ID: 1001048207

View in Genome Browser
Species Human (GRCh38)
Location 5:168391983-168392005
Sequence AAGTAAGACTGAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1261
Summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 1192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001048207 Original CRISPR AAGTAAGACTGAAGGGAAGA GGG Intronic
900286045 1:1901106-1901128 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
900969361 1:5980902-5980924 AAGAGAGACTGAGGGGAAGAGGG - Intronic
900993330 1:6107784-6107806 ATGGAAGAATGAAGGGATGATGG + Intronic
901305370 1:8228896-8228918 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
901401842 1:9020103-9020125 GATTAAGACAGATGGGAAGAAGG + Intronic
902224369 1:14987534-14987556 ATCCAAGACTGAAGGGAAGGAGG + Intronic
902388593 1:16089824-16089846 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
902634720 1:17727723-17727745 AAGAAAGAAAGAAAGGAAGAAGG - Intergenic
902757488 1:18558485-18558507 AAGGAAGACAGGAAGGAAGAGGG + Intergenic
903278633 1:22237427-22237449 AAGTAAGAGGGCAGAGAAGAGGG - Intergenic
903286443 1:22279934-22279956 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
903286446 1:22279971-22279993 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
903393004 1:22977896-22977918 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903689972 1:25166749-25166771 AAGGAAGACGGAAGGAAGGAAGG + Intergenic
903840033 1:26232557-26232579 AGGAAAGACGGAAGGAAAGAAGG - Intergenic
904712391 1:32440152-32440174 AAGCAAGGCTAAAGGTAAGAGGG + Intergenic
904789282 1:33006426-33006448 AGGTCAGACTGCAGAGAAGAAGG - Intergenic
905352030 1:37354159-37354181 AAGTTAGACAAAAGGGAAAATGG + Intergenic
905461308 1:38124679-38124701 AAGGAAGAGTGAAGGGAGAAGGG + Intergenic
905589618 1:39151610-39151632 AATTAAGAGTGAGGGGAACAGGG - Intronic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905810317 1:40908024-40908046 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
905996487 1:42385906-42385928 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
906236091 1:44211759-44211781 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
906969807 1:50499731-50499753 AAGAAAGAAAGAAGGGAGGAAGG - Intronic
906996772 1:50803949-50803971 AAGGAAAACTTTAGGGAAGAGGG + Intronic
907200864 1:52725955-52725977 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
908190384 1:61697349-61697371 AGGAAAGAAGGAAGGGAAGAAGG - Intronic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908695505 1:66836314-66836336 AAGAAAGAAAGAAGGAAAGAGGG + Intronic
908731168 1:67228128-67228150 AAGAAAGACAGAAAGAAAGAAGG - Intronic
908987347 1:70039823-70039845 AAGTAACACTAAAGGCAGGAGGG - Intronic
909014566 1:70368611-70368633 AAGGAAGACTGGAGGGTGGAAGG - Intronic
909072700 1:71015818-71015840 AAATAAGACAAAAGGGAAAATGG - Intronic
909101479 1:71354610-71354632 ATGAAAGACAGAAGGAAAGAAGG - Intergenic
909297927 1:73974753-73974775 AAGGAAAAATGAAGGGAATAGGG + Intergenic
909419191 1:75444371-75444393 AGGAAAGAAGGAAGGGAAGAAGG + Intronic
909738740 1:79001145-79001167 AAGGAAGACAGAAGGAAGGAAGG + Intronic
910502035 1:87903379-87903401 AAGTAAAGCTGAGGGTAAGATGG + Intergenic
910814520 1:91276464-91276486 AAAGAAGAAAGAAGGGAAGATGG + Intronic
910826085 1:91408654-91408676 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
911264597 1:95728045-95728067 AAAGAAGAGAGAAGGGAAGAGGG + Intergenic
911644790 1:100326602-100326624 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
911957508 1:104256338-104256360 AGGGAAGAATGAAGGGAGGAAGG - Intergenic
912316154 1:108669021-108669043 AAGAAAGAAGGAAGGGAAGAAGG + Intergenic
912623957 1:111192595-111192617 AAGTGACTCTGAAGAGAAGAGGG + Intronic
912761358 1:112370451-112370473 AAGGAAAACTGACAGGAAGATGG - Intergenic
912997358 1:114544305-114544327 AAGAGAGAAAGAAGGGAAGAAGG - Intergenic
913154419 1:116080918-116080940 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
913178009 1:116292524-116292546 AAGTAAGACTGAGGGGAACTGGG + Intergenic
913365729 1:118036201-118036223 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
913440612 1:118893252-118893274 AAGGAAGAAAGAAAGGAAGAAGG + Intronic
913440630 1:118893395-118893417 AAGAAAGAAAGAAAGGAAGAAGG + Intronic
913502028 1:119480300-119480322 AAGGAAGAAAGAAGGAAAGAAGG + Intergenic
913666300 1:121051845-121051867 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
913963228 1:143354706-143354728 AGAAAAGGCTGAAGGGAAGACGG - Intergenic
914017987 1:143838957-143838979 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
914057584 1:144180292-144180314 AGAAAAGGCTGAAGGGAAGACGG - Intergenic
914121562 1:144786074-144786096 AGAAAAGGCTGAAGGGAAGACGG + Intergenic
914193142 1:145428184-145428206 TAGGAAGACTGAAGGGCAAAGGG + Intergenic
914264491 1:146026857-146026879 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
914656599 1:149747490-149747512 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
915045451 1:153010149-153010171 AAGAATGACTAAAGGGAGGAAGG - Intergenic
915330492 1:155108822-155108844 AAGAAAGAGAGAAGGGAGGAAGG - Intergenic
915574314 1:156765448-156765470 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915856197 1:159389003-159389025 AGGTGAGCTTGAAGGGAAGATGG + Intergenic
915884342 1:159706675-159706697 AATTAAGAACCAAGGGAAGAGGG + Intergenic
916146717 1:161746537-161746559 AAGGAAGACGGAAGGAAGGAAGG - Intergenic
916259729 1:162829515-162829537 AAGGAAGAAGGAAGGAAAGAAGG - Intronic
917070462 1:171144946-171144968 TAGTAAGAATGAAGGGAGAATGG + Intronic
917229830 1:172823807-172823829 GAGTAAAACTGAGGGCAAGAGGG - Intergenic
917231683 1:172844723-172844745 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
917680282 1:177358882-177358904 AAAAAAGAAGGAAGGGAAGAAGG + Intergenic
917680652 1:177363199-177363221 AAGTAAGCTGGAAGGCAAGATGG + Intergenic
917706983 1:177644861-177644883 AAGTAAGACAGAGGGGAACTTGG + Intergenic
917758723 1:178132030-178132052 GAGAAAGAGGGAAGGGAAGAAGG - Intronic
917904126 1:179572795-179572817 AAGAAAGAAAGAAGGGAAGGAGG - Intronic
918338162 1:183542397-183542419 AACTAAGAATGATGGAAAGAAGG + Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
918748057 1:188231732-188231754 AAGGAAGACTAAAGGAAAGAAGG - Intergenic
919431752 1:197502686-197502708 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
919613135 1:199771971-199771993 AAGGAAGAAGGAAGGGAAGAAGG + Intergenic
919669598 1:200326998-200327020 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
919795319 1:201318095-201318117 GAGTAAGACTGAGGGGAGAAGGG + Intronic
919908964 1:202098331-202098353 AAATAAAAATAAAGGGAAGAGGG - Intergenic
920073236 1:203318390-203318412 AAGGAAGAAAGAAAGGAAGAAGG - Intergenic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
920611420 1:207441716-207441738 AAGTCATACTGAAGCAAAGATGG - Intergenic
921099792 1:211918891-211918913 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
921407431 1:214796371-214796393 AAGAAAGAAAGAAAGGAAGAAGG - Intergenic
922020582 1:221700170-221700192 AAGGGAGAGGGAAGGGAAGAGGG + Intergenic
922027154 1:221760877-221760899 AAGAAAGAGTAAAAGGAAGAAGG + Intergenic
922070636 1:222189285-222189307 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
922098414 1:222462083-222462105 AAGTCAGACTCAAGGTCAGAGGG - Intergenic
922283879 1:224151557-224151579 AAGTAAAGGAGAAGGGAAGATGG + Intronic
922293058 1:224225097-224225119 GATTAAGAATGAAGGGAAGCCGG - Intergenic
922707912 1:227799999-227800021 AAGAAAGAAGGAAGGAAAGAGGG - Intergenic
922862265 1:228829664-228829686 AAGAAAGACAGAGGGGAGGAAGG + Intergenic
923418801 1:233791931-233791953 AAATAACACTGAAGCGAGGAGGG - Intergenic
923673092 1:236057681-236057703 GAGTAAGACTGAAAGAAAGAAGG + Intronic
923742570 1:236669165-236669187 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
923919153 1:238544730-238544752 AAATCAGTCTTAAGGGAAGAGGG + Intergenic
923999816 1:239538076-239538098 AAGGAAGAAGGAAAGGAAGAGGG + Intronic
924035635 1:239933789-239933811 AAGAAAGAAAGAAGGGAGGAGGG + Intergenic
924218895 1:241853480-241853502 AAGTAAGACAAAGGGGCAGATGG + Exonic
924253949 1:242163437-242163459 AATTAAGACTTGAGGGAAGCTGG - Intronic
924269217 1:242315472-242315494 GAGTAAGCCTGAAGGGTAGAAGG - Intronic
1062833870 10:623666-623688 ATGCAAGGCTGAAGGGAGGAGGG + Intronic
1063144365 10:3283443-3283465 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1063257610 10:4345651-4345673 AAGGAAGAAGGAAGGGAGGAAGG + Intergenic
1063433519 10:6011894-6011916 AAGAAAGAAGGAAGTGAAGAGGG - Exonic
1063442658 10:6085758-6085780 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1063570085 10:7207427-7207449 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1063625150 10:7682201-7682223 AAGAAAGACAGAAGGGAGGGAGG + Intergenic
1063713131 10:8500077-8500099 AAGAAAGACAGAAAGAAAGAAGG - Intergenic
1063829809 10:9940081-9940103 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1063988368 10:11532960-11532982 GAGAAACAATGAAGGGAAGAAGG - Intronic
1064093237 10:12403022-12403044 AAGCAAAACCGAAGGGAAAAAGG - Intronic
1064526295 10:16260335-16260357 AAGAAAGAATGAAGAGAGGAAGG + Intergenic
1064583411 10:16816433-16816455 CAGTGAAACTGAAGGCAAGAGGG + Intronic
1064592359 10:16907400-16907422 AAGTATCACTAAAGGGAAAATGG + Intronic
1064823948 10:19373545-19373567 AAGGAAGAGGAAAGGGAAGAAGG + Intronic
1065004515 10:21367155-21367177 AGGTAAGAGTGAAGGTGAGATGG - Intergenic
1065011320 10:21423453-21423475 AAGAAAGAATGAAAGAAAGAAGG + Intergenic
1065202932 10:23331309-23331331 AGGGAAGAGGGAAGGGAAGAGGG + Intronic
1065348032 10:24767682-24767704 AAGTAAGAAGGAAGGAAGGAAGG - Intergenic
1065526245 10:26624107-26624129 AATTTAGACTGAAGAGAAAAAGG - Intergenic
1065633918 10:27711400-27711422 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1065874170 10:29982927-29982949 CAGAAAGAAGGAAGGGAAGAAGG + Intergenic
1066250104 10:33624909-33624931 AAGTAAGAGAGAGGGGAGGAAGG + Intergenic
1066260520 10:33725218-33725240 GACTAAGACTGAAGGGACAAGGG - Intergenic
1066430181 10:35344007-35344029 AAATAATACTGAAAGGATGAGGG - Intronic
1066488513 10:35872156-35872178 CAGTAACAGGGAAGGGAAGAAGG + Intergenic
1066549382 10:36538533-36538555 AAGAAAGAGAGAAGGGAAGGAGG + Intergenic
1067218582 10:44324370-44324392 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1067809385 10:49415617-49415639 AAGAAAGACAGAAGAGGAGAAGG + Intergenic
1067867841 10:49927316-49927338 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1067908696 10:50321802-50321824 AAGTAAGAAAGAACTGAAGAAGG + Intronic
1068227540 10:54125552-54125574 AAGCAAAGCTGAAGGGAATAAGG + Intronic
1068557141 10:58471541-58471563 AGGTAAGAAGGAAGGAAAGAGGG - Intergenic
1068766095 10:60765448-60765470 AAGAATGACAGAAGAGAAGAAGG + Intergenic
1069124282 10:64609807-64609829 AAGGAAGACGGAAGGAAGGAAGG - Intergenic
1069169838 10:65212862-65212884 AAGTAAGGAGGGAGGGAAGAAGG + Intergenic
1069195092 10:65541877-65541899 CAGTAAGTCAGAAAGGAAGATGG - Intergenic
1069285243 10:66706239-66706261 AAGGAAGAATGAATGGATGAAGG - Intronic
1069726113 10:70580185-70580207 AAGAAAGAATGAATGAAAGAAGG - Intergenic
1069751011 10:70744946-70744968 AAGTGAGACGGAGAGGAAGAGGG + Intronic
1069784102 10:70977088-70977110 AAATAAGACTGAGTGGAGGAAGG + Intergenic
1069909145 10:71749288-71749310 AAGAAAGAAAGAAGGAAAGAGGG - Exonic
1070082478 10:73202660-73202682 AAGGAAGAGGGAAGGGATGAAGG - Intronic
1070343973 10:75523794-75523816 AAGAAAGGATGCAGGGAAGAAGG - Intronic
1070442142 10:76456835-76456857 AAATAAAAAAGAAGGGAAGAAGG - Intronic
