563405 15:84976113-84976135 GCTGAGGTCCCACAGCTGGATGG - Intergenic
1130651276 15:85763462-85763484 TCGTAGGTCCTGCTGTTGGAGGG - Intronic
1131679047 15:94702388-94702410 CCTTTGCCCCTGCAGCAGGATGG + Intergenic
1134100419 16:11447997-11448019 CCTCGGGGCCTGCAGTTGGAAGG - Exonic
1134567356 16:15263075-15263097 TGTGAGGTCCTGCAGCTGGTAGG - Intergenic
1134735136 16:16493625-16493647 TGTGAGGTCCTGCAGCTGGTAGG + Intergenic
1134932385 16:18218592-18218614 TGTGAGGTCCTGCAGCTGGTAGG - Intergenic
1136058710 16:27709921-27709943 GCCAAGGTCATGCAGCTGGAAGG + Intronic
1136553843 16:30996749-30996771 CCTTTCTTCCCGCAGCTGGAAGG - Exonic
1137628405 16:49923970-49923992 CCCTGGGTCCTGGTGCTGGAAGG - Intergenic
1140540479 16:75752168-75752190 CCTTAGGAGCTGCAGCTTGGAGG + Intronic
1140869042 16:79089981-79090003 GCTTAGGTCCTGAAGCTCGCCGG - Intronic
1143406508 17:6681221-6681243 CCTGTGGCTCTGCAGCTGGAAGG + Intergenic
1147219976 17:38922821-38922843 CCTCAGGTCCAGCTGCTTGAGGG + Intergenic
1148220410 17:45857931-45857953 TCAGAAGTCCTGCAGCTGGATGG - Intergenic
1148640506 17:49183868-49183890 GCCTAGGTCCTGCACCTGGGAGG + Intergenic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1149058573 17:52393672-52393694 CCTAAGATCATGCAGCTGGTAGG - Intergenic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1151422031 17:74005071-74005093 CCATAGGTGCTGGAGCAGGAGGG - Intergenic
1151761173 17:76103961-76103983 CCTTATGTCCCGCGGCTGGCAGG + Intronic
1152208741 17:78991465-78991487 CCTAAGGACATGCAGCTGGATGG + Intergenic
1154162544 18:11990832-11990854 CCCAAGGCCCTGCAGCTGTAAGG - Intronic
1155293239 18:24362106-24362128 CCTAACATCTTGCAGCTGGAAGG - Intronic
1157095263 18:44680771-44680793 CCCTCGGTCCTGCAGCCGGCTGG + Intronic
1157388894 18:47284488-47284510 CCTGAGGTCACACAGCTGGAAGG + Intergenic
1158285866 18:55882163-55882185 CCTTAGGTCATGAAGCTCTATGG + Intergenic
1158692095 18:59669793-59669815 TCCTAGGTCCTGCAGCTGAAAGG - Intronic
1159634248 18:70785854-70785876 ACTTCGGTCCTGCAGCTGCAAGG + Intergenic
1160261712 18:77300496-77300518 TCTAAGCTCCTGGAGCTGGAGGG - Intergenic
1160812747 19:1020063-1020085 CCTGAGCTCCTGAAGCAGGAAGG + Intronic
1160856436 19:1220046-1220068 CCTGTGGTCCTGCAGCAGCAAGG - Intronic
1160859872 19:1233249-1233271 CCTGAGGTTCTGCAGGTGGCTGG - Intronic
1161067114 19:2244098-2244120 GCTTAGGGCCTGCAGATGGGCGG + Intronic
1162564317 19:11436743-11436765 CCGAAGGTGCTGCAGATGGAGGG + Intronic
1164109788 19:22145256-22145278 CTTAAGGTCCTGCAACTAGAAGG - Intergenic
1165093181 19:33397078-33397100 CCCGAGGTCCTGCAGCTGCTGGG + Intronic
1165328245 19:35126448-35126470 GCTGAGGCCCTGGAGCTGGACGG - Exonic
1165792249 19:38499515-38499537 TGTTGGGTCCTGGAGCTGGATGG + Intronic
1166253860 19:41588734-41588756 TCTGAGGTGCTGCAGCAGGAAGG + Intronic
1166350800 19:42197127-42197149 CCTTAGGTCATGAAAATGGAAGG + Intergenic
1167649386 19:50721151-50721173 CCGGAGAGCCTGCAGCTGGAGGG - Intergenic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
1168629921 19:57948584-57948606 ACTTATGTCCTGCTGCTGCAGGG - Intergenic
