ID: 1001048548

View in Genome Browser
Species Human (GRCh38)
Location 5:168395220-168395242
Sequence TGGACATGGGTCTGTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001048548_1001048556 3 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048556 5:168395246-168395268 GCACAGCCTGATGAACAGGGTGG No data
1001048548_1001048555 0 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048555 5:168395243-168395265 GAGGCACAGCCTGATGAACAGGG 0: 1
1: 0
2: 1
3: 15
4: 332
1001048548_1001048560 16 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048560 5:168395259-168395281 AACAGGGTGGTTGGCAGGACAGG 0: 1
1: 0
2: 1
3: 16
4: 287
1001048548_1001048557 7 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048557 5:168395250-168395272 AGCCTGATGAACAGGGTGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1001048548_1001048559 11 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048559 5:168395254-168395276 TGATGAACAGGGTGGTTGGCAGG 0: 1
1: 0
2: 1
3: 15
4: 172
1001048548_1001048561 17 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048561 5:168395260-168395282 ACAGGGTGGTTGGCAGGACAGGG 0: 1
1: 0
2: 1
3: 28
4: 493
1001048548_1001048554 -1 Left 1001048548 5:168395220-168395242 CCCACAGTACAGACCCATGTCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1001048554 5:168395242-168395264 AGAGGCACAGCCTGATGAACAGG 0: 1
1: 0
2: 0
3: 22
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001048548 Original CRISPR TGGACATGGGTCTGTACTGT GGG (reversed) Intronic
904947984 1:34213276-34213298 GGGACATGGGTCGGCACTGCAGG - Intronic
907193979 1:52671455-52671477 GGGAGATGGTTCTGTACTTTAGG - Intergenic
911456031 1:98124808-98124830 TGGAGAAGAGGCTGTACTGTGGG + Intergenic
917004145 1:170394034-170394056 TGGACCAGGATATGTACTGTGGG - Intergenic
920511085 1:206552525-206552547 TGGAGATGGGTGTGAACTGTTGG + Intronic
1065916566 10:30358404-30358426 TGAGCATTGGTCTGAACTGTGGG + Intronic
1068414052 10:56693952-56693974 TGGACATGGGACTCTACTTAAGG + Intergenic
1070481493 10:76887313-76887335 TGGACTTGGGCCGGTTCTGTCGG + Exonic
1076531519 10:131148142-131148164 TGGCAAAGGGTCTGTACAGTTGG + Intronic
1076674093 10:132138900-132138922 GGGACGTGGGTCTGCCCTGTGGG - Intronic
1078936855 11:15959176-15959198 TGGACATGCTGCTGTATTGTTGG - Intergenic
1087116409 11:94529626-94529648 TGGACATGGGTTTGTAGTTCTGG - Intergenic
1089807947 11:121108350-121108372 TGTACATGTGTGTGTACTGAGGG - Intronic
1090515885 11:127426214-127426236 TGAACATGGGGTTGTAATGTTGG + Intergenic
1090908414 11:131097082-131097104 TGGACATGTGACTGCACTGCAGG - Intergenic
1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG + Intronic
1093288995 12:17299657-17299679 TTGCCCTGGGCCTGTACTGTAGG + Intergenic
1093678276 12:21969575-21969597 TGGACATGGCTCTTTATTGGTGG - Intergenic
1097493371 12:60297334-60297356 TGGAAATGGGACTGTCCTGAGGG + Intergenic
1098789066 12:74797329-74797351 TGGCCATGGGGATGTACTGTTGG + Intergenic
1107359211 13:39601924-39601946 TGGTAATAGTTCTGTACTGTGGG - Intronic
1108511720 13:51162340-51162362 TGGACATGGGTCTGTTCCGCAGG - Intergenic
1110131334 13:72015470-72015492 TGGACTTGGGTCTGTAATTCAGG - Intergenic
1110770616 13:79339754-79339776 TGGATATGCGTTTTTACTGTGGG - Intronic
1111787488 13:92808091-92808113 TGGAACAGGGTATGTACTGTTGG - Intronic
1114565005 14:23624149-23624171 TGGAGATGGGACTGTCCTGAAGG + Intergenic
1115297444 14:31845178-31845200 TGAACATGAGTTTGAACTGTGGG - Intronic
1116400951 14:44506113-44506135 TGGACATGGGTCTCTTCAGCAGG + Exonic