1070512902 10:77177285-77177307 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1070525664 10:77293766-77293788 AAGCAAGGCTGAGGGAAAGAAGG + Intronic
1070865120 10:79703990-79704012 AGGTAAGCCTGTAGGGATGAGGG + Exonic
1070865390 10:79705576-79705598 AAGGAAGATTGAAGAGGAGATGG + Intronic
1070879182 10:79843707-79843729 AAGGAAGATTGAAGAGGAGATGG + Intronic
1071134966 10:82443136-82443158 GAGTAAGAAAGAAGGGGAGAGGG + Intronic
1071442115 10:85708662-85708684 AAGCAAAACTTAAGAGAAGATGG + Intronic
1071463522 10:85920153-85920175 AAGAAAGACAGCAGGGAAGTGGG - Intronic
1071632289 10:87227797-87227819 AAGGAAGATTGAAGAGGAGATGG + Intronic
1071645742 10:87360015-87360037 AAGGAAGATTGAAGAGGAGATGG + Intronic
1071864149 10:89707558-89707580 AGGTAAAAGGGAAGGGAAGAAGG - Intronic
1072333516 10:94376590-94376612 AGGAAAGAAGGAAGGGAAGAGGG - Intergenic
1072556591 10:96520257-96520279 AAGTAAGAAGGAAGAGAAAATGG + Exonic
1072629769 10:97137580-97137602 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1072852507 10:98911052-98911074 AAGAAAGAGGAAAGGGAAGAAGG + Intronic
1073285519 10:102385267-102385289 CAGGAAGAAGGAAGGGAAGAGGG - Intergenic
1073520230 10:104121753-104121775 AAGGAAGCCTGAAGGGAAGGCGG + Intergenic
1073767437 10:106698813-106698835 AAGAAAGAATGAAGGGGATAAGG - Intronic
1074126671 10:110534097-110534119 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
1074195414 10:111180287-111180309 AAGAAGGAAGGAAGGGAAGAAGG - Intergenic
1074471977 10:113735557-113735579 AAAAAAGGCTGAAGGGAAGGTGG + Intergenic
1074637862 10:115342085-115342107 AAGCAAGACAGAAAGAAAGAAGG - Intronic
1075496690 10:122926953-122926975 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076558752 10:131347208-131347230 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1077761360 11:5103148-5103170 AAGGAAGAAGGAAGGTAAGAAGG + Intergenic
1078356039 11:10632170-10632192 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1078488601 11:11747802-11747824 AGGAAAGAATGAAGGGAGGAAGG + Intergenic
1078665429 11:13321079-13321101 AAGGCAGAGTGAAGGGAAAAGGG - Intronic
1078973736 11:16446904-16446926 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1079009157 11:16814234-16814256 GAGTAAGACAGAACAGAAGAAGG + Intronic
1079031331 11:16988424-16988446 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1079104179 11:17559805-17559827 AGGAAAGAAGGAAGGGAAGAAGG + Intronic
1079104188 11:17559847-17559869 AGGAAAGAAGGAAGGGAAGAAGG + Intronic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079546040 11:21633030-21633052 AGGGAAGACTGTAGGGAAAATGG - Intergenic
1079656881 11:22995821-22995843 AAGAAAGCCTCAAGGGAAAACGG - Intergenic
1079681695 11:23304959-23304981 AGGTAAGAGTTAAGGGAAAAGGG - Intergenic
1080016955 11:27517781-27517803 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1080170946 11:29302029-29302051 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1080281196 11:30558756-30558778 AAGAAAGAAAGAAGGAAAGAGGG - Intronic
1080295132 11:30717965-30717987 AGGTCAAACTGAAGAGAAGAGGG - Intergenic
1080426766 11:32162208-32162230 CAGTAAGAGTGAGGTGAAGATGG - Intergenic
1080466685 11:32504059-32504081 AAGGAAGACGGAAGAAAAGAAGG + Intergenic
1080539002 11:33248762-33248784 TGGAAGGACTGAAGGGAAGAAGG + Intergenic
1080995617 11:37597022-37597044 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1081225700 11:40519445-40519467 TAGTAAGGCTGAAGGAAAGAAGG - Intronic
1081271043 11:41082826-41082848 GAGGAAGACTTAATGGAAGAAGG - Intronic
1081562055 11:44226714-44226736 GACGAAGCCTGAAGGGAAGAAGG + Intronic
1081603033 11:44508493-44508515 AAGAAAGAAGGAAAGGAAGAGGG - Intergenic
1081639341 11:44742268-44742290 AAGAAAGAAGGAAGGGAAAAAGG - Intronic
1081708520 11:45201473-45201495 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1081741032 11:45440832-45440854 AAGTGAGACAGAAGAAAAGAAGG - Intergenic
1082018318 11:47509568-47509590 AAATAAGGCTAAAGGGAAAAAGG + Intronic
1082772980 11:57222949-57222971 AAGAAAGACAGAAGGGATGCAGG - Intergenic
1082913933 11:58410319-58410341 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1083111230 11:60409794-60409816 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1084286166 11:68132474-68132496 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1084864464 11:72044484-72044506 GAGGCAGACTGATGGGAAGAAGG - Intronic
1085012365 11:73150093-73150115 AAGTAAGACAGAAGGAAGGAAGG - Intergenic
1085746355 11:79117890-79117912 AGGTATGTCTGAAGGGAAGGGGG - Intronic
1085781305 11:79411612-79411634 AAGAAAGACTGGAGGGAGAAGGG - Intronic
1086233692 11:84600096-84600118 AAGTAAGAAGGAAGGAAGGAAGG + Intronic
1086528283 11:87755074-87755096 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1086798563 11:91141110-91141132 AAGAAACAAAGAAGGGAAGAGGG + Intergenic
1087350303 11:97022634-97022656 AAAGAAGACAGAAAGGAAGAAGG + Intergenic
1087593658 11:100225476-100225498 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1087621703 11:100550324-100550346 AGGAAAGACTGAAGGGTAAATGG + Intergenic
1088274930 11:108075068-108075090 AAAATATACTGAAGGGAAGAAGG + Intronic
1088394882 11:109355881-109355903 AAGAAAGAAAGAAGGGAAGGAGG - Intergenic
1088973220 11:114791653-114791675 AAGTAAAATTGAAGCAAAGATGG + Intergenic
1088976262 11:114818859-114818881 AAGGAAGAGTGAAGAGGAGAAGG + Intergenic
1089141166 11:116285552-116285574 AAGGAAGACAGAAGGAATGATGG + Intergenic
1089196325 11:116695898-116695920 GAGAAAGAAGGAAGGGAAGAAGG - Intergenic
1089333158 11:117704111-117704133 AAGGAAGAAGGAAGGGAGGAGGG + Intronic
1089566975 11:119376810-119376832 ATGTGAGACTGCAGAGAAGATGG - Intronic
1089918339 11:122181737-122181759 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1090040210 11:123284072-123284094 AAGTAAGAAGGAAGGAAGGAAGG - Intergenic
1090267371 11:125361787-125361809 GAGGAAGTCTGAAGGGAAGTTGG + Intronic
1090285107 11:125493412-125493434 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1090420519 11:126572184-126572206 GACTAAGACTGAAGGCAATAAGG + Intronic
1090581521 11:128165322-128165344 AAATCAGGATGAAGGGAAGAGGG - Intergenic
1090644473 11:128756723-128756745 AAGTAAGTCTTCAGAGAAGATGG - Intronic
1090742324 11:129675857-129675879 AAGAAAGAATGAAAGAAAGAAGG + Intergenic
1090846467 11:130533802-130533824 AATTAGGACTGAAGGGCTGAAGG - Intergenic
1091470511 12:722125-722147 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1091470516 12:722220-722242 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1091470518 12:722248-722270 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1091470520 12:722305-722327 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1091693433 12:2612089-2612111 AAGGCAGAATGAGGGGAAGAGGG + Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1092334987 12:7624455-7624477 AAGTAAAATTGAAGGGGAGGTGG - Intergenic
1093621630 12:21297217-21297239 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1094196493 12:27755201-27755223 AAGTAAGACTGAAGCAGACATGG + Exonic
1094729562 12:33158896-33158918 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1094775595 12:33723797-33723819 CAGTTAAAGTGAAGGGAAGAGGG - Intergenic
1095378070 12:41555408-41555430 AAAAAAGAATGAAGGGAAAAAGG + Intronic
1095813325 12:46394856-46394878 AAGTAAGGAAGAAGGGAGGAAGG + Intergenic
1096079853 12:48826128-48826150 AAGGAAGAGAAAAGGGAAGAGGG - Intronic
1096149975 12:49303241-49303263 AAGGAAGACTGAAGTGAAATGGG + Intergenic
1096757499 12:53812411-53812433 AAGGAAGAAAGAAGGAAAGAAGG - Intergenic
1096849410 12:54426017-54426039 AAGGAAAACTCAAGGAAAGAGGG + Intergenic
1097456698 12:59807188-59807210 AAGTAACAGTGCAGGGAAGGGGG + Intergenic
1097955225 12:65478529-65478551 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1098310485 12:69143736-69143758 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1099351532 12:81576088-81576110 ACTTAAAACTGAAGGGAAGCTGG - Intronic
1099779056 12:87171266-87171288 AGGAAAGAAGGAAGGGAAGAAGG + Intergenic
1100457138 12:94763496-94763518 ACGTAAGACTGGAGGGATGGAGG - Intergenic
1100683151 12:96952161-96952183 AAGTAAGAGTAAAAGGATGATGG + Exonic
1100742865 12:97614539-97614561 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1100749764 12:97685675-97685697 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
1101225268 12:102681936-102681958 AAGAAAGAATGAAGGGAGGGAGG - Intergenic
1101738684 12:107483012-107483034 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1102129089 12:110510960-110510982 AAGAAAGAGAGAAAGGAAGAAGG + Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1102659694 12:114515023-114515045 AAGTATGACTGAAGGACAAAGGG + Intergenic
1102825589 12:115945503-115945525 GACTAATACAGAAGGGAAGAAGG + Intergenic
1103188812 12:118982909-118982931 GTTTAAGAATGAAGGGAAGAAGG + Intronic
1103701304 12:122850088-122850110 AACTATGACTAAAGGGGAGACGG + Intronic
1103767537 12:123291739-123291761 AAATAGAGCTGAAGGGAAGAGGG + Exonic
1104489524 12:129182021-129182043 AGGCAAGAGTGAAGGGATGAGGG + Intronic
1104575398 12:129962144-129962166 AAGAAAGAAGGAAGGGAAGAAGG - Intergenic
1104710861 12:130984869-130984891 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1105054769 12:133088151-133088173 AAGGAAGAAAGAAGGGAGGAAGG + Intronic
1105390217 13:19969667-19969689 AAGTGAGCCTGAAGCAAAGAAGG - Intronic
1105416584 13:20218583-20218605 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1105473648 13:20713196-20713218 AAGGAAGAGTGAAGGACAGAGGG + Intronic
1105518005 13:21107770-21107792 AAATAATACAGAGGGGAAGAAGG + Intergenic
1105774291 13:23642626-23642648 AAGAAAGAGGGAAGGAAAGAGGG + Intronic
1106332614 13:28753387-28753409 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1106655110 13:31734840-31734862 AAGTAAGTCTAAAGGGTAGAAGG - Intergenic
1106756826 13:32830060-32830082 AAGTAAGACTTGTGGAAAGAGGG - Intergenic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107292500 13:38871646-38871668 AATTAAGACTCAAAGGAAAAAGG - Intronic
1107368341 13:39711596-39711618 GAGTAAGACTGATGAGAAGGAGG - Intronic
1107619153 13:42207049-42207071 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1107823540 13:44307245-44307267 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1107842602 13:44474694-44474716 AAATAAGAATGGAGGGAAGAAGG + Intronic
1108359269 13:49654275-49654297 AAGGAAGAAAGAGGGGAAGAAGG + Intergenic
1108964363 13:56277658-56277680 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1109136901 13:58662777-58662799 AAGGAAGAAAGAAGGAAAGAAGG + Intergenic
1110154025 13:72291862-72291884 AAATAAGACTAAATGGGAGATGG - Intergenic
1110369782 13:74727169-74727191 GAGAAAGAGTGAAGGAAAGAAGG + Intergenic
1110497750 13:76189615-76189637 AGGTAAGAATGGAGGGAAAAGGG - Intergenic
1110585754 13:77189896-77189918 AAGTGAGATTGCAGGGAAGATGG - Intronic
1110595885 13:77319991-77320013 ACGTAAGACTGAACAGAGGAAGG + Intronic
1111228487 13:85308210-85308232 AGGTAAGAATGAAGAGAAGCTGG - Intergenic
1111519830 13:89386111-89386133 AAGAAAGACAGAAAGAAAGAAGG - Intergenic
1112214081 13:97412068-97412090 AGGTGAGACTGAAGGGAAGTTGG - Intergenic
1112647049 13:101345908-101345930 AGTTAAGACTGAAGCGAAGATGG + Intronic
1113104352 13:106757240-106757262 AAGTAAGAAGGAAAGAAAGAAGG + Intergenic
1113135944 13:107089868-107089890 AAGGAAGAGGGAAGGGAAAAGGG - Intergenic
1113278977 13:108767654-108767676 TGGTAAGAGTGAAGGGAAGAAGG + Intronic
1113383965 13:109830385-109830407 CAGTAAGTCACAAGGGAAGAGGG - Intergenic
