ID: 1001050966

View in Genome Browser
Species Human (GRCh38)
Location 5:168414213-168414235
Sequence TTGATCAGCTTGTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001050966_1001050968 28 Left 1001050966 5:168414213-168414235 CCTTGAGATGACAAGCTGATCAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1001050968 5:168414264-168414286 CTGAGATGTCTGTTTCTTCATGG 0: 1
1: 0
2: 3
3: 36
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001050966 Original CRISPR TTGATCAGCTTGTCATCTCA AGG (reversed) Intronic
907651807 1:56302411-56302433 TTGAGTAGGTTGTCATTTCATGG - Intergenic
908265483 1:62374777-62374799 TGGATCACCTTCTTATCTCAGGG + Intergenic
909253016 1:73382157-73382179 TGGTTCTGTTTGTCATCTCAAGG + Intergenic
910623047 1:89276829-89276851 TTGATCACCTTGACATCTAGTGG + Intergenic
913649772 1:120901556-120901578 TTTCTCATCTTGTCTTCTCATGG - Intergenic
913677002 1:121150228-121150250 TTGATCAGATTGTGATATGATGG + Intergenic
914028838 1:143937856-143937878 TTGATCAGATTGTGATATGATGG + Intergenic
914076912 1:144361972-144361994 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914102266 1:144604533-144604555 TTTCTCATCTTGTCTTCTCATGG - Intergenic
914171361 1:145227541-145227563 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914296632 1:146332663-146332685 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914526470 1:148471507-148471529 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914639934 1:149595615-149595637 TTTCTCATCTTGTCTTCTCATGG - Intergenic
915289564 1:154874124-154874146 TTTGTCAGCCTGTCATCTTAGGG - Intergenic
919002766 1:191854998-191855020 TTTATCAGCTTCTGATATCATGG + Intergenic
920464300 1:206168745-206168767 TTGATCAGATTGTGATATGATGG + Intergenic
920751467 1:208681804-208681826 TTTTTCAGCTTGTCAATTCAGGG + Intergenic
921772672 1:219060649-219060671 TTGACCAGCCTGTCACTTCATGG - Intergenic
1066013877 10:31218242-31218264 TTGTTCAGTTTGTAATCTTAAGG - Intergenic
1066783794 10:38979969-38979991 TTTAGAAGTTTGTCATCTCAGGG + Intergenic
1069505489 10:68993790-68993812 TTGTTAACCTGGTCATCTCATGG + Intronic
1083107298 11:60370632-60370654 TTCATCAGCTTGGATTCTCAAGG + Intronic
1085131400 11:74042096-74042118 GTGGTCAGTTTGTCATCACATGG + Exonic
1085487501 11:76879171-76879193 TTGATCAGCTTTTTCTCTTATGG + Intronic
1086368965 11:86137407-86137429 CTGTCCATCTTGTCATCTCAAGG - Intergenic
1090663359 11:128897668-128897690 TTGATCAGTTTGTCTTCTTATGG + Intronic
1090968903 11:131622798-131622820 TTGCTCAGCTTGTTAGCTCAAGG - Intronic
1093669562 12:21857584-21857606 TGGATAAGCTCCTCATCTCAAGG - Intronic
1093901930 12:24645547-24645569 TTGATCAGGTGGGCATCACAGGG + Intergenic
1095690811 12:45086436-45086458 TTGATCAGCCTTGCATCCCAGGG + Intergenic
1096992227 12:55814220-55814242 GTGATCAGCTTGTATTCTCTTGG - Intronic
1097637638 12:62142142-62142164 TTTATAAGCTTGTGATCTTAAGG + Intronic
1099823865 12:87750116-87750138 TTCAACAGCTTGTCAGCTTAAGG - Intergenic
1100704631 12:97186730-97186752 TTGATCACCTTCTCCTCTCAGGG - Intergenic
1107812003 13:44209361-44209383 ATGATTCTCTTGTCATCTCAAGG - Intergenic
1110925274 13:81142937-81142959 TTGATCATCTTGGCATCCCATGG + Intergenic