1121377944 14:93431014-93431036 TGGACATGGTGCTGTCCAGTTGG - Intronic
1121593563 14:95139358-95139380 TGGATGTGGTTCTGTACAGTGGG - Intronic
1122344128 14:101047615-101047637 TGGCCATGGGTGTGTGTTGTGGG + Intergenic
1122841153 14:104464089-104464111 TGGCCATGGTTCTTTACTGGTGG + Intergenic
1122918755 14:104871001-104871023 TGGACATGGGGCTGTAGGGTGGG - Intronic
1124575098 15:30901186-30901208 TGGATATGGGACTTTATTGTGGG - Intergenic
1127768585 15:62211717-62211739 GGGACATGAGTCTTTACTTTGGG + Intergenic
1128590237 15:68888854-68888876 TGGAAATGTGTCTAAACTGTGGG - Intronic
1129403606 15:75300510-75300532 TGAGCATTGGTCTGAACTGTGGG - Intergenic
1130275912 15:82476278-82476300 TGAGCATTGGTCTGAACTGTGGG + Intergenic
1130282689 15:82531992-82532014 TGAGCATTGGTCTGAACTGTGGG - Intergenic
1130468274 15:84203670-84203692 TGAGCATTGGTCTGAACTGTGGG + Intergenic
1130485477 15:84396072-84396094 TGAGCATTGGTCTGAACTGTGGG - Intergenic
1130495992 15:84469872-84469894 TGAGCATTGGTCTGAACTGTGGG - Intergenic
1130590567 15:85208268-85208290 TGAGCATTGGTCTGAACTGTGGG + Intergenic
1131705929 15:94996165-94996187 TTGAAATGCTTCTGTACTGTTGG + Intergenic
1132676609 16:1123750-1123772 TGTACAAGGGTCTGTCCTGGGGG - Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1139064479 16:63295511-63295533 GAGACATGGGACTTTACTGTAGG + Intergenic
1141155896 16:81596840-81596862 TGCACCTGAGTCTGTGCTGTGGG - Intronic
1142260539 16:89040675-89040697 TGGACATGGAGCTGGGCTGTAGG - Intergenic
1148213486 17:45821725-45821747 TGGGCATGGGACTGTCCTGGGGG + Intronic
1153971683 18:10233060-10233082 TAGACATGGGTCTGTATTTATGG - Intergenic
1154074099 18:11182097-11182119 TGGTCAAGGGTGTGTACTGATGG - Intergenic
1154131591 18:11741263-11741285 TTCACAGGGGTCTGTTCTGTTGG - Intronic
1161480634 19:4508624-4508646 TGGTCATGGCTCTGTACTCATGG - Intronic
1163096752 19:15064012-15064034 AGGCCATGGGTATGGACTGTGGG - Intergenic
1166650613 19:44571801-44571823 TGGACATGGCTCTGTCTTGCAGG - Intergenic
927928579 2:27029562-27029584 AGGACATGGGTGTCTAGTGTGGG - Intergenic
930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG + Intronic
931578032 2:63740823-63740845 TGGGCATGGCTCTGGGCTGTAGG - Intronic
932978067 2:76628997-76629019 TGAAGATGTGTCTGTAATGTTGG + Intergenic
933732464 2:85467897-85467919 TAGAGATGGGGTTGTACTGTTGG + Intergenic
937343656 2:121108968-121108990 TTGACGTGGGTCTGTTATGTAGG - Intergenic
939775306 2:146379605-146379627 TAGAAATGTGTCTGTATTGTTGG - Intergenic
948557580 2:238824223-238824245 TGGACATGGGTCCATGATGTAGG - Intergenic
1170959723 20:21014534-21014556 TGCACATGAGTCTGCAATGTGGG - Intergenic
1172263428 20:33589555-33589577 TTGTCATGGGTCTGTACTATAGG + Intronic
1173907888 20:46642038-46642060 TGGGCATGAGCCTTTACTGTGGG - Intronic
1174871271 20:54185175-54185197 TAGATATGGGTGTGTAATGTGGG - Intergenic
1174906899 20:54561338-54561360 TGCACAGGGGTCTTTACTATGGG - Intronic
1175088575 20:56482874-56482896 TGGATATGGGTGTGTGGTGTGGG - Intronic
1180005121 21:45017188-45017210 TGGACATGGGGCCCCACTGTTGG + Intergenic
1180456122 22:15513498-15513520 TGGACATGGGTGTACACTTTGGG + Intergenic
1182124355 22:27805326-27805348 TGTACATGTGTCTGTGCTGGTGG - Intergenic
1183307260 22:37089390-37089412 TGGAGATGGTTGTGTACTGGGGG - Intronic
1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG + Intronic
951038656 3:17963729-17963751 TGGACATGGCTGTGAACAGTTGG + Intronic
953684615 3:45066919-45066941 TGTACATGGGTATGTATTGTTGG - Intergenic