1113664097 13:112128815-112128837 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1114276047 14:21146012-21146034 AAGAAAGACAGAAAGAAAGAAGG - Intergenic
1114379788 14:22190286-22190308 AAGTAAGAGGTAAGGGAAGTGGG + Intergenic
1114592915 14:23884564-23884586 AAGGCAGACTTAAGGGAGGAAGG + Intergenic
1114632430 14:24167804-24167826 GGACAAGACTGAAGGGAAGAAGG - Intergenic
1114650411 14:24281090-24281112 AAAGAACACTGAGGGGAAGAGGG + Intergenic
1114672660 14:24419920-24419942 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1114798504 14:25743731-25743753 AAGAATGAATGAAGGAAAGAAGG - Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1115146995 14:30237710-30237732 AAGTAAAACTGAAAGCCAGAAGG + Intergenic
1115301271 14:31888134-31888156 AGGAAAGACGGAAGGAAAGACGG - Intergenic
1115301273 14:31888146-31888168 AGGAAAGACGGAAGGAAAGACGG - Intergenic
1115440581 14:33430267-33430289 AAGAAGAACTGAAGGGAAGGCGG - Intronic
1115922414 14:38390825-38390847 ACATAAGAATGAAGGGAATAAGG + Intergenic
1116375828 14:44199524-44199546 AAGAAAGAAAAAAGGGAAGAAGG + Intergenic
1116549204 14:46213076-46213098 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1116939962 14:50781564-50781586 GAGTAAGAATCCAGGGAAGAAGG - Intronic
1117247438 14:53900160-53900182 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1117962733 14:61178951-61178973 AAGGCAAACTGAAGGGAAAATGG + Intergenic
1118039431 14:61901043-61901065 AAGTAAGTCAGAAGGGAAATTGG - Intergenic
1118377873 14:65192516-65192538 ATGGAAGAATTAAGGGAAGAGGG + Intergenic
1118451554 14:65907099-65907121 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1118546836 14:66900133-66900155 AAGCAAGACTGAAAAAAAGATGG - Intronic
1118848056 14:69563013-69563035 AAGAAAGACAGAAAGAAAGAGGG - Intergenic
1119095169 14:71823360-71823382 AAGGAAGAAAGAAGGGAAGGAGG - Intergenic
1119524140 14:75308957-75308979 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1120251641 14:82066267-82066289 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1120294818 14:82626427-82626449 AAATAAGACAAAAGGGAGGAGGG + Intergenic
1120414978 14:84207873-84207895 AATTAAGAATAAAGTGAAGAGGG + Intergenic
1120420302 14:84276826-84276848 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1120629477 14:86872579-86872601 AAGAAAGAAAGAAGGAAAGAGGG + Intergenic
1120648563 14:87102719-87102741 AGGTAAGATTGGAGAGAAGAAGG - Intergenic
1120656043 14:87191097-87191119 AAATAAGAAAGAAGGTAAGAGGG + Intergenic
1120759159 14:88270639-88270661 AAGGCAGACTGGGGGGAAGAGGG + Intronic
1120766809 14:88335091-88335113 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1120828660 14:88978421-88978443 AAGAAGAACTGAAGTGAAGAGGG + Intergenic
1121141371 14:91545374-91545396 AAGAAAGAAGGGAGGGAAGAAGG - Intergenic
1121381919 14:93479284-93479306 AAGAAAGAAAGAAGGGACGAAGG - Intronic
1121533052 14:94671996-94672018 AAGACAGACTGAACTGAAGAGGG - Intergenic
1121566451 14:94913660-94913682 AAGAAAGAAAGAAAGGAAGAAGG - Intergenic
1121578711 14:95010349-95010371 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1121800203 14:96768671-96768693 AAGGAAGAAGGAAGGGAAGGAGG - Intergenic
1121898427 14:97670635-97670657 AAGCAAAACTGAATGGAAGGTGG - Intergenic
1121990851 14:98555747-98555769 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1122006514 14:98708802-98708824 AAGGAAGAAAGAAAGGAAGAAGG - Intergenic
1122040412 14:98983849-98983871 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1123395787 15:19933619-19933641 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1123470182 15:20545162-20545184 AAATAAAAATAAAGGGAAGATGG - Intergenic
1123482848 15:20650054-20650076 AAGAAATAATGAAGGGCAGAAGG - Intergenic
1123647872 15:22455539-22455561 AAATAAAAATAAAGGGAAGATGG + Intergenic
1123727778 15:23121721-23121743 AAATAAAAATAAAGGGAAGATGG + Intergenic
1123730481 15:23140143-23140165 AAATAAAAATAAAGGGAAGATGG - Intergenic
1123748619 15:23337561-23337583 AAATAAAAATAAAGGGAAGATGG - Intergenic
1124017048 15:25886327-25886349 AAGTAAGAGGGAAAGGAAAAGGG + Intergenic
1124280993 15:28361450-28361472 AAATAAAAATAAAGGGAAGATGG - Intergenic
1124301709 15:28550175-28550197 AAATAAAAATAAAGGGAAGATGG + Intergenic
1124577970 15:30926245-30926267 AAGGAACACTGAATGGAAGTGGG - Intronic
1124719012 15:32095650-32095672 ATGGAAGACTCAAGGGAAAAGGG + Intronic
1125060869 15:35421872-35421894 AAATAAGACTGAAGGTAAGAAGG + Intronic
1125121232 15:36161143-36161165 GAGAAAGACTGAAGGGAAGAAGG + Intergenic
1125353819 15:38795230-38795252 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1125415625 15:39449352-39449374 AATGAAGACTGAAGGGCAGAAGG - Intergenic
1125617803 15:41031404-41031426 AAGTGAAAGAGAAGGGAAGAGGG + Intronic
1125743155 15:41981504-41981526 GAGGAAGCCTGAAGGGATGAGGG + Intergenic
1125873016 15:43119548-43119570 AGAAAAGAGTGAAGGGAAGAAGG + Intronic
1125892758 15:43278318-43278340 AAGGAAGGGTGAATGGAAGAGGG - Intronic
1126367203 15:47906561-47906583 AAGTAAGAAGGAAGGAAGGAAGG - Intergenic
1126846032 15:52761236-52761258 AAGTAAGACTGGACAGAAGGAGG - Intronic
1127226816 15:56940024-56940046 ATGTGAGACTGAGGGGAAAATGG + Intronic
1127501595 15:59558967-59558989 AAGTAACTCTGTAGGAAAGAAGG - Intergenic
1127702902 15:61518609-61518631 AAGTAAGGCTCAGGGGAATATGG - Intergenic
1127784837 15:62346554-62346576 AAGTATGTCTGTTGGGAAGAGGG + Intergenic
1127927033 15:63556942-63556964 CAGTAACGCTGATGGGAAGAAGG - Intronic
1129146355 15:73651155-73651177 AAGAAAGAAAGAAGGCAAGAAGG + Intergenic
1129949370 15:79572410-79572432 AAGGAAGAAAGAAAGGAAGAAGG + Intergenic
1130080896 15:80732623-80732645 AAGGAAAACAGAAGGTAAGACGG + Intronic
1130850830 15:87792087-87792109 AAGTAACCCTGAAGGGAGCAAGG - Intergenic
1130910523 15:88267536-88267558 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
1131036804 15:89227772-89227794 AAGTAAAAAGGAAGTGAAGATGG + Intergenic
1131109310 15:89754883-89754905 AATGTAGATTGAAGGGAAGATGG - Intergenic
1131141995 15:89984247-89984269 AAGAAAGAATGAAGGAAAGAAGG - Intergenic
1131627792 15:94142128-94142150 AAGAAGGAATGAAGGGAGGAAGG - Intergenic
1131797882 15:96038508-96038530 AAGTAAGCTTGTAGAGAAGAAGG - Intergenic
1131875181 15:96798445-96798467 AAGAAAAACTTTAGGGAAGAAGG - Intergenic
1132918045 16:2364759-2364781 AAGAAAGAAGGAAGGGAAGGAGG + Intergenic
1133322052 16:4920292-4920314 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1133497674 16:6335193-6335215 ACGTAAGGCAGACGGGAAGATGG + Intronic
1133551158 16:6855802-6855824 AAGGAGGAAGGAAGGGAAGAAGG - Intronic
1133569637 16:7027988-7028010 AGGCAAGAAGGAAGGGAAGAAGG + Intronic
1133717850 16:8466642-8466664 AAGAAAGAGGGAAGGAAAGAAGG + Intergenic
1134002192 16:10791599-10791621 AAATAAGAGAGAAGGGAAGATGG - Intronic
1134491299 16:14697474-14697496 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1134496680 16:14736592-14736614 AAGAAAGAAGGAAGGGAGGAAGG - Intronic
1135200739 16:20435951-20435973 AAGGAAGAAAGAAGGAAAGAAGG - Intronic
1135501373 16:22998924-22998946 AAGCAAGAAGGAAGGAAAGAAGG + Intergenic
1135529064 16:23237090-23237112 AAGAAAGAAGGAAGGAAAGAGGG - Intergenic
1135626944 16:24003683-24003705 AATTATGAATGCAGGGAAGATGG - Intronic
1135874571 16:26186317-26186339 AAGTCTCTCTGAAGGGAAGAAGG - Intergenic
1136039041 16:27563529-27563551 AAGAAAGACTGCAGGGAAGAGGG + Intronic
1136651822 16:31679512-31679534 AGGTAAGACTGAAGAGTAGAAGG - Intergenic
1136726256 16:32359920-32359942 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1136798688 16:33048802-33048824 AAGAAAGAAAGAAGGGAGGAAGG + Intergenic
1136844599 16:33565999-33566021 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1136948950 16:34691502-34691524 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1136956442 16:34792014-34792036 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1136968319 16:34941832-34941854 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1137093369 16:36222036-36222058 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1137219777 16:46437237-46437259 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1137414596 16:48263645-48263667 AAGTAATACTGCAGTGAATACGG + Intronic
1137683343 16:50369271-50369293 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1137750544 16:50858292-50858314 AAGTAGGGCTGATGGCAAGAAGG + Intergenic
1137923887 16:52521213-52521235 AAGAAAGCCTGAAAGGAAAATGG + Intronic
1137953276 16:52803725-52803747 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138284493 16:55798323-55798345 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1138284495 16:55798365-55798387 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1138486684 16:57349779-57349801 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1138578173 16:57922186-57922208 AAAAAAGACTGGAAGGAAGAAGG + Intronic
1138621156 16:58212487-58212509 AAGCAAGTAAGAAGGGAAGAAGG + Intergenic
1138771228 16:59666151-59666173 AAGGAAGATAGAAAGGAAGATGG + Intergenic
1138780769 16:59782557-59782579 AAGTAAAATGGAAGGGAGGAAGG + Intergenic
1139188754 16:64837589-64837611 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1140306446 16:73807308-73807330 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1140449520 16:75059209-75059231 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1140831050 16:78751752-78751774 AAGGAAGGAGGAAGGGAAGAAGG + Intronic
1140866435 16:79066490-79066512 AAGGAAGGGGGAAGGGAAGAAGG + Intronic
1140949082 16:79798470-79798492 CAGCCAGACTGAAGGGAAGAGGG - Intergenic
1140962779 16:79932621-79932643 AATAAAGAAAGAAGGGAAGAAGG - Intergenic
1141196065 16:81862199-81862221 AGGAAAGACTGAAGGCGAGAGGG + Intronic
1141234595 16:82203724-82203746 AAGAAAGACAGAAGGAAGGAAGG - Intergenic
1141264851 16:82487709-82487731 AAAAAAGACTAAAGGGAGGATGG - Intergenic
1141557568 16:84846150-84846172 AAGGAAGAAGGAAAGGAAGAAGG - Intronic
1141557570 16:84846162-84846184 AAGGAAGAAGGAAAGGAAGAAGG - Intronic
1141756231 16:85992918-85992940 AAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756235 16:85992934-85992956 AAGAAGGACAGAAAGGAAGAAGG - Intergenic
1141756243 16:85992985-85993007 CAGAAAGACAGAAGGGAAGAAGG - Intergenic
1141756246 16:85993009-85993031 AGGAAGGACAGAAGGGAAGAAGG - Intergenic
1142437930 16:90074895-90074917 AGGTAAGAGGGAAGGGAAGGAGG - Exonic
1203000176 16_KI270728v1_random:157836-157858 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1203131777 16_KI270728v1_random:1694239-1694261 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1142615702 17:1133719-1133741 AAGCAAGGAAGAAGGGAAGACGG - Intronic
1142832860 17:2562266-2562288 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1143276757 17:5717277-5717299 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143336757 17:6177259-6177281 CAGAAAGACTCAAGGGAAGAAGG + Intergenic
1143351105 17:6288925-6288947 AAGTAACACTGAAGGCCTGAGGG + Intergenic
1144307968 17:13986615-13986637 AAGTAAGAAGAAAGGGAGGATGG - Intergenic
1145061232 17:19735558-19735580 AAGCAAGAGTGGAGGAAAGAAGG + Intergenic
1146553161 17:33799478-33799500 AAGTAAGAAAGAAAGAAAGAAGG - Intronic
1146588017 17:34099712-34099734 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1146719781 17:35115873-35115895 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1146771273 17:35570830-35570852 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1147997093 17:44366103-44366125 AAGGAAGACTGAAGACCAGAAGG - Intergenic
1148679573 17:49465978-49466000 ATGTGAGACTGAAAGGGAGAAGG - Intronic
1149192288 17:54077517-54077539 TACTAAGTCTGAAGGGCAGAGGG - Intergenic
