ID: 1001049257

View in Genome Browser
Species Human (GRCh38)
Location 5:168401309-168401331
Sequence CAGATTTCTCCCTTCTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001049252_1001049257 7 Left 1001049252 5:168401279-168401301 CCTCTTAGAAGCTCTAGGCAAGA 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 249
1001049251_1001049257 8 Left 1001049251 5:168401278-168401300 CCCTCTTAGAAGCTCTAGGCAAG 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 249
1001049249_1001049257 16 Left 1001049249 5:168401270-168401292 CCTGGTAGCCCTCTTAGAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001049257 Original CRISPR CAGATTTCTCCCTTCTAAGG GGG Intronic
902750040 1:18501747-18501769 CAAATTGCTGCCTTCTCAGGAGG - Intergenic
904318471 1:29681311-29681333 CAGACTGCTCCCTTCTAGTGGGG + Intergenic
904355994 1:29940215-29940237 CAGACTACTCCCTTCTAGTGGGG - Intergenic
904439015 1:30517671-30517693 CAGACTGCTCCCTTCTAGTGGGG - Intergenic
904487641 1:30837970-30837992 CAGAGTCCTCCATTCTCAGGGGG - Intergenic
905651262 1:39658593-39658615 CAGAATGCTTCCTTCTAAGAGGG + Intergenic
906686032 1:47764106-47764128 CAGCTATCTCCCTTCTGAGACGG - Exonic
907987309 1:59544683-59544705 CACTTTTCTCACTTGTAAGGTGG - Intronic
909102198 1:71362156-71362178 GAGATTTCTAGCTTCTAAAGTGG - Intergenic
910753043 1:90655068-90655090 CACATTTCTCACTTGTAAGTGGG + Intergenic
911295393 1:96108400-96108422 GAGATTTCTCCCTCCTAATAGGG + Intergenic
911564992 1:99453815-99453837 GAAATGTCTCCCTTCTAAGTAGG + Intergenic
911660181 1:100492797-100492819 GACATTTCTCCCTTCTAACTTGG + Intronic
912630796 1:111245044-111245066 CAGCTTTCTCATTTTTAAGGTGG + Intergenic
912935424 1:113999956-113999978 TTGATTCCTCTCTTCTAAGGGGG - Intergenic
913123102 1:115759999-115760021 CAGATCATTTCCTTCTAAGGAGG + Intronic
913520697 1:119643209-119643231 CAGATTTCTCCTTCCTGTGGAGG - Intronic
919319348 1:196015205-196015227 CAGATTTATCCATTGTAAAGGGG - Intergenic
919666386 1:200296834-200296856 CAGAGCTCACCCTTTTAAGGTGG - Intergenic
920411819 1:205767645-205767667 CACATTTCTCACTTGTAAGTGGG + Intergenic
920724177 1:208418256-208418278 CTGATTTTTCCCTTCTAACAAGG + Intergenic
921157906 1:212452558-212452580 CAGACCTCTCCCTGCCAAGGTGG + Intergenic
923140988 1:231161789-231161811 CCGTTTTCACCCTTCTATGGCGG + Intergenic
924266216 1:242284891-242284913 CAGATCTCCCCCTTGTAAAGAGG + Intronic
1064111094 10:12539651-12539673 CAGATTTCTCCCTGCAGGGGTGG - Intronic
1066162497 10:32748693-32748715 CAGTTTTTTCCCTTCTTATGTGG + Intronic
1066718614 10:38313669-38313691 CAGATCTCCCCCTTGTAAAGAGG - Intergenic
1067450682 10:46380246-46380268 CAGCTTTCTCACTTGTAAAGTGG + Intronic
1067586561 10:47479505-47479527 CAGCTTTCTCACTTGTAAAGTGG - Intronic
1071320718 10:84454268-84454290 CAAATTTCTCCCTTCTTATAAGG + Intronic
1071829080 10:89354072-89354094 TCGATTTCTTTCTTCTAAGGAGG + Intronic
