ID: 1001050395

View in Genome Browser
Species Human (GRCh38)
Location 5:168409397-168409419
Sequence GCTGGACACATGGTGGTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001050395_1001050400 -6 Left 1001050395 5:168409397-168409419 CCCCATACCACCATGTGTCCAGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1001050400 5:168409414-168409436 TCCAGCTACTAGCCATCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1001050395_1001050403 12 Left 1001050395 5:168409397-168409419 CCCCATACCACCATGTGTCCAGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1001050403 5:168409432-168409454 GCAGGCCAAAGTATTTGTAAAGG 0: 1
1: 0
2: 0
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001050395 Original CRISPR GCTGGACACATGGTGGTATG GGG (reversed) Intronic
901901826 1:12371207-12371229 GCTGGAGACAGGGAGGAATGGGG - Intronic
903550893 1:24156890-24156912 GGTGGACACAGGGTGGGCTGAGG - Exonic
904578034 1:31518128-31518150 GCTGGTCACATGGTCATAGGTGG - Intergenic
905956528 1:42001933-42001955 GCAGGACATATGCTGGAATGGGG - Intronic
907328766 1:53657973-53657995 GCTGGAGACCAGGTGGAATGTGG - Intronic
907385078 1:54120951-54120973 ACTGGAGAGATGGTGGTACGTGG + Intergenic
907557635 1:55358622-55358644 GCTAAAAAGATGGTGGTATGAGG - Intergenic
910558018 1:88558296-88558318 GCTGGAGATATGGTGGGGTGGGG - Intergenic
910562172 1:88601993-88602015 GCTGGTCACATGGTTGTAGCTGG - Intergenic
910911900 1:92243719-92243741 GCTGAACACATGGAGGTGTCTGG + Intronic
910948497 1:92618739-92618761 GCTGGTCACGTAGTGGTATCTGG - Intronic
911108350 1:94156292-94156314 GCTGGACACATTATTTTATGAGG + Intronic
911403637 1:97408267-97408289 GCTGGTCACGTGGTCGTAGGTGG - Intronic
911738123 1:101359902-101359924 GCTGGTCACATGGTCGTAGCTGG + Intergenic
912609389 1:111028057-111028079 TCTGAACACATGGTGTTATCTGG - Intergenic
913559440 1:120002611-120002633 GCTGGTCACATGGTAGTAGCTGG - Intronic
913638421 1:120787929-120787951 GCTGGTCACATGGTAGTAGGTGG + Intergenic
914280030 1:146162033-146162055 GCTGGTCACATGGTAGTAGCTGG - Intronic
914541075 1:148612972-148612994 GCTGGTCACATGGTAGTAGCTGG - Intronic
914625567 1:149458274-149458296 GCTGGTCACATGGTAGTAGCTGG + Intergenic
916105915 1:161432261-161432283 GCTGGTCACATGGTGATAGCTGG + Intergenic
916161217 1:161917060-161917082 GCTGGGGATATGGTGGTAAGTGG - Intronic
920847187 1:209604106-209604128 GCTGGACACAACGTGGTTTTTGG + Intronic
922891649 1:229066459-229066481 GCTGGACACATGGAGGTTCTTGG - Intergenic
922956386 1:229604776-229604798 GCTGGTCACATGGTGGTTGCTGG - Intronic
924099629 1:240590002-240590024 CCAGGACACATGGTGGGAGGTGG + Intronic
1064321078 10:14305129-14305151 ACTGGACACATGCTGGTAATAGG - Intronic
1066347992 10:34608104-34608126 GCTTGACACATGTCAGTATGTGG - Intronic
1067645633 10:48099238-48099260 GCTGGTCACATGGTTGTATCTGG - Intergenic
1069940071 10:71949225-71949247 GCTGGTCACAAGATGATATGTGG - Intergenic
1071887459 10:89966600-89966622 GCTGAACACACGGAGGTATGTGG + Intergenic
1073312610 10:102554464-102554486 GCTGGTTACATGGGTGTATGTGG - Intronic
1074704301 10:116117648-116117670 GATGGATAGATGGTGGGATGGGG + Intronic