1150502078 17:65660514-65660536 AAGAAAGGAAGAAGGGAAGAAGG - Intronic
1150908739 17:69366299-69366321 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1150993779 17:70292146-70292168 AAGTAAGACAGAGGGAATGAGGG + Intergenic
1151483729 17:74385715-74385737 AAGGAAGAAAGAAGGAAAGAAGG + Intergenic
1151884226 17:76914121-76914143 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1152166586 17:78712071-78712093 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152909013 17:82986523-82986545 AAGTAAATCTAAATGGAAGAAGG + Intronic
1203183921 17_KI270729v1_random:93578-93600 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1152988660 18:342662-342684 ACGAGAGACTGAGGGGAAGAAGG - Intronic
1153020781 18:626917-626939 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1153062646 18:1010008-1010030 TGGTGAGACTGAAGGGAACAAGG - Intergenic
1153708468 18:7772312-7772334 AAGAAAGAACGAAGGGAGGAAGG - Intronic
1153909428 18:9694079-9694101 AGGAAAGAAGGAAGGGAAGAAGG - Intergenic
1154066234 18:11109935-11109957 AAGTCAGACAGAAAGGTAGAGGG + Intronic
1154180324 18:12132421-12132443 AAGGAAGAAAGAAGGGAGGAAGG - Intergenic
1155028007 18:21959854-21959876 AAGAAGGACAGAAGGAAAGAAGG + Intergenic
1155146707 18:23089750-23089772 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1155146719 18:23089858-23089880 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1155146731 18:23089986-23090008 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1155610685 18:27664136-27664158 AATTAAGACTCATGGTAAGATGG + Intergenic
1155710798 18:28876673-28876695 ATGTAAGAATGAAGGAAGGAAGG - Intergenic
1156103037 18:33621604-33621626 AAGGAAGACTGAAAAGAACAAGG + Intronic
1156148125 18:34211094-34211116 AAGGAAGAAGGAAGGAAAGAAGG + Intronic
1156346517 18:36261759-36261781 AAGTAAGGATGGAGGGATGAGGG - Intronic
1156512712 18:37654731-37654753 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
1156519287 18:37708066-37708088 AAGTATGACTGGAAGGGAGAAGG - Intergenic
1156558393 18:38093123-38093145 AAGAAAGAAAGAAGGGAGGAAGG + Intergenic
1156602103 18:38619619-38619641 AAGAAAGAATGAAGGAATGAAGG - Intergenic
1156776160 18:40791955-40791977 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1156877948 18:42038985-42039007 AGGAAAGACAGAAGGGAAGCAGG - Intronic
1157181695 18:45504059-45504081 CAGTAAGATGGAAGGGAAGGAGG + Intronic
1157631151 18:49097393-49097415 AAGACAGACTGAAGGTAAGAAGG - Exonic
1158219870 18:55139524-55139546 AAGGAAGAAGGAAGGAAAGAGGG - Intergenic
1158473891 18:57762567-57762589 GAGTAAGACTTAATGCAAGAGGG - Intronic
1158608443 18:58917066-58917088 CAGTCAGTCGGAAGGGAAGAGGG - Intronic
1158820454 18:61153017-61153039 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1159063468 18:63541764-63541786 AACAGAGACAGAAGGGAAGAGGG + Intergenic
1159079752 18:63724051-63724073 AAGGAAGAAGGAAGGGGAGAAGG - Intronic
1159337448 18:67088349-67088371 AAGAAGGAGGGAAGGGAAGAAGG + Intergenic
1159516588 18:69466773-69466795 AAGTAAGAGGGAGGGAAAGAGGG + Intronic
1159619313 18:70619263-70619285 CCCAAAGACTGAAGGGAAGAAGG - Intergenic
1159633986 18:70783029-70783051 AAGTGAGAAAGAAGGAAAGAAGG - Intergenic
1159677205 18:71299693-71299715 AAGGAAGAAAGAAGGGGAGAGGG - Intergenic
1159691055 18:71487775-71487797 AAGTAGGTCTGAATGGAAAAAGG - Intergenic
1160153965 18:76418882-76418904 ATGGAAGCCTGAAGGGCAGAGGG + Intronic
1160174922 18:76585383-76585405 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174927 18:76585449-76585471 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174932 18:76585497-76585519 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174937 18:76585549-76585571 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174942 18:76585611-76585633 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174947 18:76585681-76585703 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174952 18:76585725-76585747 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1160174957 18:76585779-76585801 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1161559018 19:4960530-4960552 AAGTGAGACTGAAGGTCAGAGGG + Intronic
1161920083 19:7259420-7259442 AAATAAGATTGTTGGGAAGATGG + Intronic
1162424358 19:10585234-10585256 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1162514541 19:11140025-11140047 AAGAAAGAATGAAGGAAGGAAGG - Intronic
1162537734 19:11273607-11273629 AAGAAGGACAGAAGGAAAGAAGG - Intergenic
1162648614 19:12067934-12067956 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1163040467 19:14598444-14598466 AAGTAAGAAGGAAGGAAAGAAGG - Intronic
1163430399 19:17263877-17263899 AAGTCAGGCTGAAGGCAATAGGG + Intronic
1164749762 19:30644249-30644271 AACTAAGAATGAAAGGAAGGAGG - Intronic
1164911859 19:32019156-32019178 AAGGAAGAAAGAAGGAAAGAAGG + Intergenic
1164967027 19:32494183-32494205 TACTAAGATTGGAGGGAAGAAGG + Intergenic
1165198784 19:34128537-34128559 AGGAAAGACTTCAGGGAAGACGG + Intergenic
1165970592 19:39625552-39625574 AAGAAAGAATGAAAGAAAGAAGG - Intergenic
1166983431 19:46645523-46645545 AAATAAGAAGGAAGGAAAGAAGG + Intergenic
1167608628 19:50495195-50495217 AAGTTAGAGATAAGGGAAGAAGG + Intergenic
1167702081 19:51054787-51054809 AAGAAAGACCGAAAGGATGAAGG - Intergenic
1168082293 19:54019032-54019054 AAGGAAGATAGAAGGGGAGAAGG + Intergenic
1168128921 19:54304890-54304912 AAGAAAGAAAGAAGGGAAGAAGG - Intergenic
1168434049 19:56303531-56303553 AGGCAAGACGGAAGGGAAGGAGG + Intronic
1202682350 1_KI270712v1_random:18676-18698 AAGAAAGAAAGAAGGGAGGAAGG + Intergenic
1202682398 1_KI270712v1_random:18949-18971 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1202697067 1_KI270712v1_random:132965-132987 AGAAAAGGCTGAAGGGAAGACGG - Intergenic
925458651 2:4041643-4041665 AAGTGAGACAGAAGGAAAGAAGG - Intergenic
925746314 2:7046651-7046673 AAGGAAAACAGGAGGGAAGAGGG - Intronic
925965653 2:9062921-9062943 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
926272045 2:11374099-11374121 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
926359159 2:12068833-12068855 AATAAAGGCTGAAGGGAAGGGGG + Intergenic
926368246 2:12153347-12153369 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
926419534 2:12682900-12682922 TGGAAAGGCTGAAGGGAAGAGGG - Intergenic
926497778 2:13613150-13613172 AAGAAAGAGTGAAAGGAATAAGG + Intergenic
926809908 2:16746686-16746708 AAGGAAGAAAGAAGGAAAGAAGG - Intergenic
926875975 2:17479260-17479282 AAATAAGAAAGAAGGGGAGAGGG + Intergenic
926911706 2:17857663-17857685 AAGGAAGAAAGAAGGAAAGAAGG - Intergenic
927228210 2:20791652-20791674 AAGGAAGAAAGAAGGGAGGAAGG + Intronic
927412299 2:22840756-22840778 AAATAAGAGTGAAATGAAGATGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928086835 2:28351192-28351214 AGGTAAGCCTGCTGGGAAGAGGG - Intergenic
928184218 2:29095075-29095097 AAGGAAGAGTCAAGGGAAAAGGG - Intergenic
928634525 2:33229478-33229500 AAGAAAGAAGGAAGGGAGGAAGG + Intronic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
928835690 2:35541713-35541735 AAGGAAGGAAGAAGGGAAGAAGG - Intergenic
928877449 2:36056715-36056737 AAGAAAGAAGGGAGGGAAGAAGG + Intergenic
929046798 2:37798370-37798392 AAGAAAGATGGAAGGGAGGAAGG - Intergenic
929362137 2:41104462-41104484 AAATAAGACTGATAGGAAAAAGG + Intergenic
929529062 2:42734626-42734648 AAGGAAGACAGGAAGGAAGAAGG - Intronic
929555320 2:42922173-42922195 AACAAAGACTGTCGGGAAGAGGG - Intergenic
930107800 2:47653716-47653738 AGGAAAGAATGGAGGGAAGAGGG - Intergenic
930541065 2:52707253-52707275 TACAAAGACTGAAGGGAAGTTGG - Intergenic
930556798 2:52906340-52906362 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
930998696 2:57755081-57755103 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
931166722 2:59756804-59756826 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
931407474 2:61993980-61994002 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
933274295 2:80267174-80267196 AAGTGAGAATGAAGAGGAGAGGG - Intronic
933810999 2:86032584-86032606 GATGAAGACTGAAGGGAAGGAGG - Intronic
934216192 2:90033769-90033791 AAGAAAGACGGAAGGAAGGAAGG - Intergenic
934278228 2:91589979-91590001 AGAAAAGGCTGAAGGGAAGACGG - Intergenic
934303504 2:91799187-91799209 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
934329755 2:92053569-92053591 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
934536130 2:95135397-95135419 AAGAAAGAACGAAGGAAAGAAGG - Intronic
934603689 2:95678497-95678519 AAGAAAGGCTGGAAGGAAGATGG - Intergenic
934903102 2:98176526-98176548 AAGGAAGGCAGAAGGAAAGAAGG - Intronic
935402265 2:102672573-102672595 AGGAGAGACTGAAGGGAAGTTGG + Intronic
935498910 2:103814295-103814317 ATGTTAAACTCAAGGGAAGAGGG + Intergenic
935513322 2:104002991-104003013 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
936259097 2:110943022-110943044 AAGGAAGAAGGAAGGAAAGAAGG + Intronic
936259115 2:110943121-110943143 AAGGAAGAAGGAAGGAAAGAAGG + Intronic
936259129 2:110943207-110943229 AAGGAAGAAGGAAGGAAAGAAGG + Intronic
936605908 2:113953523-113953545 AAGTAAAACTAAGGTGAAGAAGG - Intronic
936817442 2:116476183-116476205 AAGGAAGAAGGAAGGCAAGAAGG + Intergenic
936840635 2:116764290-116764312 AAGGAAGAATGAAGGGAAAGTGG - Intergenic
937008800 2:118543175-118543197 AATTAAGGCAGAAGGCAAGAAGG - Intergenic
938539613 2:132275441-132275463 AAGTCAGCCTGATGGGAAGGAGG + Intergenic
938956020 2:136299189-136299211 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
939271724 2:139948042-139948064 AAGAAAGCAAGAAGGGAAGAAGG + Intergenic
939604879 2:144241693-144241715 AAGGAAGACAGAAAGAAAGATGG - Intronic
939729192 2:145760756-145760778 AAGTAAGATTTAAGGCAAGAAGG + Intergenic
940524968 2:154801525-154801547 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
941131829 2:161660632-161660654 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
941357691 2:164513146-164513168 AAAAGAGACTGAAGGGAAGAAGG - Intronic
941412013 2:165169942-165169964 GAATAAGACGGAAGGGAAAAGGG + Intronic
941507511 2:166365937-166365959 AAGAAAGAGGGAAGGAAAGAAGG + Intronic
942067115 2:172281840-172281862 AGGAAAGAGTGAAGGGAAGAAGG - Intergenic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
943142442 2:183999447-183999469 GGGTTAGAGTGAAGGGAAGAAGG - Intergenic
943180960 2:184540439-184540461 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943227899 2:185205053-185205075 AAGGAAGAAGGAAGGAAAGAGGG - Intergenic
944188468 2:196975831-196975853 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
944210965 2:197206028-197206050 AAGTAAGACTGAACAGAAGGGGG + Intronic
944437349 2:199704419-199704441 AGGGAAGACTGGGGGGAAGAGGG + Intergenic
944732640 2:202533167-202533189 AAGGAAGAAAGAAGGAAAGAAGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945220262 2:207476269-207476291 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
945386331 2:209206152-209206174 AAGAAAGACTGAGGTGAGGATGG - Intergenic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
946655448 2:221940997-221941019 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
946687158 2:222281867-222281889 AAGTCAGAGAGAAGGCAAGAAGG + Intronic
947279107 2:228428367-228428389 GAATAAGACTGAAATGAAGAAGG - Intergenic
948041068 2:234901882-234901904 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
948041078 2:234902074-234902096 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
948282743 2:236760387-236760409 AAGAAAGAAGGAAGGGAAGAAGG + Intergenic
948289454 2:236814256-236814278 AAGAAAGACTAAAGAGGAGAAGG - Intergenic