957147436 3:76442456-76442478 TGGAGATGGCTCTTTACTGGTGG + Intronic
958035579 3:88166526-88166548 TGGACATCTGTCTGAATTGTGGG + Intronic
959536969 3:107497561-107497583 CTGTCATGGGTCAGTACTGTGGG + Intergenic
965611651 3:170550044-170550066 TGGACATGTGTGTGTAATGAAGG + Intronic
968165682 3:196463147-196463169 GAGAGTTGGGTCTGTACTGTGGG - Intergenic
971637873 4:29086703-29086725 TGGAAATGTAACTGTACTGTGGG + Intergenic
975856662 4:78631971-78631993 TGAACATGGGTGTGAAGTGTGGG + Intergenic
980468298 4:133215641-133215663 TGGACATGTTTATGTACTGAGGG - Intergenic
987968106 5:24903081-24903103 TGGACATGGGTGTGTCATCTAGG - Intergenic
989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG + Intergenic
989131533 5:38111976-38111998 TGGACATAGGTCTGTCCCTTAGG + Intergenic
990755008 5:59058732-59058754 TAGACAGGTGTCTGTTCTGTTGG - Intronic
992097487 5:73376495-73376517 GGGACATGGGTATGTACAGTTGG - Intergenic
994606784 5:101977744-101977766 TGCACATGGGTTTATACTGTGGG - Intergenic
997119083 5:131156015-131156037 TCGACAGGTGTTTGTACTGTGGG + Intergenic
998591375 5:143482382-143482404 TGGTCATGGGTCTTTACAATAGG - Intergenic
1000365472 5:160486671-160486693 GGGACATGGGTGTGTTCTCTGGG + Intergenic
1001009954 5:168088271-168088293 TAGACATGGGTCTTTGCAGTTGG + Intronic
1001048548 5:168395220-168395242 TGGACATGGGTCTGTACTGTGGG - Intronic
1002904628 6:1438607-1438629 TGGACAGAGGTCTGTTCTGATGG - Intergenic
1004524113 6:16390137-16390159 TGGACTTGAGTCTGTAGTTTGGG - Intronic
1007157576 6:39760620-39760642 TAAACATGAGTCTGTACTTTGGG + Intergenic
1013386417 6:109636172-109636194 TGGGCATGGGTTTGTGCAGTAGG - Intronic
1014969777 6:127800432-127800454 TTACCATGGGTCTGTACTTTAGG - Intronic
1016547876 6:145244608-145244630 TGGTCATGGGACTATACTTTGGG + Intergenic
1016550693 6:145276644-145276666 TATACATAGGTCTGTGCTGTTGG + Intergenic
1018357966 6:163037711-163037733 TGCACATGCGTCTGTGCTGTAGG - Intronic
1022218379 7:28287833-28287855 ATGAAATGGGTCTGTGCTGTGGG + Intergenic
1023603594 7:41906199-41906221 TGGACTTGGCTCTTTGCTGTGGG + Intergenic
1024996292 7:55275337-55275359 AGGACATGGGGCTGTGCAGTGGG - Intergenic
1026929430 7:74215687-74215709 TGCACATGGGGCTGTCTTGTGGG + Intronic
1029261212 7:99304125-99304147 CGGACATGGGCCTGTGCTCTTGG - Intergenic
1030695899 7:112584830-112584852 TAGAATAGGGTCTGTACTGTAGG - Intergenic
1035567082 8:648625-648647 TGAACACGGGGCTGTCCTGTGGG + Intronic
1035739884 8:1919020-1919042 TGGATATGGAGCTGTTCTGTGGG + Intronic
1036701010 8:11013934-11013956 TGGATTTGGGTCTGTCCTGCGGG - Intronic
1038410850 8:27358197-27358219 TGGATATAGCTCTGCACTGTAGG + Intronic
1039405969 8:37312828-37312850 TAAACATGGGTCTTTACTGGAGG - Intergenic
1050788291 9:9432608-9432630 GAGGCATGGGTCTGCACTGTTGG - Intronic
1052247722 9:26357752-26357774 TGGATATGGCTCTGAAGTGTAGG - Intergenic
1052497720 9:29248603-29248625 TGCATATCGGTTTGTACTGTGGG - Intergenic
1056355165 9:85793774-85793796 AAGACATGGGCCAGTACTGTGGG + Intergenic
1057823306 9:98351992-98352014 TGTACATGTGTCTATAGTGTTGG + Intronic
1059251376 9:112890456-112890478 TGGAGATGGCTCTCTGCTGTTGG + Exonic
1062560353 9:137138941-137138963 GGGACAGGGGCCTGTGCTGTCGG - Intronic
1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG + Intergenic
1188458417 X:30394224-30394246 TAGACACGGTTCTGTACGGTAGG - Intergenic
1199501494 X:148511744-148511766 TGGACTTGGGGCTCTGCTGTTGG - Intronic
1202372737 Y:24209522-24209544 TGAGCATTGGTCTGAACTGTGGG + Intergenic
1202498045 Y:25460598-25460620 TGAGCATTGGTCTGAACTGTGGG - Intergenic