925075354 2:1012402-1012424 CCTTAGAACCTACAGCTGGGTGG + Intronic
926118044 2:10225628-10225650 GCTCAGGTGCTGCAGCTGGGAGG - Intergenic
927466680 2:23341916-23341938 CTTTAGGACCTGAACCTGGAGGG - Intergenic
927716439 2:25356195-25356217 CCTATGGCCCTGCAGCTGCAGGG - Intergenic
927721465 2:25385617-25385639 CCTAAGGTCGTGCAGCTTGAAGG - Intronic
927993663 2:27466403-27466425 CCTCAGGCCCTCCAGCAGGATGG + Intronic
928694603 2:33836582-33836604 CCTGTGGACCAGCAGCTGGAGGG - Intergenic
930033156 2:47070317-47070339 CCTTAGGTTCTGCACCTGCGTGG + Intronic
930953571 2:57175729-57175751 CTTTATTTTCTGCAGCTGGAAGG - Intergenic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932344327 2:70985675-70985697 GCTTAGAGCCTGCAGCAGGAAGG - Intronic
932623019 2:73277228-73277250 CCTCAGCTCCAGCAGATGGAGGG - Intronic
932630822 2:73341781-73341803 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
932868706 2:75374624-75374646 CCTGTGATACTGCAGCTGGATGG - Intergenic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
937010427 2:118558118-118558140 CCTAAGGTCACGCAGCTGGACGG - Intergenic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
938289081 2:130140082-130140104 CTTGAGGTGCTGCAGCTGAAAGG + Exonic
940092984 2:149942968-149942990 CCTTAGGGCCTCCAGAGGGAGGG - Intergenic
941065207 2:160893841-160893863 GCTTAGCTCTTGCAGCTAGATGG + Intergenic
942114458 2:172713732-172713754 GCCCAGGTCCTGCAGCTGGGTGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
946085587 2:217168196-217168218 CCTTTGGACCTGAAGGTGGAAGG + Intergenic
1170210713 20:13844026-13844048 CCTAGGGTTCTGCTGCTGGATGG - Intergenic
1172038726 20:32028938-32028960 CCTGAGGGCCAGGAGCTGGAGGG + Intronic
1173646705 20:44637776-44637798 CCTGAGGTCATCCAGCTGGCAGG + Intronic
1175093078 20:56520570-56520592 GCTTGGGTCCTGGAGGTGGACGG - Intronic
1175327381 20:58139149-58139171 CCTGAGCTCCTGCTGCTGCATGG - Intergenic
1175374913 20:58517509-58517531 CCTGAGGCCAGGCAGCTGGAAGG + Intergenic
1175786017 20:61712245-61712267 CCTTGGGGCCTCCAGGTGGATGG + Intronic
1176077005 20:63253263-63253285 CCTGAGGTCCTGCAACAGGCTGG - Intronic
1176512953 21:7762328-7762350 CCTAAGGTCCCCCAGCTGGTGGG + Intronic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
1177450397 21:21258562-21258584 CCTTAGGTCCTGAGGGTGGAGGG - Intronic
1178514726 21:33236825-33236847 CCCCAGGCCCTGCAGCTAGAAGG - Intronic
1178530304 21:33370330-33370352 TCCTAGGTCCTGCAGCCGCAAGG + Intergenic
1178647066 21:34392852-34392874 CCTAAGGTCCCCCAGCTGGTGGG + Intronic
1179618995 21:42600094-42600116 ACTCAGGCCCTGCAGCTGGTCGG - Intergenic
1181108367 22:20587732-20587754 CTTGAGGTGCTGCAGCTGAAAGG + Intergenic
1182026095 22:27120403-27120425 TTTTAGGGCCTGCTGCTGGAGGG + Intergenic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1184745204 22:46452079-46452101 CCCTCAGTTCTGCAGCTGGAAGG - Intronic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
951620610 3:24597945-24597967 CCCAAGGTCCTGAAGCTGGATGG - Intergenic