1072156953 10:92732382-92732404 CAGATTTCCACCTACTAAAGTGG - Intergenic
1072276958 10:93833147-93833169 CAGATTTCTCCCTTCTGGAATGG - Intergenic
1075357063 10:121789176-121789198 CAGATTTCTCACTTTTAAAATGG - Intronic
1077882317 11:6360855-6360877 CTGAATTCTTTCTTCTAAGGAGG + Intergenic
1079140324 11:17804591-17804613 CAGATTTCTCCTTTGTAAAATGG + Intronic
1079426875 11:20351996-20352018 TAGACCTCTCCCTTCTAGGGAGG - Intergenic
1079704631 11:23598788-23598810 CATATTTCTCACTTATAAAGGGG - Intergenic
1080643098 11:34169457-34169479 CAGTTTCCTCCCCTCTAAGATGG - Intronic
1081441402 11:43085399-43085421 CAGATTTCTCCCTTTTGAAATGG - Intergenic
1081614637 11:44583394-44583416 CAGATGTGGCCCTTCTCAGGAGG - Intronic
1083336545 11:61925001-61925023 CTGATGACTCCCTTCCAAGGTGG + Intergenic
1083406016 11:62457697-62457719 CACATTTCTCACTTATAAGTGGG + Intronic
1084537030 11:69763344-69763366 CAGATTTCCCTCTTCTTATGAGG - Intergenic
1086498234 11:87425828-87425850 CAGATGGCTCCCTTCTCAGGTGG - Intergenic
1087008453 11:93491515-93491537 CTCATTTCTCACTTCTAAGGTGG - Intronic
1087932993 11:103999788-103999810 CAGATTTCACCCTTCTTTGGAGG + Intronic
1089922035 11:122218167-122218189 CAGATTTCTGCCTTCCCAGCTGG - Intergenic
1091261201 11:134235627-134235649 CAGCTTTCTCACTTCAAAGTGGG + Intronic
1092715592 12:11386449-11386471 CCCATTTCTCCCTTTTAAGTAGG - Intronic
1092732281 12:11546102-11546124 CAGATTTCTGCCTCTTAAAGCGG + Intergenic
1093072418 12:14720553-14720575 CATATTTCTCACTTATAAGTGGG - Intergenic
1093164104 12:15786032-15786054 TAGATTTCTACCATCAAAGGGGG + Intronic
1093945470 12:25103340-25103362 AAGATTTCTCCCAACTCAGGAGG - Intronic
1094453329 12:30604605-30604627 CAGATTTCTCCTGTCTGAGCAGG + Intergenic
1096815092 12:54196872-54196894 CAATTTCCTCCTTTCTAAGGTGG - Intergenic
1097606720 12:61764071-61764093 CAAATTCCTACCTTCTAAGTAGG + Intronic
1098325655 12:69298984-69299006 CCGATTTCTCCCTTTTGAGATGG + Intergenic
1098482242 12:70977181-70977203 CAGTTTTCTCATTTGTAAGGTGG - Intergenic
1103864608 12:124042040-124042062 CAGATTTCCCTCTTCTTAGAAGG + Intronic
1103907100 12:124333309-124333331 CAGAGGTCTCCCTACTGAGGGGG + Intronic
1108710917 13:53031496-53031518 CAGACGTCTCCCTCCTGAGGAGG + Intronic
1108876549 13:55056517-55056539 CAGGTTTCTCCCTTTTAAGAGGG - Intergenic
1109483043 13:62981629-62981651 CAGCTTCCTCACTTCTATGGTGG - Intergenic
1109959496 13:69612555-69612577 TAGATTTCTTTCTTCTGAGGAGG - Intergenic
1110296445 13:73871853-73871875 CAGATATCTCTCTTATAAGACGG + Intronic
1113326393 13:109285825-109285847 CAGATTTCATCCTTATCAGGAGG - Intergenic
1114898340 14:27023219-27023241 CTGATTTCTCTGTTCTCAGGAGG - Intergenic
1115961100 14:38836859-38836881 CACATTTCTCAGTTCAAAGGAGG + Intergenic
1116427247 14:44806517-44806539 CAGATTTCTGCCTTGTAAAATGG + Intergenic
1117560569 14:56933766-56933788 CAGAATTCCCCCTTCTTTGGAGG + Intergenic