948303144 2:236924218-236924240 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
948856384 2:240732357-240732379 AGGAAAAAATGAAGGGAAGAGGG + Intronic
1168862883 20:1058707-1058729 AATTAAGATTGGAGGGTAGATGG - Intergenic
1169038038 20:2469802-2469824 AAGGAAGAAAGAAGGGAAGACGG - Intronic
1169400332 20:5274205-5274227 ACCTGAGACTGAAGGGCAGATGG + Intergenic
1169544347 20:6635326-6635348 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1169611285 20:7382788-7382810 GAGCAAGAGTGAAGGGAGGAAGG - Intergenic
1169897342 20:10518383-10518405 AAGAAAGAAAGAAAGGAAGAAGG - Intronic
1169948599 20:11016166-11016188 TAGTATAACAGAAGGGAAGAAGG - Intergenic
1170052849 20:12165712-12165734 AAAAAAGAGTGAAGGAAAGAAGG - Intergenic
1170830484 20:19835153-19835175 AGGAAGGAATGAAGGGAAGAAGG + Intergenic
1170975814 20:21163340-21163362 AAGAAAGAAGGAAGGGAGGAAGG - Intronic
1171069124 20:22049292-22049314 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1171151867 20:22834710-22834732 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151904 20:22834857-22834879 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151954 20:22835097-22835119 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171199016 20:23226239-23226261 AAGAAAGAATGAAGGGAGGAAGG + Intergenic
1171240176 20:23561083-23561105 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1171296694 20:24023236-24023258 AAGCAAGACTGAGAGCAAGAAGG + Intergenic
1172203747 20:33147351-33147373 AAGAAAGACAGAATGGAAGGAGG + Intergenic
1172340236 20:34151847-34151869 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1172637599 20:36420491-36420513 AATGAAGACCCAAGGGAAGAGGG + Intronic
1172790003 20:37496550-37496572 AGGTAGCAGTGAAGGGAAGAGGG - Intronic
1172887342 20:38240094-38240116 AAGGAAGACGGAAGGAAGGAAGG - Intronic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173309894 20:41888198-41888220 AAGGAAGACAGAAGGCAGGAAGG - Intergenic
1173469414 20:43311182-43311204 AAGAAAGAAAGAAGGGAAAAAGG + Intergenic
1173681271 20:44884246-44884268 AAGTAAGGGTAAAGGCAAGACGG + Intergenic
1174140877 20:48412760-48412782 AAGAAAGACAGAAGGAAGGAAGG - Intergenic
1174409465 20:50324673-50324695 AATGAACACTGATGGGAAGAAGG - Intergenic
1174964705 20:55199362-55199384 AGTTAGAACTGAAGGGAAGATGG + Intergenic
1175565056 20:59968091-59968113 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1175615010 20:60390506-60390528 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
1175716764 20:61260173-61260195 AAGGAACACTGGAGGGTAGAGGG - Intronic
1176551469 21:8224264-8224286 AAGGCAGACCGAAGGGAAGGAGG - Intergenic
1176570378 21:8407263-8407285 AAGGCAGACCGAAGGGAAGGAGG - Intergenic
1176578287 21:8451450-8451472 AAGGCAGACCGAAGGGAAGGAGG - Intergenic
1176585898 21:8584856-8584878 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1176668955 21:9714127-9714149 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
1176697553 21:9998006-9998028 AAAGAAGGCCGAAGGGAAGAAGG - Intergenic
1176933680 21:14842507-14842529 AAATGATACTGAAGGGGAGAGGG - Intergenic
1176948681 21:15016884-15016906 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1177573352 21:22919175-22919197 CATTAAGAATGAAAGGAAGAAGG + Intergenic
1177674526 21:24279500-24279522 AAGGCAGACAGAAGGCAAGAAGG - Intergenic
1178059029 21:28831513-28831535 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1178059035 21:28831569-28831591 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1178093506 21:29189350-29189372 GAGTGAGACTGAATGGGAGAAGG + Intergenic
1178684214 21:34698473-34698495 GAGAAAGACAGAAGGGAGGAAGG + Intronic
1178684225 21:34698538-34698560 AAGACAGACGGAAGGGAGGATGG + Intronic
1178792045 21:35709631-35709653 AAGGAAGAAAGAAAGGAAGAAGG - Intronic
1178974866 21:37212915-37212937 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1180268705 22:10561761-10561783 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1180407688 22:12571380-12571402 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1180566307 22:16669107-16669129 AAGGAAGAAAGAAGGGAGGAAGG + Intergenic
1181991565 22:26840863-26840885 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1182212846 22:28690891-28690913 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1182240970 22:28915959-28915981 AAGTATGAAGGAAGGGAGGAAGG - Intronic
1182793252 22:32970947-32970969 TAGTAAGAATGCAGTGAAGATGG - Intronic
1183371909 22:37437485-37437507 AAGGAAGAATGAAGGAAGGAGGG + Intergenic
1184127306 22:42496759-42496781 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1184313693 22:43665780-43665802 AAGAAAGAAAGAAGGGAATAAGG - Intronic
1203256491 22_KI270733v1_random:141208-141230 AAGGCAGACCGAAGGGAAGGAGG - Intergenic
1203290082 22_KI270735v1_random:28141-28163 AAGTGAGAAAGAAGGGAAGGAGG - Intergenic
949791426 3:7796571-7796593 AGGGGAGACTGAAGGGAAAATGG - Intergenic
950236978 3:11331044-11331066 AAAAAAGACTGGAAGGAAGATGG - Intronic
950881970 3:16329373-16329395 AAGGAAGGCGGAAGGGAGGAGGG + Intronic
951134600 3:19089888-19089910 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
951418736 3:22458024-22458046 AAGGAAGAAGGGAGGGAAGAAGG + Intergenic
952433270 3:33246887-33246909 AAGAAAAAATGAAGGGAGGAAGG - Intergenic
952438805 3:33301255-33301277 AAGTAAGACTGAAGGTGAATAGG - Intronic
952672016 3:35980798-35980820 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
953034014 3:39196182-39196204 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
953562933 3:44008920-44008942 AAGAAAGACAGAAAGAAAGAAGG - Intergenic
953578787 3:44134839-44134861 AGGGAAGATGGAAGGGAAGAAGG + Intergenic
954382179 3:50225441-50225463 AAGAAAGACTGGAAAGAAGAAGG + Intergenic
954608189 3:51929763-51929785 GAGTAAGACAGAAGGGTAGCTGG - Intergenic
955212722 3:56956748-56956770 GAGCAATACTGAAGGGAGGATGG + Intronic
955385858 3:58479296-58479318 AAGTAAGAGAGAAGGGAGGCAGG + Intergenic
955672942 3:61420957-61420979 AAGAAAGAGAGAAAGGAAGAAGG - Intergenic
955889251 3:63632401-63632423 AAGAAGGAAGGAAGGGAAGAAGG + Intergenic
956305594 3:67821037-67821059 AAGGAAGAAAGAAGGAAAGAAGG + Intergenic
956392408 3:68787532-68787554 AAAGAAGAAAGAAGGGAAGAGGG + Intronic
956673573 3:71714219-71714241 AAGAAAGAAAGAAGGGAAGAAGG + Intronic
956767549 3:72496634-72496656 AGGAAAGAATGAAGGGAGGAAGG - Intergenic
956847929 3:73200983-73201005 AAGTCAGGCTGAAGGGAATGAGG - Intergenic
957041946 3:75342390-75342412 CAGCAAGATTGAAGGGAATATGG + Intergenic
957212460 3:77277148-77277170 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
957289665 3:78262797-78262819 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
957305653 3:78455635-78455657 TAGTACGAAAGAAGGGAAGAGGG - Intergenic
957356009 3:79087535-79087557 AAGGAAGAAGGAAGGAAAGAAGG - Intronic
957507434 3:81140908-81140930 AAGAAAGGGAGAAGGGAAGAAGG + Intergenic
957603179 3:82365340-82365362 AAGTAAGGCAGAAAGAAAGAAGG + Intergenic
958671393 3:97210324-97210346 AAATGAGAGTGAAGTGAAGACGG + Intronic
959148034 3:102573245-102573267 AGGTAGGAGTGAAGTGAAGAAGG + Intergenic
959154306 3:102648117-102648139 AAGAAAGGCTGCAGTGAAGAGGG - Intergenic
959215268 3:103444314-103444336 AAGAAAGAATGAAAGAAAGAAGG - Intergenic
959232039 3:103666881-103666903 AAGTAATAATGAAAGTAAGAAGG - Intergenic
959364417 3:105438924-105438946 AAGGAAGAAAGAAGGGAGGAAGG + Intronic
959416227 3:106078934-106078956 AAGAAGGAATGAAGGAAAGAAGG - Intergenic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
959545761 3:107594344-107594366 AAGTAAGACTGACAGGAATAAGG - Intronic
959778095 3:110193949-110193971 AAGTAAGATGCAAGGGAGGAAGG + Intergenic
959925681 3:111919228-111919250 AAGAAAGAAAAAAGGGAAGAGGG - Intronic
960150885 3:114247581-114247603 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
960396279 3:117141694-117141716 AAGTAAGAGGGAAGGTAAGGAGG - Intergenic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961067293 3:123886384-123886406 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
961170126 3:124791659-124791681 AAGACAGGCTGCAGGGAAGAGGG + Intronic
961262780 3:125615935-125615957 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
961919825 3:130414171-130414193 AAGTTATTCTGATGGGAAGAAGG + Intronic
961961541 3:130860737-130860759 AGGAAGGAGTGAAGGGAAGAAGG - Intronic
962107737 3:132409807-132409829 AACCAAGAATGAAGGGCAGAAGG - Intergenic
962379099 3:134882730-134882752 AAGGAAGAAAGAAGGAAAGAAGG - Intronic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
962490662 3:135890907-135890929 AAGCTATACTGAAGGGAAGTAGG - Intergenic
962859583 3:139387221-139387243 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
963362985 3:144300988-144301010 AAGAAACACTGCAGGCAAGAGGG - Intergenic
963994467 3:151691903-151691925 ATGTAAGAATGAAGTGAAGCAGG - Intergenic
964112253 3:153099816-153099838 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
964177508 3:153841936-153841958 TAGTAAGGCTGCAGAGAAGAAGG - Intergenic
964746787 3:160020045-160020067 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
964818378 3:160741798-160741820 AAGGAAGACTGTATAGAAGATGG + Intergenic
964824138 3:160806826-160806848 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
964839736 3:160980666-160980688 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
965456329 3:168905499-168905521 AAGGAAGAAGGAAGAGAAGAAGG - Intergenic
965478877 3:169191476-169191498 AATAAAGGCTGAAGGTAAGATGG + Intronic
965804076 3:172524385-172524407 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
965898554 3:173610279-173610301 AATTAAGATGGAAAGGAAGAAGG + Intronic
965988277 3:174783310-174783332 AAAAAAGACTAAAGGGAACAAGG - Intronic
966647558 3:182263380-182263402 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
966728787 3:183133044-183133066 AAAGAAGACAGAGGGGAAGATGG + Intronic
966937396 3:184719970-184719992 AAGAGAGACTCAAGGGAAGGAGG + Intergenic
967054226 3:185814195-185814217 AAGAAAGAAGGAAGGGAGGAGGG - Intronic
967316507 3:188155459-188155481 AAGAAAGCCTAAAGTGAAGAAGG + Intronic
968147212 3:196309621-196309643 AAGGAAGAAGGAAGGAAAGAAGG + Intronic
968937325 4:3617961-3617983 AATGAATACTGCAGGGAAGAAGG - Intergenic
969032522 4:4226353-4226375 AGAAAAGGCTGAAGGGAAGACGG + Intronic
969074447 4:4566737-4566759 CCTTAAGCCTGAAGGGAAGAGGG - Intergenic
969144929 4:5114260-5114282 AAGTCAGAATGAAGGGCAGGAGG - Intronic
969263933 4:6052079-6052101 GGGTGAGACTGAAGGAAAGAGGG + Intronic
969436128 4:7190619-7190641 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
969437583 4:7197510-7197532 AGGGAAGACTGCATGGAAGAGGG + Intronic
969450113 4:7268212-7268234 AAGTGGGAGTGAAGGGATGAAGG + Intronic
969762062 4:9193695-9193717 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
970142557 4:12998115-12998137 ATCTAAGACAGAGGGGAAGATGG - Intergenic
970282777 4:14476540-14476562 AACCAAGACTGAATGGAAGAGGG + Intergenic
970365107 4:15350272-15350294 AAGAAGGAAGGAAGGGAAGAAGG + Intronic
970420350 4:15900138-15900160 AAAAAAGAAGGAAGGGAAGAAGG - Intergenic
970647997 4:18145366-18145388 AAGAAAGAAAGAAGGAAAGATGG - Intergenic
970660610 4:18281301-18281323 CAGTAAGATTGAAGAGCAGATGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971393875 4:26210743-26210765 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
971579414 4:28315564-28315586 GAGGAAGTCAGAAGGGAAGAAGG + Intergenic
971782639 4:31056374-31056396 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
971782642 4:31056402-31056424 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