952505170 3:34000594-34000616 CTTTAGGCTCTGCAGCTGCAAGG + Intergenic
952919132 3:38272933-38272955 CCCTTGGTCCTACAGCTGGATGG - Intronic
954791238 3:53134960-53134982 CTTGAGGTCCTGCTTCTGGAAGG - Intergenic
955949413 3:64227002-64227024 CTTCAGGAACTGCAGCTGGAAGG - Intronic
959480372 3:106865173-106865195 CCTCAAGGCCTGCAGCTGCAGGG + Intergenic
961058341 3:123807864-123807886 CCTTAGGTGCTGCATCAGAATGG + Intronic
961406377 3:126682489-126682511 CCTGAGGTCATGCAGCTAGAAGG - Intergenic
962318145 3:134371314-134371336 CCTCAGGGCCTGCTGCTGGATGG + Exonic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
965468254 3:169059258-169059280 TCTTAGCTCCTGCAGCCAGAGGG + Intergenic
968577987 4:1376808-1376830 CCTCAGCTCCTGCCGCAGGACGG + Intronic
968650981 4:1760201-1760223 CCTGAGCTCCCGGAGCTGGAGGG - Intergenic
969434622 4:7181238-7181260 CCTGAGGACCAGCAGCTGGTGGG - Intergenic
969463970 4:7343900-7343922 CCCGAGGCCCTGCAGCTGGGAGG + Intronic
970609058 4:17708965-17708987 GCTCAGGTCCGGAAGCTGGAAGG - Exonic
973609374 4:52619843-52619865 TCTTAGATCCTTCAACTGGATGG - Intronic
975845377 4:78519650-78519672 CCTTCTGTCCTGATGCTGGAAGG + Intronic
977810355 4:101348794-101348816 CCTTGGGTGCTGCAGTTGGTCGG - Exonic
981741287 4:148004666-148004688 CCTTTAGTCCTGCAACTGCAAGG + Intronic
982771618 4:159401833-159401855 CCTTGGGTCCTGCCGAGGGAGGG - Intergenic
984680353 4:182601107-182601129 CCAGCTGTCCTGCAGCTGGACGG - Exonic
985101115 4:186459575-186459597 CCCTATTTCTTGCAGCTGGAAGG + Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
987480935 5:18457033-18457055 ACTGAGGTGCTGCAGCTGCAAGG + Intergenic
989427253 5:41310722-41310744 CCATGGGTCCTCCAGCTAGAGGG - Exonic
990023627 5:51159564-51159586 ACTCAGGTCCTGCACCTGGGAGG - Intergenic
995389417 5:111623937-111623959 CCTAAAGTCCTGCAGCCAGAAGG - Intergenic
996988927 5:129604263-129604285 ACTTAGGTCCTGCAGTGTGAAGG - Intronic
997960339 5:138316140-138316162 TATTAGGTCCTGCACCTGGGAGG - Intronic
999088644 5:148915312-148915334 CCTTAGTTCCTGCAGCTGAGAGG - Intergenic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1001250688 5:170144541-170144563 CCTTGGCTCCTGTAGGTGGAAGG + Intergenic
1001267214 5:170282485-170282507 CCCAAGGTCCTACAGCTGGTGGG + Intronic
1003760898 6:9177627-9177649 CTTTATCTCCTGCAGCTGCAGGG - Intergenic
1004203228 6:13569537-13569559 CCTGAGGTCCTCCAGCTCTAGGG - Intergenic
1006444746 6:34073939-34073961 CCTATGGTCCAGCAACTGGATGG + Intronic
1006743592 6:36325963-36325985 CCTCAGGTCCTTCATCTGTAAGG + Intronic
1007919257 6:45591406-45591428 CCTTAGGGCTTGCAGCTTCAAGG + Intronic
1008410130 6:51167826-51167848 CCTTACATTCTGCAGCTGCAGGG - Intergenic
1008634105 6:53392406-53392428 CATCAGATCCTGCAGGTGGATGG + Intergenic
1009253239 6:61337854-61337876 CCTTAAGTCCTATAGCTGAAAGG + Intergenic
1009257925 6:61439675-61439697 CCTTAAGTCCTATAGCTGAAAGG + Intergenic
1010407362 6:75520268-75520290 CCTTATTTCCTGTAGCTGCAGGG - Intergenic
1011176990 6:84574640-84574662 CCTTATTTCCTGGAGCTGTATGG + Intergenic