1117611096 14:57484278-57484300 CAGATTTCCCCTTTTTAATGAGG - Intronic
1118481394 14:66170556-66170578 CAGTTTTCTCCCTTGTGAAGGGG + Intergenic
1119250289 14:73146940-73146962 CAGAGTTCACCCTCCTAGGGGGG - Intronic
1119637666 14:76289954-76289976 TAGATTACTGCCTTCTAACGGGG - Intergenic
1120119639 14:80663717-80663739 CAGCTTCCTCCCTTGTAGGGGGG - Intronic
1121672655 14:95724575-95724597 CAGATTTCTCCCTTTTGAAAAGG + Intergenic
1121891059 14:97591137-97591159 CAGCTTTGTCTCTTCTAAGTGGG + Intergenic
1122264186 14:100539071-100539093 TAGATGTCTCCCTTGTAGGGGGG + Exonic
1125251325 15:37708158-37708180 CAGATTTCTCCTTTTTATTGGGG - Intergenic
1127123236 15:55788996-55789018 CAGATTCCCCCCTTCCAAGTGGG + Intergenic
1127590732 15:60419907-60419929 CAAACTTCTCCCTTCAAGGGTGG + Exonic
1129690734 15:77711981-77712003 CAGATTCCTCCCATCTACAGTGG + Intronic
1130415289 15:83688231-83688253 AAAATTTCTAACTTCTAAGGAGG + Intronic
1130872667 15:87983583-87983605 CAGTTTTCTCCCTTGTAAAGTGG - Intronic
1131232694 15:90671158-90671180 CATCTTTCTCCCTTCTAAGCTGG - Intergenic
1131815182 15:96214730-96214752 GAGATTTGTCCCTCCTAAGGAGG - Intergenic
1131919573 15:97309617-97309639 AAGATTTGTCCCCTCTTAGGTGG + Intergenic
1134328046 16:13225063-13225085 CAAATTTCTCCCTTCTTATAAGG - Intronic
1134821811 16:17253046-17253068 CAGATTTCCCTCTGCTTAGGAGG - Intronic
1134879684 16:17734335-17734357 CAAACTTCTCCCAGCTAAGGAGG + Intergenic
1134898074 16:17907594-17907616 CAAACTTCTCCCAGCTAAGGAGG + Intergenic
1137755747 16:50900856-50900878 CAGCTTCCTCCCCTCTCAGGTGG + Intergenic
1137920124 16:52478759-52478781 CTGTTTCCTCACTTCTAAGGAGG + Intronic
1139169822 16:64616310-64616332 CAGATATCTCCTTTTTATGGAGG + Intergenic
1139290693 16:65855551-65855573 CGGTTTGCTCCCTTGTAAGGAGG + Intergenic
1139455452 16:67071665-67071687 CAGATTTCTCCTTCCTAAGATGG + Intronic
1139628592 16:68212392-68212414 CAGATTTTTCCCTTCTAAGTAGG + Intronic
1140034984 16:71364946-71364968 CCGATTCCTCCTTTCTAAGATGG + Intronic
1141002764 16:80323801-80323823 CACATTTCCCTCTTCTAATGAGG + Intergenic
1141788956 16:86220008-86220030 GTGATTTCTCCCTCCCAAGGGGG + Intergenic
1143282674 17:5766463-5766485 TAGATTTCTCGCTCCTGAGGTGG - Intergenic
1144266430 17:13573980-13574002 CTGATTTCTTACTTCTATGGAGG - Intronic
1145109989 17:20154331-20154353 CAAATGTCACCCTACTAAGGGGG - Intronic
1146915577 17:36676324-36676346 CTGATTTCTCCCTGCTAGGGAGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1148199812 17:45742588-45742610 CTGATTTGTCCCCTCTAGGGTGG + Intergenic
1151245791 17:72793555-72793577 CAGATTTCTAGCTTTTAAGAGGG + Intronic
1153743252 18:8151323-8151345 CAGATTTCTCCTTCCTGAGCAGG - Intronic
1154109995 18:11559627-11559649 CAGCTTCCTCCCCTGTAAGGAGG - Intergenic
1154234882 18:12595425-12595447 CAGATTTCTGACTGCAAAGGAGG + Intronic