1074709911 10:116168695-116168717 GCTGGACAGACGGTGGGAAGGGG - Intronic
1075607084 10:123819442-123819464 GCTGGTCACATGGTCGTAGATGG - Intronic
1079115131 11:17635722-17635744 GCTGGGCACATGGCGGGCTGCGG + Intronic
1081927167 11:46840626-46840648 GCTGAACACATGGTGGTCCCTGG + Intronic
1083734480 11:64671583-64671605 GCTGGACACATGCAGGTTAGAGG + Intronic
1084312697 11:68326135-68326157 GCTGGAGCCCTGGTGGGATGGGG + Intronic
1085937859 11:81171681-81171703 GCTGGTCACATGGTAGTAGCTGG + Intergenic
1086990036 11:93292689-93292711 ACTGGTCACATGGTTGTATCTGG - Intergenic
1089019842 11:115201767-115201789 GCTGGACTTATGGTGGTGTTGGG + Intronic
1091845218 12:3650632-3650654 GCAGGACACAGGGTGGGGTGGGG - Intronic
1091883527 12:3999366-3999388 CCTGGCCACATGGTGGGATTAGG - Intergenic
1092938510 12:13386160-13386182 GCTGGAGACATGGCTGTTTGAGG + Intronic
1093036623 12:14337685-14337707 GCTGGTCACATGGTCGTAGCTGG - Intergenic
1096289049 12:50325258-50325280 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1098239786 12:68455516-68455538 GCTGTAAACAAAGTGGTATGAGG - Intergenic
1098750103 12:74281603-74281625 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1099366191 12:81767391-81767413 GCTGGTCACATGGTCGTAGCTGG - Intergenic
1100784002 12:98059770-98059792 AGTGGACACATGGTGGAAAGAGG - Intergenic
1101247049 12:102893538-102893560 GCTGGACAAATGATAGCATGTGG - Intronic
1101843973 12:108346826-108346848 GCTGGGCACATGGTAGCAAGAGG - Intergenic
1103251374 12:119502843-119502865 GGTGGACAGATGGTGGCATGAGG - Intronic
1104633291 12:130422758-130422780 GCTGGGCGCATGGTGGGGTGAGG + Intronic
1105924788 13:24998173-24998195 TCTGAACACATGGTGTTATCTGG - Intergenic
1106842500 13:33699458-33699480 GCTGGATGGAGGGTGGTATGGGG - Intergenic
1107955770 13:45509718-45509740 GCTGGAGAAATTGTGGTCTGTGG - Exonic
1108239209 13:48444659-48444681 GCTGAACACATGGAGGTTTCTGG - Exonic
1112792919 13:103023182-103023204 GCTGGATACATGGGGGTTTGGGG - Intergenic
1113170968 13:107502932-107502954 GCTGGATACACTGTGGGATGTGG - Intronic
1114405878 14:22455619-22455641 GGTGGACACAAGGTGAAATGAGG + Intergenic
1115648678 14:35387703-35387725 GCTGAACACATGGAGGTTTCTGG - Intergenic
1116301115 14:43184650-43184672 TCTAGACACATGGGGATATGTGG - Intergenic
1119107274 14:71936842-71936864 GCTGGTCACATGGTCGTAGCTGG + Intronic
1119174686 14:72560423-72560445 GCAGGAAACATGGGGGTGTGGGG - Intronic
1121053878 14:90837244-90837266 CCTGGACATATTGTGGTATTTGG - Intergenic
1121243471 14:92446690-92446712 GCTGGACACATAGTGGGCTTTGG + Intronic
1124235277 15:27984520-27984542 CCTGGGCACCTGGTGGTCTGGGG + Intronic
1128256509 15:66201200-66201222 GCTGGACTTGTGGTGGGATGAGG - Intronic
1128675479 15:69605359-69605381 GCTGGACACATAGTAGTACTTGG + Intergenic
1130683150 15:86014067-86014089 GCAGGGCACAGGGTGGTATGGGG - Intergenic
1131841309 15:96440853-96440875 GCTTGTCCCATGTTGGTATGAGG + Intergenic
1132217887 15:100080633-100080655 GCTGGTCACATGGTTGTAGCTGG - Intronic
1132825697 16:1904165-1904187 GCTGGGCCCATGTTGGTAGGGGG - Intergenic
1133631365 16:7625184-7625206 TCTGAACACATGGTGTTATCTGG + Intronic