1012310689 6:97720598-97720620 CTTCAGTTCCTACAGCTGGAGGG + Intergenic
1013842973 6:114420093-114420115 GCTTTGGACCTGCATCTGGAGGG - Intergenic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1015196125 6:130526494-130526516 CCTTAGGTCCTGGAGTTGGGAGG + Intergenic
1015902595 6:138083191-138083213 CATTACCTCCTGCAGCTGTAGGG + Intergenic
1016339752 6:143049798-143049820 GCCTAGGTCCTGCACCTGGGAGG + Intergenic
1016939205 6:149470686-149470708 CCTAAGGTCACACAGCTGGATGG + Intronic
1018411297 6:163551318-163551340 CCTTAGGTCCCACAGGTTGAGGG + Intronic
1019734598 7:2644563-2644585 CCCTGGGTCCTGCCCCTGGAGGG + Intronic
1021855752 7:24853918-24853940 TTCTGGGTCCTGCAGCTGGAAGG - Intronic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1022959507 7:35413101-35413123 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
1026743213 7:72991519-72991541 CCTGAGGTCCATCAGCTGGAAGG - Intergenic
1026782700 7:73280585-73280607 CCTGAGGTCCATCAGCTGGAAGG - Intergenic
1026803079 7:73411973-73411995 CCTGAGGTCCATCAGATGGAAGG - Intergenic
1027029327 7:74876216-74876238 CCTGAGGTCCATCAGCTGGAAGG - Intergenic
1027100522 7:75373559-75373581 CCTGAGGTCCATCAGCTGGAAGG + Intergenic
1029160391 7:98547686-98547708 CCCTGGGTCCTGCAGCTATAAGG - Intergenic
1029437574 7:100571629-100571651 ACTTAGGTGCCACAGCTGGAAGG - Intergenic
1033147799 7:138885918-138885940 CCTCAGATCCTACAGGTGGAGGG - Intronic
1036638929 8:10569968-10569990 CCTTAGCTCCTGCAGGCAGATGG - Intergenic
1040548746 8:48422411-48422433 CCTTAGGTTCTGCAGCTGTGTGG + Intergenic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1049706993 8:144047623-144047645 CCTCAGCTCCTGCAGCAGGTGGG - Intergenic
1052474331 9:28939150-28939172 CCTTATGTTCTGCAGTTCGAAGG + Intergenic
1055196210 9:73597332-73597354 CCTCAGGTCAAGCAGATGGAGGG + Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1061120217 9:128637299-128637321 CCTCAGGGGCTGCAGCAGGAAGG + Intronic
1061153851 9:128845379-128845401 CCTTCGGGCCTGCAGCTGTTTGG + Exonic
1061162358 9:128902652-128902674 CTTTAGGTCCTGGCCCTGGATGG + Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061914600 9:133742892-133742914 CTCTTGCTCCTGCAGCTGGATGG - Intergenic
1062107199 9:134762200-134762222 CCATCGGTCCTGCTGATGGATGG + Intronic
1185461778 X:336083-336105 CCTTAAGCCCAGCAGGTGGAGGG + Intronic
1185504604 X:621945-621967 CCTTAGGTTCTGCATCAGGAGGG + Intergenic
1186836148 X:13440316-13440338 ACTTAGGCCCTGCAGCAGGCAGG + Intergenic
1191215488 X:57928712-57928734 CCCTAGGTCAGGCTGCTGGAGGG + Intergenic
1191926158 X:66312286-66312308 CCTTAGCTCCTAAAGGTGGAGGG - Intergenic
1196112338 X:111960459-111960481 CCTTAAGTCATTCAGCTGCATGG + Intronic
1198295915 X:135286268-135286290 CTTTAGGTCCTGCAGCAGTATGG + Exonic
1198792041 X:140356480-140356502 CCTTTGGTGCTGCAGATGGTAGG - Intergenic
1200046642 X:153406487-153406509 GCAAAGGTCCTGGAGCTGGAAGG + Intergenic
1200887272 Y:8281982-8282004 CCTGAGCTTCTGCAGCTGGTTGG + Intergenic
1201337010 Y:12892394-12892416 CCCCAGGTCCCGCAGATGGAGGG - Intergenic