1155074826 18:22345514-22345536 TAGATTTCTGCCTGCTTAGGAGG + Intergenic
1157558376 18:48628472-48628494 CAGTTTCCTCCCTTGTAAGATGG - Intronic
1157653991 18:49367086-49367108 CAGATGTCTCCCTCCTAACCGGG - Intronic
1157812093 18:50704572-50704594 CTGACTTCTCCCTTCTCAGAAGG - Intronic
1159402912 18:67960216-67960238 CTGAGTTCTACCATCTAAGGAGG - Intergenic
1161358742 19:3834351-3834373 CAGATTCCTACCTTCTAAGAGGG - Intronic
1163174135 19:15552392-15552414 CTGTTTTCTGCCTTCTTAGGGGG + Intergenic
1163939665 19:20480121-20480143 CAGATTTTTCCCTGTTAAGCGGG + Intergenic
1164623077 19:29708924-29708946 CAGATACCTCCCTTCTAAGACGG + Intronic
1165643994 19:37417749-37417771 CACATTTTTCCCTTCTATGGTGG - Intronic
1166092219 19:40517164-40517186 CAGTTTTCTCCTCTCTAATGTGG - Intronic
925059749 2:881672-881694 CAGGGTTCTCCCCTCGAAGGGGG - Intergenic
926056597 2:9777428-9777450 CAGGCTTCTCACTTCTAAGTGGG + Intergenic
926385745 2:12334191-12334213 CAGTTTTCTCCCTTGAAAAGTGG - Intergenic
926502023 2:13667527-13667549 CACATTTCACACTTCTAAAGTGG - Intergenic
927391541 2:22601121-22601143 CAGAATACTCCCTTCTAAGCAGG - Intergenic
927726583 2:25428846-25428868 CAGTTTTCTCTCTTCTAAAAGGG + Intronic
928997242 2:37306191-37306213 CAGTTTTCTCCCTTGTAATCAGG + Intronic
929335465 2:40738816-40738838 CAGATTTCTGACTGCAAAGGGGG + Intergenic
930369853 2:50488800-50488822 CAGATATCTGCCTTCTCAGATGG + Intronic
930864391 2:56108409-56108431 CAGCACTCTCTCTTCTAAGGAGG - Intergenic
932943645 2:76200758-76200780 CAACTTTCTCCCTTCTGAGAAGG + Intergenic
933168470 2:79099053-79099075 CAGATTTTTCCCTGTTAACGGGG + Intergenic
933522661 2:83392792-83392814 CAGTTTTCTCCCTTTTTTGGAGG + Intergenic
935581192 2:104757161-104757183 CAGGGCTCACCCTTCTAAGGGGG + Intergenic
936515921 2:113181597-113181619 GAGATCTCTGCCTTCTAGGGAGG - Intronic
936985027 2:118301066-118301088 CATATTTCTTCCTTCAAAAGTGG - Intergenic
940645459 2:156388261-156388283 CAGATCTCTCCATTCTCATGAGG + Intergenic
940851299 2:158690343-158690365 CAGCTTTCTCACTCCTGAGGTGG - Intergenic
942540757 2:177013079-177013101 CAGATTCCTCGTCTCTAAGGTGG + Intergenic
942869921 2:180722272-180722294 TAGATTTCTCACCTCTAAGATGG - Intergenic
945540764 2:211083326-211083348 CAGATTTCTCACTTCCATAGTGG + Intergenic
946077206 2:217084291-217084313 AAGTTTTCTCACTTCTAAGATGG + Intergenic
947219861 2:227781753-227781775 TAGAATTCTTCCTTCTGAGGAGG + Intergenic
1170833492 20:19863506-19863528 CAGAGTTATCCCTTCTGAAGGGG - Intergenic
1171334475 20:24371016-24371038 CAGAATCCTCCCTTCAGAGGAGG - Intergenic
1173023159 20:39284670-39284692 CATATTTCTTCTTTCGAAGGTGG + Intergenic
1177800263 21:25821796-25821818 CAGTTTTCTCCTTTCTAAAATGG + Intergenic
1178121528 21:29474610-29474632 CAGAATTCTCCCTTCTCTAGAGG + Intronic
1178608351 21:34058386-34058408 CATTTTTCTCCCTCCTCAGGTGG - Intergenic
1182431335 22:30300657-30300679 GAGATTTCTCCCCTCTAGGCTGG - Intronic