1135056874 16:19239137-19239159 GCTGGACATATGGTGGCGTGTGG + Intronic
1135492011 16:22917480-22917502 TATGGACACATGGAGGTATCTGG - Intergenic
1137044802 16:35644901-35644923 GCTGAACACATCCTGATATGTGG + Intergenic
1139803446 16:69543465-69543487 GCTGGACACATGGAGGTTCCTGG + Intergenic
1140272566 16:73479917-73479939 GCTGGGCAAATGGAGGCATGGGG + Intergenic
1141836855 16:86546357-86546379 GCTGTACACATGTTGGGCTGGGG + Intronic
1143326122 17:6099613-6099635 TCTGAACACATGGTGTTATCTGG - Intronic
1146460248 17:33040534-33040556 CCAGGACAGATGGTGGTAGGTGG + Intronic
1147009590 17:37434412-37434434 GCTGAACACATGGAGGTAGAGGG - Intronic
1148088697 17:45009734-45009756 GCTGCAGACATGGTCTTATGAGG - Intergenic
1148635410 17:49145505-49145527 GCTGGTCACATGGTCGTAGCTGG + Intronic
1148862277 17:50610654-50610676 GCTGGAGACATAGTGTTATGAGG - Intronic
1151616774 17:75218325-75218347 GTAGGACACATGGTGGGAGGTGG - Intronic
1152855857 17:82664213-82664235 GCTGGGCAGATGGTGGTGGGGGG + Intronic
1154005465 18:10523739-10523761 TCTGAACACATGGTGTTATCTGG + Intergenic
1154285880 18:13056135-13056157 GCAGGACACAGGGTGTGATGTGG - Exonic
1155844062 18:30683464-30683486 ACTGGACACATAATGGTTTGAGG + Intergenic
1156174026 18:34521165-34521187 GCTGGAAACATACTGGGATGAGG - Intronic
1159566578 18:70057795-70057817 CCTGGACACATGTCTGTATGAGG + Exonic
1160167348 18:76526075-76526097 GTTTGACAAATTGTGGTATGGGG + Intergenic
1161980274 19:7626636-7626658 GCTGGACCCATTGTGGGTTGGGG - Intronic
1165570293 19:36770157-36770179 GCTGAACACATGGTGGTTCCTGG - Intronic
930017545 2:46981404-46981426 GCTGGGCACATAGTGGACTGTGG + Intronic
933771413 2:85746756-85746778 GCTGGAAAGATGGTGGGATTTGG - Intergenic
934683416 2:96302899-96302921 GCTGCACACATGGAGGTTTCTGG - Intronic
935156012 2:100484329-100484351 GCTGGACACATGGAGGTTGCTGG + Intergenic
937293418 2:120795697-120795719 GCTGGACACCTGGAGGAGTGGGG - Intronic
937885228 2:126894957-126894979 GCTGGGAACATGGTGGTGTGTGG + Intergenic
938731753 2:134152230-134152252 GCGGGTCCCATGGTGGTAAGCGG - Intronic
942675922 2:178426827-178426849 GCTGGACAGATTGTGGCAAGGGG + Intergenic
943021111 2:182575031-182575053 GCTGGTCACATGGTTGTAGCTGG + Intergenic
943246751 2:185463180-185463202 GGTAGAGACATGGTGGTAGGGGG + Intergenic
943383799 2:187179085-187179107 GCTGGTCACATGGTTGTAGCTGG + Intergenic
946527548 2:220537676-220537698 GCTGGTCACATGGTCGTAGCTGG + Intergenic
948806808 2:240456589-240456611 GCCGGACACATGATGGTAATGGG - Exonic
948890766 2:240906067-240906089 GCTGGACACACGGTGGGCAGAGG - Intergenic
1169869740 20:10237899-10237921 TCAGGAGAAATGGTGGTATGGGG - Intronic
1170199946 20:13731884-13731906 GCTGGACACATGGAGGTTCCTGG + Intronic
1170257384 20:14360098-14360120 GCTGGGCACAGGGTGGTGGGGGG + Intronic
1173476687 20:43364729-43364751 GAGGGACACCTGGTGGGATGAGG - Intergenic
1173505532 20:43584183-43584205 GCTGTTCACATGGTGGCATCAGG + Intronic
1174284322 20:49461451-49461473 GCTGGATAAATGGGGGTTTGGGG + Intronic
1174750906 20:53110647-53110669 ACTGGAAATATGGTGGTAAGGGG + Intronic
1174926336 20:54763965-54763987 GCTGAAAACAGGGTGGTCTGAGG - Intergenic