971834856 4:31749529-31749551 AAGAAAGACGGAAAGAAAGAAGG - Intergenic
971956598 4:33428024-33428046 AAGAAAGACTCAAGGGAAAATGG + Intergenic
972267322 4:37474227-37474249 GAGAAAGAAAGAAGGGAAGAGGG - Intronic
972316961 4:37935767-37935789 AGGTAAGACTGGAGGGGAAACGG - Intronic
972353060 4:38255030-38255052 AAGGAAGAAAGGAGGGAAGAAGG + Intergenic
972961141 4:44453413-44453435 GAATAAGACTGAAGATAAGATGG + Intergenic
973161248 4:47019597-47019619 AAGAAAGAAAGAAGGGAGGAAGG - Intronic
973378292 4:49302663-49302685 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
973629841 4:52810246-52810268 GAGAAAGACTGATGGGGAGAGGG + Intergenic
973804753 4:54514907-54514929 AATAAAGAATGAAGGAAAGAAGG - Intergenic
973835571 4:54806160-54806182 AAGAAAGACAGAAAGAAAGAGGG + Intergenic
973835593 4:54806306-54806328 AAGAAAGACAGAAAGAAAGAGGG + Intergenic
974102162 4:57429252-57429274 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
974222343 4:58991793-58991815 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
974251955 4:59395985-59396007 AAATAGGACTGCAGGGAAAAAGG - Intergenic
974311493 4:60216202-60216224 AGGTTAGACTGTAGGGAGGATGG + Intergenic
974338649 4:60585517-60585539 AAATAAGACAAAAGGAAAGAAGG + Intergenic
974717355 4:65685248-65685270 AAGTAGGAGTGATGGAAAGACGG + Intergenic
975799383 4:78043917-78043939 AAGGAAGAAAGAAAGGAAGAAGG - Intergenic
975938131 4:79606814-79606836 AAGTAGCACTGCAGAGAAGATGG - Intergenic
976674240 4:87686604-87686626 TAGTAAGGCTGAAGAGAAAATGG - Intergenic
976753275 4:88471965-88471987 AAGAAAGAAGGAAGGGAAGGAGG - Intronic
977068473 4:92350603-92350625 AAGAAAGATAGAAGGGAAGAAGG - Intronic
977600225 4:98928186-98928208 AAGGATGAATGAATGGAAGACGG + Intronic
977865481 4:102021678-102021700 AAGCAAGACTGAAGAGAATGTGG + Intronic
978169212 4:105649034-105649056 AAGTAAAACAGGATGGAAGAAGG - Intronic
978294057 4:107182323-107182345 TGGTAAGAGGGAAGGGAAGAGGG + Intronic
978454051 4:108868616-108868638 AAGAAAGAAAGAAGGGAAAAGGG + Intronic
978550594 4:109921600-109921622 AAGTTAGTCTGAATGGAGGAAGG - Intronic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
978992946 4:115109007-115109029 AAGGAAGAAGGAAGGAAAGAGGG + Intronic
979050834 4:115929465-115929487 AAGACAGTTTGAAGGGAAGAAGG + Intergenic
979762563 4:124425074-124425096 AAGTAAGACTCAAGTGACTATGG + Intergenic
979807007 4:124986521-124986543 AAGTAATTCAGGAGGGAAGAGGG - Intergenic
979833529 4:125331061-125331083 AACGAAAACTGGAGGGAAGAAGG - Intronic
980083983 4:128372802-128372824 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
980202323 4:129671524-129671546 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
980253781 4:130350161-130350183 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
980344299 4:131593121-131593143 GTGTAAGACAGCAGGGAAGATGG - Intergenic
980560820 4:134472605-134472627 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
980616187 4:135228967-135228989 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
980648129 4:135671815-135671837 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
981064929 4:140473158-140473180 AAATAGGAATGAAGGAAAGAAGG - Intronic
981183236 4:141770052-141770074 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981651918 4:147069910-147069932 GAGGAAGACTGCAAGGAAGAAGG - Intergenic
981666350 4:147231216-147231238 GGGAAAGAGTGAAGGGAAGAGGG - Intergenic
981680349 4:147390338-147390360 CAATAAGAATAAAGGGAAGAAGG + Intergenic
982328909 4:154159333-154159355 AAGTGACGCTGAAGGGAGGAGGG + Intergenic
982420999 4:155197452-155197474 AAGTAAGAAGGAAGGAAAGCAGG - Intergenic
982563064 4:156955076-156955098 ATATTAGACTGAAGGCAAGAGGG + Intronic
982605147 4:157506538-157506560 AAATAAGACAGAAAGAAAGAGGG - Intergenic
983029436 4:162781104-162781126 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
983366977 4:166803985-166804007 AAATAAAACTGAAAGAAAGAAGG + Intronic
983693276 4:170498603-170498625 AAAAAGGAATGAAGGGAAGAAGG + Intergenic
983843532 4:172487286-172487308 AAGAAAGACAGAAGGAAAGAAGG - Intronic
983980220 4:173986714-173986736 ACGTAAGAGTTCAGGGAAGATGG + Intergenic
984143261 4:176029606-176029628 ATTTCAGACTGATGGGAAGATGG - Intergenic
984261972 4:177453378-177453400 AAGTAAAAGAGAAGGGAGGAAGG - Intergenic
984502865 4:180578285-180578307 AAGGAAGAGAGAAAGGAAGAGGG + Intergenic
984612389 4:181856111-181856133 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
984990384 4:185374890-185374912 AAGTATGCTTGAATGGAAGACGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985147152 4:186905342-186905364 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
985169450 4:187133153-187133175 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
985267798 4:188166229-188166251 AAGAAAGAGAGAAGGAAAGAAGG - Intergenic
985336962 4:188906137-188906159 AAGGAAGGGGGAAGGGAAGACGG - Intergenic
985405827 4:189637388-189637410 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
985817032 5:2134734-2134756 ATGGAAGCCTGACGGGAAGAGGG + Intergenic
985886221 5:2681670-2681692 AAGAAAGAAAGAAGGGAGGAAGG + Intergenic
985993733 5:3584747-3584769 AAGAAAGAAGGAAGGAAAGAGGG + Intergenic
985993746 5:3584812-3584834 AAGGAGGAATGAAAGGAAGAAGG + Intergenic
986457409 5:7933126-7933148 AAGTTATACAGAAGGGAAGAAGG - Intergenic
986492894 5:8310117-8310139 AAGGAAGACAGAAAGGAAGAAGG - Intergenic
986541526 5:8849746-8849768 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
986918092 5:12648993-12649015 AAGCAAGACTGAAAGAAAAAAGG + Intergenic
987053687 5:14170390-14170412 AAGTTAAACTGAAGGGTGGAGGG - Intronic
987661427 5:20883243-20883265 AAGGAATACAGAATGGAAGAAGG - Intergenic
987862073 5:23501713-23501735 AAATCAGTCTGATGGGAAGAGGG - Intergenic
987863165 5:23510026-23510048 AGGTAAGAGGGAAGGGAAGTAGG + Exonic
988066222 5:26230630-26230652 AAGGAGGACGGAAGGGAGGAAGG - Intergenic
988522632 5:31960210-31960232 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
988530145 5:32020317-32020339 TATTAAGACTCAAAGGAAGATGG + Intronic
988762158 5:34322082-34322104 AAGGAATACAGAATGGAAGAAGG + Intergenic
989006425 5:36818292-36818314 AAGCAAGACTGATGAGCAGATGG - Intergenic
989083043 5:37646040-37646062 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
989732170 5:44662247-44662269 TGGGAAGAATGAAGGGAAGAAGG - Intergenic
989997071 5:50848564-50848586 AATGAAGACTTAAGAGAAGAAGG + Intergenic
990650620 5:57895010-57895032 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
990793956 5:59519054-59519076 AAGAAAGATGGTAGGGAAGAAGG - Intronic
991054254 5:62305469-62305491 AACTGTGACTCAAGGGAAGAAGG - Intergenic
991252389 5:64577987-64578009 AAGTAAGAGTGGATGGCAGAAGG - Intronic
991564803 5:67993867-67993889 AAGAAAGACGGGAGGGCAGAGGG - Intergenic
991972375 5:72153464-72153486 GAGTAAGACTATATGGAAGATGG - Intronic
992186425 5:74248989-74249011 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
992321709 5:75619813-75619835 AAGGAAGAAGGAAGGGAGGAAGG - Intronic
992488663 5:77219861-77219883 AATAAAGACTGAAGGGAGCAAGG + Intronic
993012627 5:82500812-82500834 AGGGCAGAATGAAGGGAAGAAGG - Intergenic
993012664 5:82501198-82501220 AAGAAAGGCAGAAAGGAAGAAGG - Intergenic
993360130 5:86964735-86964757 AAGGATGAAAGAAGGGAAGAGGG + Intergenic
993588629 5:89764793-89764815 AAGAAAGAAGGGAGGGAAGATGG + Intergenic
993622384 5:90184009-90184031 AAGGAAGCATGAAGGAAAGAAGG + Intergenic
993735267 5:91468899-91468921 AGGTAAGACTGAAAGGCAGTTGG + Intergenic
994153226 5:96473804-96473826 TAGTAAAGCAGAAGGGAAGAGGG + Intergenic
994159020 5:96534882-96534904 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
994450806 5:99940200-99940222 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
995836449 5:116404583-116404605 AAGAAAGAAGGAAGGAAAGAGGG - Intronic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
996352683 5:122563072-122563094 AAGTCTGACAGAAGGGAAAAGGG + Intergenic
996564551 5:124865614-124865636 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
996801335 5:127406793-127406815 AAGTAAGAGTGAAGAGACAATGG + Intronic
996972810 5:129393569-129393591 AAGAAAGAGGGAAGAGAAGAGGG + Intergenic
997103928 5:130996726-130996748 CCTTAAGCCTGAAGGGAAGAGGG + Intergenic
998810819 5:145964208-145964230 AAGAAAGAAGGAAGGGAGGAAGG - Intronic
999082855 5:148860689-148860711 AAGTAAAACTTCAGGGAAGCTGG - Intergenic
999524130 5:152383955-152383977 AGGGAAGAAGGAAGGGAAGAAGG - Intergenic
999687528 5:154116434-154116456 AAGTAAAAATAAAGGGAAAAAGG - Intronic
999693252 5:154166961-154166983 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000414298 5:160967244-160967266 AAGAACGAAAGAAGGGAAGAAGG - Intergenic
1000933328 5:167279466-167279488 AAGAAAGGAAGAAGGGAAGAAGG - Intergenic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001866958 5:175114126-175114148 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
1002018188 5:176342763-176342785 CAGTAACACTGAGGGGAATAAGG - Intronic
1002180017 5:177426561-177426583 GAGGAAGACTAATGGGAAGACGG + Intronic
1002332624 5:178455085-178455107 AAGTCAGACTGGAGGGGAGCAGG - Intronic
1002811088 6:629805-629827 AAAGAAGACTGAAAGCAAGATGG + Intronic
1003195008 6:3906603-3906625 AAGTAGGACTGTGGGTAAGAAGG + Intergenic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1003709621 6:8574880-8574902 AAGGAAGACGGAAGGAAGGAAGG - Intergenic
1003722261 6:8717084-8717106 AAGTCACAGTTAAGGGAAGAAGG + Intergenic
1003976643 6:11351171-11351193 AAGGAAGAGAGATGGGAAGAAGG + Intronic
1004125862 6:12872913-12872935 AAGAAAGAAAGAAGGGAGGAAGG - Intronic
1004222229 6:13756814-13756836 AAGTAAAACTGCGGAGAAGAGGG - Intergenic
1004375149 6:15084640-15084662 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1004392780 6:15223278-15223300 AACTAAGTTTTAAGGGAAGAAGG + Intergenic
1004534805 6:16490285-16490307 GAAAAAGACTGAAGGGAAGTTGG - Intronic
1004582986 6:16972414-16972436 AAGAAAGACAGAAGGAAAGAAGG + Intergenic
1004585323 6:16994189-16994211 AAGTAAGAAGGAAGGTAGGAAGG - Intergenic
1004617141 6:17301341-17301363 AAGTTAGGCTGAAGGTCAGAAGG - Intergenic
1004751426 6:18565974-18565996 AAGGAAGAAGGAAGGGAAGGAGG - Intergenic
1004822143 6:19378912-19378934 AAGATAGAGTGAAAGGAAGAAGG - Intergenic
1005205159 6:23394072-23394094 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1005256134 6:24005253-24005275 GAGGAAGACTGAGGGGAAGAAGG + Intergenic
1005424800 6:25691431-25691453 AACCAAGTCTGAGGGGAAGAGGG - Intronic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006050196 6:31336367-31336389 GAGTAAGACAGAAGGTAAAAAGG - Intronic
1006426352 6:33965488-33965510 AAGGAAGAAAGAAAGGAAGAAGG - Intergenic
1006524098 6:34589097-34589119 AACTAAGACTTGAGGGAAGGAGG + Exonic
1006854289 6:37122443-37122465 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1007007179 6:38375929-38375951 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1007012982 6:38435567-38435589 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1007398920 6:41592704-41592726 AGGTAAGACAGAAGGAAGGAAGG - Intronic
1007593406 6:43037099-43037121 AAGTAAGACTGACATGATGAAGG - Intergenic
1007994824 6:46295687-46295709 AAAAAAGACTGAAGGAAACATGG + Intronic
1008107056 6:47450555-47450577 AAGTATGAATTAAGGAAAGAAGG - Intergenic
1008330837 6:50241789-50241811 GAGTATCACTGAATGGAAGAAGG - Intergenic
1008593630 6:53018804-53018826 AACTAAGAGAGAAAGGAAGAGGG + Intronic
1008966570 6:57318512-57318534 AAGTAAAACTGAAGGCAATGAGG - Exonic
1009399695 6:63239714-63239736 AAGAAAGAAAGAAGGAAAGATGG + Intergenic