1184481479 22:44750772-44750794 GACATGTCTCACTTCTAAGGGGG + Intronic
949628200 3:5891785-5891807 CAGATTGCTGGCTTCCAAGGGGG - Intergenic
951238797 3:20266072-20266094 CAGGTTTCTCACTCCTAAGTGGG - Intergenic
952040469 3:29255645-29255667 GATATTTCTCCCTTGAAAGGGGG + Intergenic
952187383 3:30984581-30984603 CATTTTTCTACCCTCTAAGGAGG + Intergenic
953183873 3:40620512-40620534 CAGATTAGCCTCTTCTAAGGAGG + Intergenic
954426767 3:50447514-50447536 CAGTTCTCTCCCTCCTAAGGAGG - Intronic
954955306 3:54513483-54513505 CAGTTTTCTCACCTCTAAAGTGG - Intronic
955317841 3:57953592-57953614 CAGACTTCTCCATTCTCAGGTGG + Intergenic
955789301 3:62571976-62571998 CAGATCTCTCCTTTCTTAGTTGG - Intronic
955959779 3:64328311-64328333 CAGAATTCCCTCTTCTTAGGAGG - Intronic
957024280 3:75163475-75163497 AAGATGTCACCCTTCTCAGGTGG - Intergenic
958792096 3:98663468-98663490 CAGAGTTCTCACCTCTAAGATGG + Intergenic
958815286 3:98907631-98907653 CAGATTTCTACCTAATGAGGAGG + Intergenic
959231299 3:103655555-103655577 CTGATTTCTCCATTTTAATGAGG + Intergenic
959442789 3:106399035-106399057 CAGATTCCTCCCAGCTATGGTGG - Intergenic
960005217 3:112774863-112774885 CAGTTTTCTCATTTCTAAAGTGG + Intronic
960127656 3:114017989-114018011 CAGAATTCTGCCTTCAAATGAGG - Intronic
961579694 3:127870435-127870457 CACATTTCACCATTTTAAGGAGG - Intergenic
962808629 3:138944427-138944449 CACATTTCTCCTTCCCAAGGTGG + Exonic
964324554 3:155532497-155532519 CAGATTTCTCCCTAGTCACGTGG - Intronic
965770217 3:172174066-172174088 CACATTCCTCCCACCTAAGGAGG - Intronic
966098721 3:176240458-176240480 CAGATTTCTTCTTTGTAAGGAGG + Intergenic
966557646 3:181281818-181281840 CTGATTTCTGCCTTATAAGCAGG + Intergenic
967077053 3:186012954-186012976 CAGTTTTCTCCTCTGTAAGGTGG + Intergenic
970013886 4:11490936-11490958 CTGATTTATCCCTTTTTAGGGGG + Intergenic
970770588 4:19607505-19607527 CAGATTCCTCCTTTATAGGGAGG - Intergenic
970920940 4:21394303-21394325 CAGTTTTCTCACTTCTTCGGGGG + Intronic
972710814 4:41592712-41592734 CAGATTTCTAACTCATAAGGTGG - Intronic
973013334 4:45105173-45105195 CAGGTTTCTCCCTTTTTAAGGGG + Intergenic
973637701 4:52875286-52875308 CAGATTTATCTCTGCAAAGGTGG + Intronic
974289019 4:59906867-59906889 CAGAATTCTTGCTTCTGAGGAGG + Intergenic
975393054 4:73842421-73842443 CAGTTTTCTCATTTGTAAGGGGG - Intronic
976618958 4:87108340-87108362 CAGAATGCTGCCATCTAAGGTGG - Intronic
977181469 4:93880204-93880226 CAGACTTCTCCCCACAAAGGTGG - Intergenic
978171253 4:105672973-105672995 CAAATCTCTCCCTTCAGAGGAGG + Intronic
979597404 4:122549334-122549356 CAGTTTTCTCACTTGTAAAGTGG - Intergenic
979845589 4:125506718-125506740 GAGATTTCCCCCTTCCAATGGGG + Intergenic
982080111 4:151781261-151781283 CAGATTTCTCCCAGCTGAGAGGG - Intergenic
982228859 4:153190003-153190025 AACATTTCTCCCTTCCAAGATGG - Intronic