1178751030 21:35303238-35303260 GCTGGCAACATCGTGGAATGTGG - Intronic
1179518969 21:41929725-41929747 GCTGGACACTTGGTGATCTTTGG - Intronic
1179862798 21:44199596-44199618 TTTGAACACATGGTGTTATGTGG - Intergenic
1180782423 22:18528706-18528728 GCTGGACCCAGGGTGGGGTGAGG + Intronic
1181125977 22:20702733-20702755 GCTGGACCCAGGGTGGGGTGGGG + Intergenic
1181239314 22:21468041-21468063 GCTGGACCCAGGGTGGGGTGGGG + Intergenic
1181671571 22:24427801-24427823 CCTGGACACATGGGGGTGTGGGG + Intronic
1181808849 22:25391393-25391415 GCTGGAGCCCTGGTGGGATGGGG - Intronic
1181972175 22:26699177-26699199 GCTTGAAAAATGGTGGCATGAGG + Intergenic
1183423109 22:37723687-37723709 GCTGGACACAGGGTGTCCTGGGG - Exonic
1184516375 22:44965243-44965265 GCTGCACACCTGCTTGTATGTGG + Intronic
954123931 3:48517716-48517738 GCTGGACACAGTGTTGCATGTGG + Exonic
956589886 3:70903639-70903661 GCTGGGCACATGGCTGTAGGTGG - Intergenic
956905411 3:73760350-73760372 GCTGAACCCATGGAGGTATAGGG - Intergenic
958170459 3:89933282-89933304 GCCTGACACATGGGGGTGTGTGG + Intergenic
959226512 3:103595273-103595295 GCTGGTCACATGGTTGTAACTGG + Intergenic
960973882 3:123157397-123157419 GCTGGCCACAGGCTGGTGTGTGG + Intronic
963609579 3:147449358-147449380 TCTGCCCACATGCTGGTATGTGG + Intronic
965819039 3:172666265-172666287 TCTGAACACATGGTGTTATCCGG - Intronic
968887187 4:3341255-3341277 GGTGGAGAGATGGGGGTATGGGG + Intronic
968887214 4:3341320-3341342 GGTGGAGAGATGGGGGTATGGGG + Intronic
968887251 4:3341417-3341439 GGTGGAGAGATGGGGGTATGTGG + Intronic
971460251 4:26888535-26888557 GCTGGTCACATGGTCGTAGCTGG + Intronic
974516625 4:62922660-62922682 TCTTGACACGTGGTGTTATGGGG + Intergenic
976685804 4:87813195-87813217 GCTGGACAAGGGGTGGAATGAGG + Intergenic
978898789 4:113924832-113924854 GCTGGTCACATGGTCGTAGCTGG + Intronic
980401392 4:132290598-132290620 TCTGGAGAAATGGTGGGATGGGG + Intergenic
984232467 4:177115433-177115455 GCTGAACACATGGAGGTTTCTGG + Intergenic
984403715 4:179300247-179300269 GCTGGTCACATGGTTGTAACTGG + Intergenic
984887362 4:184461960-184461982 GCTGGACACCTGGGGATGTGGGG - Intronic
987336764 5:16904179-16904201 GCTGGACACATGGGGGTTTCTGG + Intronic
987724947 5:21685999-21686021 GCTGAACACATGGAGGTTTCTGG + Intergenic
988267494 5:28971368-28971390 GCTGGTCACATGGTCGTAGCTGG + Intergenic
994100774 5:95890168-95890190 GTTGGTGACATGGTGGTTTGGGG - Intronic
994598745 5:101873917-101873939 GCTGGATAGCTAGTGGTATGTGG - Intergenic
998883762 5:146672495-146672517 GCTGGAGACATGGGGGTGGGGGG + Intronic
1000048430 5:157541066-157541088 CCTGGACACATGGGCGTATGTGG - Intronic
1001050395 5:168409397-168409419 GCTGGACACATGGTGGTATGGGG - Intronic
1001591026 5:172865535-172865557 GGTGGCCACATGGGGGTATCAGG - Intronic
1002044463 5:176534136-176534158 GCTGGACACAAGGTGGTCCCTGG - Intronic
1002210121 5:177593761-177593783 GCTGGAGGCATGCTGGTAAGTGG + Exonic
1002276818 5:178109280-178109302 GCTGGACTCCTGCTGGGATGGGG - Intergenic
1005185439 6:23159067-23159089 GCTGGTCACATGGTCGTAGTTGG - Intergenic
1006405328 6:33841680-33841702 GCTGGACAGAAGATGGTCTGGGG - Intergenic