1009494181 6:64328418-64328440 AATAAAGGCTGGAGGGAAGAAGG + Intronic
1009578458 6:65498133-65498155 CAGTAAGACGGCAAGGAAGAGGG + Intronic
1009734601 6:67660857-67660879 AAGAAAGACAGAAAGAAAGAGGG + Intergenic
1009761503 6:68012873-68012895 AAGTAAAAAGGAAGGAAAGAAGG + Intergenic
1010248816 6:73687340-73687362 AAGAAAGACTGAAGGGAGGAAGG - Intergenic
1010284796 6:74063619-74063641 TAGTAAAGCTGTAGGGAAGAAGG + Intergenic
1010698539 6:79010056-79010078 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1010720342 6:79276396-79276418 AAGAAAGACTGAGGTTAAGAAGG - Intergenic
1010915576 6:81613891-81613913 AGGGAAGAAGGAAGGGAAGAAGG + Intronic
1011218473 6:85030304-85030326 AGGAGAGACTGAAGGGAGGAGGG - Intergenic
1011779913 6:90776464-90776486 GAGTAAGACAGAAGAAAAGAGGG - Intergenic
1011889742 6:92143023-92143045 AAGAAAGAATGAAGGAAGGAAGG + Intergenic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1012305174 6:97647065-97647087 AAGCAAGAGAGAAGGGAGGAAGG + Intergenic
1012482441 6:99682038-99682060 AAGAAAGAGGGAAGGAAAGAAGG - Intergenic
1012745056 6:103076490-103076512 AAGTAAAAATGAAGAGATGAAGG - Intergenic
1013046673 6:106492523-106492545 AGGAAAGAAGGAAGGGAAGAAGG + Intergenic
1013219964 6:108069679-108069701 AAGTATGACTCTAAGGAAGAGGG + Intronic
1013520466 6:110928184-110928206 AAGAAGGAATGAAGGGAAGGAGG - Intergenic
1013703607 6:112805135-112805157 AAGAGAGACAGAAAGGAAGAAGG - Intergenic
1014164899 6:118212687-118212709 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1014897005 6:126913668-126913690 AAGTAAAAGTGAAGGGAGGGGGG + Intergenic
1014911443 6:127098651-127098673 AAGGAAGAAGGAAGGGAAAAAGG + Intergenic
1014989734 6:128058938-128058960 AGGTAAAACTGTAGGGAAGAGGG - Intronic
1015137221 6:129886715-129886737 AAGGAAGAAGGAAGGAAAGATGG + Intergenic
1015345741 6:132156054-132156076 AAGAAAGAAAGAAGGGTAGAAGG - Intergenic
1016366873 6:143328425-143328447 AAGAAAGACTAAAGGCAAGTGGG + Intronic
1016371196 6:143375877-143375899 AGGAAAGAAGGAAGGGAAGAAGG + Intergenic
1016421740 6:143892252-143892274 AAGCAAGAGGGAAGGGAAGGAGG + Intronic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016532532 6:145074885-145074907 AGGAAAGAAAGAAGGGAAGAAGG + Intergenic
1016535012 6:145100069-145100091 AAGGAAGAGGGAAGGGAAGGAGG + Intergenic
1016736814 6:147488338-147488360 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
1016895023 6:149043053-149043075 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1017075046 6:150610100-150610122 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1017138838 6:151172013-151172035 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017920873 6:158870746-158870768 AAGGAAGAAAGAAGGGAGGAAGG - Intronic
1018132759 6:160748308-160748330 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1020211538 7:6161838-6161860 AAGTAAGATTGGAGGGTGGATGG - Exonic
1020567251 7:9813096-9813118 AGGCAAGACTCAAAGGAAGATGG + Intergenic
1020901810 7:14012943-14012965 GAGTAAGACTCAAGAGAAGATGG + Intergenic
1020950121 7:14664896-14664918 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1021053628 7:16020104-16020126 AAGAAAGATTGAAGGAAGGAAGG + Intergenic
1021314599 7:19131742-19131764 AAAAAAGACTGAAGACAAGAGGG + Intergenic
1021352938 7:19617567-19617589 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021956183 7:25826943-25826965 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1022219298 7:28296611-28296633 GAGAAAGAGAGAAGGGAAGAAGG - Intergenic
1022282464 7:28924988-28925010 GAGGAAGAAGGAAGGGAAGAAGG + Intergenic
1022282467 7:28925000-28925022 AGGGAAGAAGGAAGGGAAGAAGG + Intergenic
1022675389 7:32495111-32495133 AAGGAAAACAGAAGAGAAGAGGG + Intronic
1022771409 7:33476637-33476659 AAGTAAGACGGGATGGATGATGG - Intronic
1023201496 7:37702340-37702362 AAAAAAGACAGAAGGGAGGAAGG - Intronic
1023417401 7:39946437-39946459 AAGTAAGAGTGAGGGGCAGAAGG + Intergenic
1023449161 7:40263847-40263869 AAGAAAGACTGACAGGAAGGGGG - Intronic
1023470779 7:40516004-40516026 AAGAAAGAAGAAAGGGAAGAAGG - Intronic
1023519129 7:41033266-41033288 AAGCAAGACAGAAGAGATGAAGG - Intergenic
1024217502 7:47259787-47259809 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1024283204 7:47736288-47736310 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1024298157 7:47862799-47862821 AAGGAGGACAGAAGGAAAGAAGG + Intronic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024491610 7:49991938-49991960 AAGTAAGAATGTAGGAAGGAAGG + Intronic
1024791149 7:52966118-52966140 AAGTAAGAAAAAAGGAAAGAAGG - Intergenic
1024803735 7:53111413-53111435 AAGGAAGAATGAAGGGCACAAGG - Intergenic
1024807227 7:53157245-53157267 AGGTATTTCTGAAGGGAAGAAGG + Intergenic
1025474814 7:60905913-60905935 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1025512189 7:61583961-61583983 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1025556748 7:62318992-62319014 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1025847846 7:65216819-65216841 AAGAAAGACAGAAAGAAAGAAGG - Intergenic
1025913402 7:65846377-65846399 AAGGAAGAAGGAAGGGAGGAAGG - Intergenic
1026078681 7:67197752-67197774 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1026188544 7:68103475-68103497 AAGAAAGAAGGAAGGAAAGAGGG + Intergenic
1026213572 7:68328355-68328377 AAGGAAGACAGAAAGAAAGATGG - Intergenic
1026222239 7:68410386-68410408 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1026284618 7:68952420-68952442 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1026318882 7:69251616-69251638 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1026509169 7:71013750-71013772 AAGAAAGAGAAAAGGGAAGAAGG + Intergenic
1026698139 7:72614202-72614224 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1027605579 7:80294345-80294367 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1028091260 7:86705205-86705227 AAGAAAGACAGAAGGAAGGAAGG - Intronic
1028357151 7:89924734-89924756 AAGAAGGAAGGAAGGGAAGAAGG + Intergenic
1028453309 7:91010740-91010762 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1029135395 7:98366876-98366898 AAGGAAGAAAGGAGGGAAGAAGG - Intronic
1029162031 7:98559387-98559409 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1029473341 7:100768148-100768170 AGGTAGGAGTTAAGGGAAGACGG + Intronic
1030577735 7:111311302-111311324 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1030676954 7:112394205-112394227 AAGAAAGAAAGAAGGGAAGCAGG - Intergenic
1030834205 7:114263372-114263394 AAGGAAGAAAGAGGGGAAGAAGG - Intronic
1030951381 7:115794202-115794224 AAGAAAGAGAGAAGGAAAGAAGG - Intergenic
1031050495 7:116939877-116939899 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1031141286 7:117946375-117946397 AATTAAGAGTAAAGGAAAGAAGG + Intergenic
1031220231 7:118956431-118956453 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1031220240 7:118956479-118956501 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1031241901 7:119256206-119256228 AAGTAAAACTGATGGTCAGATGG - Intergenic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1031859524 7:126962004-126962026 GAGAAAGAGTGTAGGGAAGAAGG - Intronic
1032301410 7:130690831-130690853 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1032402630 7:131634488-131634510 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1032540447 7:132698729-132698751 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1032593678 7:133217455-133217477 AAGAATCACTGAGGGGAAGAAGG + Intergenic
1033263639 7:139865770-139865792 AAGGAAGAAGGAAGGGAGGAAGG + Intronic
1033628637 7:143135514-143135536 AAATAAGAAGGAAAGGAAGAAGG + Intronic
1033639491 7:143247520-143247542 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1033707026 7:143900240-143900262 AACTCACACTGAAGGGAAGGGGG - Intronic
1033928008 7:146488217-146488239 AAGAAAGCCTGAAGGGATGGAGG - Intronic
1033985945 7:147225801-147225823 AAGAAAGAAAGAAGGAAAGAAGG + Intronic
1034476643 7:151288337-151288359 AAGAAAGACAGAAGGTAGGATGG + Intergenic
1034761983 7:153681172-153681194 AATTAAGACTCAAAGAAAGAGGG - Intergenic
1035389529 7:158496214-158496236 AGGGAAGGCTGAAGGGAAGGGGG - Intronic
1035683332 8:1505011-1505033 AAGGAAGAAGGAAGGAAAGAGGG + Intronic
1035992700 8:4510555-4510577 AGGGAAGAGGGAAGGGAAGAGGG - Intronic
1036504677 8:9344683-9344705 AAGAAAGACGGAAGGAAGGAAGG + Intergenic
1036978962 8:13446974-13446996 ACGGAAGAAGGAAGGGAAGAAGG + Intronic
1037310067 8:17545718-17545740 AAGCAGGACTGCAGGTAAGAAGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037460345 8:19102267-19102289 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1037460349 8:19102360-19102382 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1037470828 8:19208500-19208522 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
1037474435 8:19242588-19242610 AAGAAAGAAAGAAGGGAAGGAGG + Intergenic
1037887782 8:22604174-22604196 AAGTAAGGCTGGAGTGATGATGG + Intergenic
1038279635 8:26152284-26152306 AAGGAAGAATGCAAGGAAGAAGG - Intergenic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1038932458 8:32209761-32209783 AAGTAAGAAGGAAGGAAGGAAGG - Intronic
1038958106 8:32489133-32489155 AAGGAAGAATCAAGGGAAAAGGG - Intronic
1039347188 8:36719126-36719148 AAGTAGGAAGGAAGGAAAGAAGG - Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1039455916 8:37706534-37706556 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1039510651 8:38089389-38089411 AATAAAGACTGAAGGGAAGAAGG - Intergenic
1040958691 8:53007353-53007375 AAGAAAGAAAGAAGGGAGGAAGG - Intergenic
1041148125 8:54900964-54900986 AAGTAGGAAGGAAGGAAAGAAGG + Intergenic
1041183103 8:55269571-55269593 GAGAAAGAATGAAGGGAGGAGGG + Intronic
1041682938 8:60611369-60611391 TAGGAAAACTGAGGGGAAGAAGG - Intronic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042036579 8:64540431-64540453 AAGAAAGAAAGAAGGGAAGGAGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042082320 8:65068735-65068757 AGATAGGAATGAAGGGAAGAAGG - Intergenic
1042137122 8:65643303-65643325 AAGTATGAAGGAAGGGAAGTTGG + Intergenic
1042835196 8:73073211-73073233 ACGGAAGACTGCAGGGAAGTAGG - Intronic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1043275803 8:78391052-78391074 ATTTAAGACTGCAGTGAAGAAGG + Intergenic
1043311781 8:78869689-78869711 AAGGAAGACAGTAAGGAAGAAGG - Intergenic
1043548773 8:81344856-81344878 AAGCAAGAGGAAAGGGAAGAGGG - Intergenic
1043609630 8:82046008-82046030 AAAGAAAACTGAAGGGGAGATGG - Intergenic
1044119937 8:88382410-88382432 AAGGAAGAAGGAAGGAAAGAAGG - Intergenic
1044687277 8:94839100-94839122 TAGTAAGACTGAAGGAGAAAGGG + Intronic
1044825867 8:96196346-96196368 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
1044963349 8:97552550-97552572 AGGAAAGAGTGAAGGAAAGAAGG - Intergenic
1045078961 8:98603777-98603799 AAGGAAGAAGGAAAGGAAGAAGG + Intronic
1045662263 8:104450140-104450162 AAGAAAGAAGGAAGGGAGGAAGG + Intronic
1045725129 8:105163433-105163455 AAGGAAGAAGGAAGGAAAGAAGG - Intronic
1046131026 8:109968891-109968913 AGGTAAGACTGAAGGCAGGCAGG + Intronic
1046215086 8:111134669-111134691 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1046494759 8:114998947-114998969 AAGAAGGAAGGAAGGGAAGAGGG - Intergenic
1046605353 8:116365664-116365686 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1046893683 8:119450196-119450218 AAGCAAGACTGAATGGAAAGGGG - Intergenic
1046954159 8:120046132-120046154 AATAAACATTGAAGGGAAGAGGG - Intronic
1047120032 8:121892317-121892339 AAGACAGACTGAAGGGAAGATGG - Intergenic