982595330 4:157376263-157376285 CAGATTACTCTCTTTTAAAGGGG + Intergenic
984305255 4:177981077-177981099 CACATTTCTCACTTATAAGTGGG - Intronic
985677964 5:1242165-1242187 CAGCTTCCTCACTTCGAAGGTGG - Intronic
986707670 5:10464880-10464902 CAGATTTCTTCTTTCCAAAGAGG + Exonic
988915404 5:35888846-35888868 CTGATTTCTCCCTTGTGATGTGG + Intergenic
988981779 5:36577174-36577196 CAGAACTCTCCCTTATAAGGTGG - Intergenic
989444602 5:41512354-41512376 CAGTTTTCTCCATTATAAAGTGG + Intergenic
990903308 5:60777009-60777031 CAGATTTCTCACTTATATGTGGG + Intronic
991646966 5:68810036-68810058 CAGGTTTCTCCCTTCTGTAGAGG - Intergenic
992017958 5:72594858-72594880 TGTGTTTCTCCCTTCTAAGGAGG - Intergenic
992158443 5:73977665-73977687 CTGTTTTCTCAGTTCTAAGGTGG + Intergenic
992221927 5:74581679-74581701 CAGATGTCTCTTTCCTAAGGAGG - Intergenic
993651626 5:90529452-90529474 CAGAGTGCTCCCTGCTAACGGGG - Exonic
994010906 5:94901193-94901215 CAAAGTTATGCCTTCTAAGGTGG + Intronic
994254897 5:97580848-97580870 AAGATTTATCCCTTCTCATGAGG + Intergenic
994331085 5:98507492-98507514 CACATTTCTCACTTATAAGTGGG + Intergenic
996701003 5:126450253-126450275 AACATTTCTCTCTTCTAAGTCGG + Intronic
997645119 5:135476851-135476873 CAGCTTTCTCACTCCTCAGGGGG + Intergenic
997902785 5:137783401-137783423 CAGATTTCTCCTCTCTGAGCAGG + Intergenic
1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG + Intronic
1001302777 5:170548928-170548950 CAGGGTTCTCCCATCTAAAGAGG - Intronic
1001437875 5:171714738-171714760 CAGCTGTCTCACTTCTAAAGTGG - Intergenic
1001886319 5:175293576-175293598 CAGGGTTCTCCTTTCTCAGGTGG + Intergenic
1002156781 5:177288274-177288296 CAGATTTCTCCATTTTAAAATGG + Intronic
1002337211 5:178488135-178488157 CAGGTTTGTCCCTTCTAATGAGG - Intronic
1002854371 6:1024191-1024213 CAGATCTGTACCCTCTAAGGAGG + Intergenic
1006827893 6:36949469-36949491 CTGAGTTCTCCCGTCTATGGAGG + Intronic
1009591252 6:65673563-65673585 CAGAGTTCTCCTTTTTAAGTTGG + Intronic
1011405891 6:87015238-87015260 AAGGTTTCTCACTTGTAAGGAGG - Exonic
1016471676 6:144381247-144381269 CACATTTCTCACTTTTAAGTGGG - Intronic
1017639033 6:156472335-156472357 CAGTTTTCTCACCTGTAAGGTGG - Intergenic
1021444698 7:20719778-20719800 CAGTTTTCTCCCTTGTGAAGAGG + Intronic
1021978419 7:26031195-26031217 CAGATTTCCCTCTTCTCAGAAGG - Intergenic
1023192601 7:37598734-37598756 CTTATTTTTCCCTTTTAAGGAGG + Intergenic
1023743447 7:43301367-43301389 CATCTCTCTCCCTTCTAGGGGGG + Intronic
1023747475 7:43334757-43334779 ACAATTTCTCCCCTCTAAGGTGG - Intronic
1023771357 7:43559567-43559589 CAGTTTTCTCACTTGTAAAGTGG - Intronic
1027983814 7:85259600-85259622 CACATTTATCCTTTCTAATGAGG - Intergenic
1029103727 7:98156843-98156865 CAGAGTTCTTCCTTCTGTGGGGG + Intronic
1029635628 7:101781819-101781841 CAGTTTCCTCCCATCTAAGAAGG - Intergenic
1029864612 7:103613887-103613909 TAAATTTCTCCCTTCTGAGATGG + Intronic