1006634173 6:35450421-35450443 GCTGGGGACATGGAGGAATGGGG + Intergenic
1007852084 6:44812926-44812948 GCTGTACATATGGTGGGGTGGGG + Intronic
1008634149 6:53392698-53392720 GCTGAACACGTGGAGGTTTGTGG - Intergenic
1009616188 6:66010215-66010237 GCTGGACAAAAGGTGCTGTGGGG - Intergenic
1012920507 6:105217553-105217575 GCTGGTCACATGGTTGTAGCTGG + Intergenic
1013586473 6:111583156-111583178 CTTGGAGACATGGTGGTAAGAGG - Intronic
1018566629 6:165161685-165161707 GCTGGACACACGGTGCTCTGGGG - Intergenic
1019920971 7:4163160-4163182 GCTGGGAACATAGTGGGATGGGG + Intronic
1020111034 7:5447904-5447926 GCTGGGCACAGGGCGGGATGAGG - Intronic
1021792312 7:24217888-24217910 GCTGAAGACTTGGTGGTCTGGGG - Intergenic
1025854713 7:65267036-65267058 GCTGGGCACATGGATGTCTGGGG - Intergenic
1030104950 7:105979275-105979297 GCTGGGCACATGGTAGTGAGGGG - Intronic
1030622081 7:111801130-111801152 TCTGAACACATGGTGTTATCCGG - Intronic
1030897424 7:115078110-115078132 TTTGGAGGCATGGTGGTATGTGG + Intergenic
1032855171 7:135828124-135828146 GCAGGAGCCATGGTGGGATGGGG + Intergenic
1037546600 8:19929964-19929986 CCTGGAAATATGGTGGGATGTGG - Intronic
1038720916 8:30034627-30034649 TCTGAACACATGGTGTTATCTGG + Intergenic
1040912204 8:52530417-52530439 GCTGGTCACATGGTTGTAGCTGG - Intergenic
1040982140 8:53254854-53254876 GCCTGACACGTGGTGGTGTGGGG + Intergenic
1041387380 8:57318866-57318888 TCTGAACACATGGTGTTATCTGG + Intergenic
1041741791 8:61164518-61164540 TCTGCACACATGGGGATATGTGG - Intronic
1042321286 8:67478215-67478237 GCTGGACACATGGAGGTTCATGG + Intronic
1048154850 8:131936829-131936851 GCTGGACACATGGAAGTTTCCGG - Intronic
1050813016 9:9774023-9774045 GCTGGACTCATGCAGGTAAGTGG + Intronic
1051882227 9:21851274-21851296 GCTGGTCACATGGTTGTAGCTGG - Intronic
1051992770 9:23173160-23173182 GTTGTACACAAGGTCGTATGTGG - Intergenic
1053256854 9:36624925-36624947 GGTGGACAGATGCTGGTATGGGG + Intronic
1056156951 9:83847210-83847232 GCTGGTCACATGGTCGTAGCTGG - Intronic
1056601539 9:88050809-88050831 TCAGGACACATGGTGGTAGCTGG - Intergenic
1057760890 9:97873621-97873643 TCTGAACACATGGTGTTATCTGG - Intergenic
1058020173 9:100078056-100078078 GCTGGCCACATGGTCGTAACTGG - Intronic
1060291939 9:122311301-122311323 GCTGGACACAGGGAGGGCTGAGG - Intronic
1062580985 9:137229139-137229161 GCTGAACCCATGATGGTGTGTGG - Exonic
1186469476 X:9810128-9810150 GCTGGTCACATGGTTGTAGCTGG + Intronic
1187013005 X:15298977-15298999 AGGGGACACATGGTAGTATGGGG - Intronic
1189887154 X:45559419-45559441 CCTTGACACATGGGGATATGGGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190158200 X:48010569-48010591 GCTGGAAGAATGGTGTTATGTGG - Intronic
1190173971 X:48133451-48133473 GCTGGAAGAATGGTGTTATGTGG - Intergenic
1200456915 Y:3405128-3405150 CCTGCACACATGGTGTTATCCGG + Intergenic
1200707447 Y:6455039-6455061 GATAGACACAAGGTGGGATGTGG - Intergenic
1200745703 Y:6902317-6902339 GCTGGTCACATGGTTGTAGCTGG + Intergenic
1201026665 Y:9709669-9709691 GATAGACACAAGGTGGGATGTGG + Intergenic
1201955087 Y:19614478-19614500 GCAAGACACTTGGTTGTATGAGG + Intergenic