1047303545 8:123635337-123635359 AAGGCAGACTGTAGGCAAGATGG + Intergenic
1047511138 8:125516633-125516655 AAGTTTGATTGAAGAGAAGAGGG + Intergenic
1047674926 8:127190884-127190906 AGGAAAGAATGAAGAGAAGAAGG + Intergenic
1048100161 8:131342433-131342455 AAGTAAGAAAGGAGGGAACAGGG - Intergenic
1048156427 8:131959262-131959284 AAGTAAATCTGAATGAAAGAGGG - Intronic
1048503915 8:135003752-135003774 AAGAAAGACTGGAGGTAAAAGGG + Intergenic
1048539609 8:135330867-135330889 AGGGAAGACAGAAGAGAAGAGGG - Intergenic
1048761973 8:137805023-137805045 AAGGAAGAATGGAGGGAGGAAGG + Intergenic
1049037963 8:140091355-140091377 AAGAAAGACTGGCAGGAAGATGG + Intronic
1049166645 8:141129759-141129781 AATGAAGACTGCAGGGCAGAGGG + Intronic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1050340955 9:4638176-4638198 TAGGAAGACAGGAGGGAAGATGG + Intronic
1050522602 9:6517316-6517338 AAGTAGGACTGAAGAGGAAAGGG - Intergenic
1050707910 9:8424723-8424745 AAGAATGAGTGAAGGGAGGAGGG + Intronic
1050710909 9:8462177-8462199 AAGTGAGGAGGAAGGGAAGAAGG - Intronic
1050727729 9:8670915-8670937 AAGACAGATTGAAGGGAAGTAGG + Intronic
1050945709 9:11514488-11514510 AAGAAAGAATGAAGGAAAGAAGG + Intergenic
1050948856 9:11562574-11562596 AAGGAAGAAAGAAGGAAAGAAGG - Intergenic
1051039382 9:12788112-12788134 AAGAAAGAATGAAGGAAGGAAGG + Intronic
1051058382 9:13015650-13015672 ACATAAGATTGAAGGAAAGAAGG + Intergenic
1051144349 9:14010642-14010664 AAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1051403487 9:16708740-16708762 AAGGAAGACCGAAGGAAAAAAGG + Intronic
1051419125 9:16872257-16872279 GAGGAAGAGAGAAGGGAAGAAGG - Intergenic
1051858753 9:21600224-21600246 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1051958908 9:22734376-22734398 GATTAAGACTGAAAGGTAGAGGG + Intergenic
1052657971 9:31389401-31389423 AAGCAAGAATAAAGGCAAGAGGG - Intergenic
1052668670 9:31527182-31527204 GAGTAAAACTGAAGGCAGGAAGG + Intergenic
1053280499 9:36817379-36817401 AAGAAAGAGGGAAGGAAAGAAGG + Intergenic
1053698392 9:40661525-40661547 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1054309683 9:63460932-63460954 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1054408472 9:64785074-64785096 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1054441625 9:65268885-65268907 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1054453827 9:65419711-65419733 AATGAATACTGCAGGGAAGAAGG + Intergenic
1054488655 9:65752604-65752626 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1054772532 9:69096250-69096272 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1054832109 9:69636873-69636895 AAGAAAGAAGGAAGGAAAGAAGG + Intronic
1054952757 9:70871396-70871418 AAGTAAGACTGGAGAGAATCGGG - Intronic
1054957703 9:70932262-70932284 AAGTAAGAGAGTGGGGAAGAGGG + Intronic
1055595043 9:77857503-77857525 AGGAAAGAAGGAAGGGAAGAAGG + Intronic
1055595047 9:77857519-77857541 AAGAAGGAAGGAAGGGAAGAAGG + Intronic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055756736 9:79566295-79566317 AATTAAGTCTGCAGGCAAGAAGG - Intergenic
1056058096 9:82850232-82850254 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1056058102 9:82850292-82850314 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1056422513 9:86443109-86443131 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1056523153 9:87418738-87418760 AAGGAAGGAGGAAGGGAAGAAGG - Intergenic
1056780552 9:89546450-89546472 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1056869756 9:90266398-90266420 AAGAAAGAAGGAAAGGAAGAAGG - Intergenic
1057058593 9:91983161-91983183 AAGGAAGACAGAAGGTCAGATGG - Intergenic
1057355222 9:94326381-94326403 AAGGAAGACTGAAGAGGAGATGG - Intronic
1057652530 9:96931253-96931275 AAGGAAGACTGAAGAGGAGATGG + Intronic
1058394822 9:104539288-104539310 AGGAAAGAAAGAAGGGAAGATGG + Intergenic
1058412593 9:104748982-104749004 AAGGAAGACTGCAGGGGAGCCGG - Intronic
1058547923 9:106080940-106080962 AAGGAAGAGAGAAGGGGAGAAGG + Intergenic
1059347294 9:113637691-113637713 AAGGAAGACTTCATGGAAGAGGG - Intergenic
1059354222 9:113687045-113687067 AAGGAAGAGAGAAGGGAGGAGGG + Intergenic
1059360470 9:113738262-113738284 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1059861580 9:118469208-118469230 AAGAAAGACAGAAGAGGAGAAGG - Intergenic
1060916091 9:127391723-127391745 TAGTAAGACTGCAGGGAAACAGG + Intronic
1061026001 9:128050149-128050171 AACTAAGAGTGGAGGAAAGATGG + Intergenic
1061352868 9:130079599-130079621 AAATAAGACAGAAGGAAAAAAGG - Intronic
1061365247 9:130169306-130169328 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1061617343 9:131789016-131789038 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1061658387 9:132110502-132110524 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1062416832 9:136455417-136455439 GAGGAAGCATGAAGGGAAGAGGG + Intronic
1062696857 9:137880054-137880076 AAGCCAGGCTTAAGGGAAGAGGG - Intronic
1202780755 9_KI270717v1_random:34720-34742 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1203472648 Un_GL000220v1:122908-122930 AAGGCAGACCGAAGGGAAGGAGG - Intergenic
1203615798 Un_KI270749v1:62374-62396 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1203656911 Un_KI270753v1:6808-6830 AAGGAAGAAGGAAGGAAAGAAGG + Intergenic
1185686744 X:1935064-1935086 AAGGAAGAAAGAAGGGAGGAGGG + Intergenic
1185698375 X:2213129-2213151 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1185698395 X:2213199-2213221 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1185698451 X:2213378-2213400 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1185698459 X:2213415-2213437 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1185698552 X:2213729-2213751 AAGGAAGAAGGAAGGGAAGGAGG + Intergenic
1185711667 X:2308797-2308819 AAGCAAGAATGAATGGAAGGAGG + Intronic
1185801796 X:3017759-3017781 AAGAAAGAAAGAAGGGAAAATGG + Intronic
1185937504 X:4275430-4275452 AAATAACACTGATGGGAAAAGGG - Intergenic
1185939341 X:4297989-4298011 CAGAAAGAATGAAGGGAAAAAGG - Intergenic
1186019184 X:5235069-5235091 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1186019197 X:5235110-5235132 AAGGAAGACGGAAGGGAGGGAGG - Intergenic
1186022414 X:5271304-5271326 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1186049917 X:5580495-5580517 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
1186107147 X:6219659-6219681 AAGAAAGAAGGAAGGGAAGAAGG - Intronic
1186239962 X:7555297-7555319 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1186402295 X:9271007-9271029 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1186791605 X:13004811-13004833 AAGTAAGACTGAAGTACAGGTGG - Intergenic
1186808573 X:13164298-13164320 AAGAAAGAAAGAAGGTAAGAAGG + Intergenic
1186912408 X:14182588-14182610 AGGTCAGACTGAAAGGAAGCTGG - Intergenic
1187149450 X:16668623-16668645 AAGGAAGGAAGAAGGGAAGAAGG + Intronic
1187208763 X:17208446-17208468 AAGAAAGAAAGAAAGGAAGAGGG + Intergenic
1187242826 X:17529022-17529044 AAGAAAGAAGGAAGGGAAGAAGG - Intronic
1187252199 X:17608759-17608781 TAGAAAGACTGAAGCCAAGAAGG - Intronic
1187264495 X:17718727-17718749 AAGGAAGAAGGAAGGAAAGAGGG + Intronic
1187413993 X:19076275-19076297 AAGCAAGGGTGAGGGGAAGAGGG + Intronic
1187838638 X:23461584-23461606 AAGAAAGAAGGAAGAGAAGATGG - Intergenic
1188321617 X:28745286-28745308 ATGGAAGACTGAAGGAAACAGGG - Intronic
1188344045 X:29042222-29042244 AACTAAGACTGAATGGAACTTGG + Intronic
1188427474 X:30065683-30065705 AAGTTAGACTGAAAAGAAAAGGG + Intergenic
1188565530 X:31522258-31522280 AAGTAACTCCGGAGGGAAGAGGG + Intronic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1189683440 X:43540006-43540028 AACAAAGAGAGAAGGGAAGAGGG + Intergenic
1190062720 X:47221551-47221573 AAGTAGGGCTGAATGGAGGATGG - Intronic
1190313485 X:49134064-49134086 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1190446564 X:50531389-50531411 AGGAAAGAGGGAAGGGAAGAAGG - Intergenic
1190652596 X:52581986-52582008 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1191027943 X:55936215-55936237 GAGTGATACTGAAGGGGAGATGG - Intergenic
1191903732 X:66065394-66065416 AAGAAAGAATGAAGGAAGGAAGG - Intergenic
1191920551 X:66252219-66252241 AAGGAAGACTGAAGAGGAGAAGG + Intronic
1192143453 X:68664204-68664226 AAGAAAGAAGGAAGGAAAGAAGG - Intronic
1192275668 X:69628354-69628376 TAGTCAGACTGAGGGAAAGAAGG + Intronic
1192307835 X:69982235-69982257 AAGTAAGACTGGTGGGAGTAGGG - Intronic
1192398216 X:70806490-70806512 AAGAAAGAATGAAGGAAGGAAGG + Intronic
1192808813 X:74532125-74532147 AAAAAAGAAGGAAGGGAAGAGGG - Exonic
1193119418 X:77807822-77807844 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1193674570 X:84434284-84434306 AAATAATACTGAATGGAAAAAGG - Intronic
1193811602 X:86057804-86057826 AAGAAAGACTGAAAGTGAGATGG - Intergenic
1194000073 X:88417287-88417309 AAGAAAGAGTGAAGGGAGGAAGG + Intergenic
1194010903 X:88559751-88559773 AGGGAAGAATGAAGGGAAAAGGG - Intergenic
1194590230 X:95791496-95791518 AAGAAAGAAAGAAAGGAAGAAGG + Intergenic
1194654687 X:96558328-96558350 AAAGAAGAAGGAAGGGAAGAAGG + Intergenic
1195619638 X:106939984-106940006 AAGTGAGACTGCAGGGAATGAGG - Intronic
1195892733 X:109713057-109713079 AAGGAGGGATGAAGGGAAGAAGG + Intronic
1196298642 X:114029259-114029281 AAGAGAGACTTAAAGGAAGAAGG + Intergenic
1196404894 X:115350760-115350782 CAGTAAGACAGCAGGGAACAAGG - Intergenic
1196818889 X:119687217-119687239 AAGAAAGAAAGAAGGAAAGAAGG - Intronic
1197582086 X:128295640-128295662 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic
1197660771 X:129168880-129168902 AGGGAAGAATGAAGGGAATAAGG + Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1198041739 X:132859691-132859713 AAGAAAGAATGAAGAAAAGAAGG + Intronic
1198133984 X:133728373-133728395 AAGAAGGAGTGAAGGAAAGAAGG + Intronic
1198421367 X:136473074-136473096 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198421381 X:136473119-136473141 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198793554 X:140371759-140371781 AAGTGAGGCTTAAGGGAACATGG + Intergenic
1199161956 X:144623377-144623399 AAGTCAGACTGGAGGGAGGCAGG + Intergenic
1199312776 X:146341085-146341107 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1199529665 X:148832166-148832188 AAGAAAAACTGAAGGAAGGAAGG + Intronic
1200428361 Y:3047035-3047057 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1200872267 Y:8114853-8114875 AAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1200957259 Y:8963014-8963036 AAGAAAGAAAGAAGGAAAGAAGG - Intergenic
1201255263 Y:12101799-12101821 AAGTAACACTAAAGATAAGAGGG - Intergenic
1201549824 Y:15208131-15208153 AAGAAAGAAAGAAAGGAAGAGGG + Intergenic
1201550376 Y:15211777-15211799 AAGAAGGAAGGAAGGGAAGAGGG + Intergenic
1201604022 Y:15765265-15765287 AATTAAGACTCAAGGGAGGCTGG - Intergenic
1201690547 Y:16760123-16760145 AAGGAAGAAGGAAGGGATGAAGG - Intergenic
1201738675 Y:17300263-17300285 AAGAAGGAAAGAAGGGAAGAAGG + Intergenic
1201788516 Y:17810974-17810996 AAGAAAGAAGGAAGGAAAGAAGG - Intergenic
1201813037 Y:18095014-18095036 AAGAAAGAAGGAAGGAAAGAAGG + Intergenic
1202093294 Y:21216646-21216668 AAGTAACACTGAGGAGAACATGG - Intergenic
1202234140 Y:22690671-22690693 AAGGAAGACAGAAGGAAGGAAGG + Intergenic
1202309018 Y:23505495-23505517 AAGGAAGACAGAAGGAAGGAAGG - Intergenic
1202332834 Y:23772673-23772695 AAGGAAGAAAGAAGGGAGGAAGG - Intergenic
1202537935 Y:25897390-25897412 AAGGAAGAAAGAAGGGAGGAAGG + Intergenic
1202561782 Y:26165093-26165115 AAGGAAGACAGAAGGAAGGAAGG + Intergenic
1202625932 Y:56858427-56858449 AAGAAAGAAAGAAGGAAAGAAGG + Intergenic