1031368288 7:120930775-120930797 CAGTTTCCTCACTTCTAAGTGGG - Intergenic
1031797092 7:126188271-126188293 CAGCTTTGTCCCGTCTTAGGAGG + Intergenic
1038067879 8:23982557-23982579 CAGAATTCTCCTTTTTAATGGGG + Intergenic
1039440225 8:37589943-37589965 CAGTTTTCTCCCCTCTAACAGGG - Intergenic
1040003145 8:42596065-42596087 CAGCTGTCTCCCTGCTACGGGGG - Intergenic
1042224135 8:66502402-66502424 CAGATTTCAAGCTTGTAAGGAGG + Intronic
1045839207 8:106560315-106560337 CAGATTTCTGCCCTGTAAGCTGG + Intronic
1046371000 8:113306305-113306327 AAGATTTCTCCCTTCAGAGTTGG - Intronic
1046744497 8:117862479-117862501 TATATTTCTCCCTTCTGAGGTGG - Intronic
1047760014 8:127947539-127947561 CAGGTTTCTCCCCTCCCAGGTGG + Intergenic
1047929325 8:129711226-129711248 CAGTTTTCTCATTTGTAAGGTGG - Intergenic
1048503699 8:135001759-135001781 GAGATTTCTGCCTTCTAGGTTGG - Intergenic
1052046294 9:23798037-23798059 CAGAGTTCTCCCTTCTTTGCCGG - Intronic
1052400753 9:27997402-27997424 CAGATTTCTCACTTATGACGGGG - Intronic
1052567050 9:30168256-30168278 CAGACTTCTGGCTTCTAATGTGG - Intergenic
1054935940 9:70687756-70687778 CAGATTTCTGACTTTTAAGGGGG - Intronic
1055447547 9:76397698-76397720 CAGAATTCTTCCTTCTTGGGAGG - Intergenic
1056652808 9:88482894-88482916 CAGATTTCTCCCTTCGAACTGGG - Intergenic
1057442132 9:95090545-95090567 CTGCTTCCTCCCTTCGAAGGGGG - Intergenic
1058052918 9:100424680-100424702 CAGTTTTCTCATTTCTAAGATGG - Intergenic
1058492374 9:105516138-105516160 CAGATTTCTCCTCTCTGAGCAGG + Intronic
1060328205 9:122638869-122638891 AAGATTTCTCCCTTCTATTCCGG - Intergenic
1060545062 9:124454630-124454652 CAGTTTCCTCCCTTGTAAAGGGG + Intronic
1060585383 9:124782298-124782320 CAGCTTTCTCCTCTCTAAGGTGG + Intronic
1189106032 X:38236193-38236215 CATATTTCTTCCTCTTAAGGTGG + Intronic
1189869764 X:45369553-45369575 CTGATTTCTCCCATTTAGGGTGG + Intergenic
1190370777 X:49738741-49738763 CAGATTTCTCTCTCCTACTGTGG - Intergenic
1190968567 X:55327094-55327116 CACCTTTCTCCCCTCTAGGGTGG - Intergenic
1191248467 X:58246569-58246591 CAGGTGTCTCCATTCTTAGGCGG - Intergenic
1191749524 X:64526926-64526948 CACATTTCTCACTTATAAGTGGG + Intergenic
1191791759 X:64978603-64978625 CAGTTTTCTTCCTTCTAAAAGGG - Intronic
1193787722 X:85780687-85780709 CAGACTTTTCACTTCTAAGATGG - Intergenic
1195286444 X:103389183-103389205 CAGTTTCCTCCCTTGTAAAGTGG - Intergenic
1195499982 X:105585589-105585611 CACATTTCTCACTTATAAGTGGG - Intronic
1195538940 X:106040346-106040368 CAGTTTTCTCACCTCTAAAGTGG + Intergenic
1196039240 X:111184053-111184075 CAGATTTCTCATTTGTAATGAGG + Intronic
1197126909 X:122957643-122957665 CAGACTTCACCTTTCTAAGATGG + Intergenic
1197538175 X:127718001-127718023 CAGATTTCTCCCTCGTCATGTGG + Intergenic
1200136265 X:153876109-153876131 CAGATTTCTCCCTCCAAGGTGGG - Intronic
1200437154 Y:3165548-3165570 CTGATTTCTCCCTTCTGAAATGG - Intergenic