ID: 1001045901

View in Genome Browser
Species Human (GRCh38)
Location 5:168371414-168371436
Sequence CGGTTTGGTGTACCTGGCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001045901_1001045908 22 Left 1001045901 5:168371414-168371436 CCCTTGCCAGGTACACCAAACCG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1001045908 5:168371459-168371481 GTGATGAGTTGCCGCTAGGATGG 0: 1
1: 0
2: 0
3: 4
4: 47
1001045901_1001045909 23 Left 1001045901 5:168371414-168371436 CCCTTGCCAGGTACACCAAACCG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1001045909 5:168371460-168371482 TGATGAGTTGCCGCTAGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1001045901_1001045907 18 Left 1001045901 5:168371414-168371436 CCCTTGCCAGGTACACCAAACCG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1001045907 5:168371455-168371477 ATTAGTGATGAGTTGCCGCTAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1001045901_1001045910 29 Left 1001045901 5:168371414-168371436 CCCTTGCCAGGTACACCAAACCG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1001045910 5:168371466-168371488 GTTGCCGCTAGGATGGGAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001045901 Original CRISPR CGGTTTGGTGTACCTGGCAA GGG (reversed) Exonic
900977212 1:6025370-6025392 CTCTTTGGGGTACCAGGCAAAGG - Intronic
903002268 1:20274786-20274808 GGGTTTGTTGTACCTGGGGAGGG - Intergenic
907243134 1:53091565-53091587 CGGGAGGGTGTTCCTGGCAATGG + Intronic
915474304 1:156144096-156144118 CGGTCTGGGGTTCCAGGCAAAGG - Intergenic
918579425 1:186108666-186108688 TGGTTTTGTGTACCCAGCAAAGG - Intronic
1075488613 10:122847595-122847617 CTGTTAGGTGGCCCTGGCAAAGG + Intronic
1075685741 10:124364139-124364161 CTGGTTGGTGTCTCTGGCAAAGG - Intergenic
1084554506 11:69867917-69867939 CAGTTTGATGTGCCTGGCACAGG + Intergenic
1090858854 11:130635140-130635162 CGGGTTGCTGTTCCTGGCGAAGG - Intergenic
1091883311 12:3997462-3997484 CAGTTTGGAGGACCTGGGAAAGG + Intergenic
1093892156 12:24535018-24535040 CTGGTTGTTGTACCTGGTAAAGG - Intergenic
1094214843 12:27929932-27929954 AGGTTTGGTGTATCTACCAAAGG - Intergenic
1110487687 13:76066128-76066150 CAGTTTGGTGTTCCTGCCATAGG + Intergenic
1114986171 14:28231244-28231266 TGATTTAGTGTACCTGGCAGAGG - Intergenic
1119025742 14:71150954-71150976 CGGTTTGGTGTGCCAGGCCCAGG + Intergenic
1124621348 15:31275845-31275867 AGGTTGGGGGAACCTGGCAAAGG - Intergenic
1131111252 15:89766584-89766606 CGGGTGGGTGTTCCTGGCAGAGG - Intronic
1143080657 17:4378998-4379020 TGGATTTGTGTACCTGGCAGAGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1164897997 19:31894230-31894252 CGGAGTGCTGTACCAGGCAAAGG + Intergenic
930713459 2:54571179-54571201 TGGTTTGGCGTGCCTGTCAAGGG + Intronic
934112179 2:88754264-88754286 CAGTTGTGTGTACCTGGCACTGG + Intergenic
945249206 2:207749447-207749469 CGGTTTGCTGTGCCTGTAAAGGG + Intronic
948654485 2:239468407-239468429 TGGTTTGGGGTCCCTGGGAAGGG + Intergenic
1179464790 21:41564403-41564425 CGCTTGGGTGTACCTGGGAATGG + Intergenic
1184866035 22:47202358-47202380 CGCTTTGGGGGACCTGGCCAGGG - Intergenic
954906805 3:54070111-54070133 GGGTTTGCTGTAACTTGCAATGG - Intergenic
960501672 3:118445376-118445398 AAGTTTGGGGTCCCTGGCAAAGG - Intergenic
961437584 3:126930214-126930236 TGGTTTGGAGTACATGGAAAAGG - Intronic
972579025 4:40378955-40378977 CAATTTGGTGTTCCTGCCAAGGG - Intergenic
975463596 4:74683805-74683827 CAGTTTGGTGTTCCTGTGAATGG + Intergenic
975573294 4:75839284-75839306 GGGTTTGGTGTACCTCACACAGG - Intergenic
976562726 4:86520999-86521021 CGGTCTGGTGGAGGTGGCAAGGG + Intronic
976842120 4:89444194-89444216 AGGTTTGGTGGACCCAGCAAGGG - Intergenic
978107125 4:104916667-104916689 CGGTTTGGTGAACCGGGAACTGG + Intergenic
986629732 5:9759465-9759487 CTGTTTGGTGTATCTGGGAAGGG - Intergenic
993498824 5:88640224-88640246 AGGTTTGGTGGTGCTGGCAAAGG + Intergenic
995661865 5:114493451-114493473 CACTTTGGTGGACTTGGCAAAGG + Exonic
1001045901 5:168371414-168371436 CGGTTTGGTGTACCTGGCAAGGG - Exonic
1004860198 6:19796244-19796266 AGTTTTGGGGTATCTGGCAAAGG - Intergenic
1007386978 6:41526910-41526932 GGGTTTTCTGGACCTGGCAAGGG - Intergenic
1007391306 6:41551067-41551089 CGGCTTGGTGGAACTGGCAGTGG - Intronic
1010652247 6:78468710-78468732 CTGATTGGTGTACCTGAAAATGG + Intergenic
1017144888 6:151225726-151225748 TGATTTGGTGTTCATGGCAAAGG + Intergenic
1017238682 6:152143685-152143707 CGGTTTGCTGTATCTGAAAACGG + Exonic
1019519313 7:1453520-1453542 CCGTTTGGGGGACCTTGCAAGGG + Intronic
1035558703 8:588703-588725 CTGATTGGTGTACCTGGGATGGG - Intergenic
1036769227 8:11567209-11567231 CGGCTTGGTTTTCCTGGGAAAGG + Intergenic
1038310987 8:26446009-26446031 CAGTTTGGAGTACTAGGCAATGG - Intronic
1043769834 8:84184364-84184386 CGGTTTGGTTTCCTTGTCAACGG + Intronic
1044373955 8:91447321-91447343 CTGTTTGGTGTATCTGGCTCAGG + Intergenic
1049193551 8:141302858-141302880 TGGTTTGGTGTATATGGGAAGGG - Intronic
1050226939 9:3469907-3469929 CGGTTAGGTGTACTTCGAAAAGG - Intronic
1059747850 9:117220245-117220267 GGGTTTTGTGTACCAGGCTAGGG - Intronic
1061957869 9:133973011-133973033 CTGGTTGGTGTTCCAGGCAACGG - Intronic
1191641071 X:63430195-63430217 CCTTTTGGTGTCCCTTGCAATGG + Intergenic
1198451398 X:136769470-136769492 TGGTAGGGTGTCCCTGGCAATGG + Intronic
1200895374 Y:8370257-8370279 CGGTTTGGGGGACTTGGCTATGG - Intergenic
1200900517 Y:8426669-8426691 AAGTTTGGTGTGCCTGGCACAGG + Intergenic