1114367346 14:22043986-22044008 TAGATCTGCTTATCATCCCAGGG + Intergenic
1114959953 14:27873652-27873674 TTTATCAGCTTGACAGCTTAAGG - Intergenic
1115630963 14:35244960-35244982 TTGCTCAGCTTATCTTCTCAAGG - Intronic
1121988798 14:98534166-98534188 AGGATCATCTTCTCATCTCAAGG + Intergenic
1122015842 14:98796042-98796064 TTCATCAGCCTCTCCTCTCAAGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1202833931 14_GL000009v2_random:63910-63932 TTGAACAGCTTGTGTTCTTATGG + Intergenic
1124455631 15:29840254-29840276 TTGATCAGTTTTTCCTCTTATGG + Intronic
1126917479 15:53482209-53482231 TTGATCAGACTGTCATCCCTGGG - Intergenic
1128766499 15:70254262-70254284 TTCATCAGTTTGTCTTCTCGTGG + Intergenic
1129201503 15:74004676-74004698 TTCTTCAGCTCTTCATCTCAGGG + Intronic
1129945545 15:79536472-79536494 TAGATCAGCTTGTCGTCCCATGG - Intergenic
1130935933 15:88470410-88470432 TTAATGATTTTGTCATCTCATGG - Intronic
1131820839 15:96272009-96272031 TTGGTGAAGTTGTCATCTCAAGG - Intergenic
1134807706 16:17139846-17139868 ATGATGAGCTTGTCATCACTGGG - Intronic
1135935797 16:26778925-26778947 TTGATCAGCTTGGGAGCCCAGGG - Intergenic
1137434817 16:48446647-48446669 TTGGTCAGCTTTCCATCCCATGG + Intronic
1138702710 16:58881079-58881101 TTAATTAGATTGTCACCTCAGGG - Intergenic
1139863911 16:70049503-70049525 TTAAGCAGCTTGTCATTACATGG - Intergenic
1140194010 16:72841960-72841982 CTGATGACTTTGTCATCTCATGG - Intronic
1140709001 16:77658823-77658845 TTGAGCAGCTTCTCACCTCTGGG + Intergenic
1140974111 16:80042876-80042898 TTAATCAGCTTTGCAGCTCAGGG + Intergenic
1141418194 16:83893345-83893367 TTGGTTAGCTTGACATTTCATGG + Intergenic
1144478807 17:15612152-15612174 TTGATTTGGTTGTCTTCTCAGGG - Intronic
1144919494 17:18751581-18751603 TTGATTTGGTTGTCCTCTCAGGG + Intronic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1151131416 17:71901009-71901031 TTCATTACCTTGGCATCTCAGGG - Intergenic
1153098823 18:1440532-1440554 TTCATCAGGCTGTCAACTCAGGG + Intergenic
1156574333 18:38297119-38297141 TGTATCAGCTAGACATCTCATGG + Intergenic
1157667238 18:49498114-49498136 CTCATCAGCTTTTCATCTAATGG + Intergenic
1158407102 18:57169461-57169483 TTGAGCAGCTCGACATCCCAAGG - Intergenic
1166528228 19:43526544-43526566 TTGATCAGCTGGGCATCCCGAGG + Exonic
1202638753 1_KI270706v1_random:63782-63804 TTGAACAGCTTGTGTTCTTATGG - Intergenic
928478058 2:31651727-31651749 GTGAGGAGCTTGTCATCTCCAGG + Intergenic
930373728 2:50538201-50538223 TTAATAAACTTTTCATCTCAGGG + Intronic
931171889 2:59812445-59812467 TTGACCTTCTTCTCATCTCATGG + Intergenic
934871306 2:97868854-97868876 TTGATGAGCCTGTCATTTAAAGG - Intronic
934881205 2:97981559-97981581 TTGATAGGCTTTTCATCTAAGGG - Intronic
936226458 2:110658297-110658319 TTGATTAGCTTGTCACATAAAGG - Intronic
940318835 2:152352541-152352563 ATGATGAGCTTGCCATCACAAGG - Intronic
942011648 2:171768848-171768870 CTGATTATCTTGTCCTCTCATGG - Intergenic
944127307 2:196309050-196309072 TTGATAAGCATGTGATCACATGG - Intronic
944419017 2:199508944-199508966 TTTATCATCTTGTCATGACATGG + Intergenic
946920091 2:224570698-224570720 TCGATCAGGTTGTGATTTCATGG - Intronic
947933939 2:233987433-233987455 TTGAGCATCTTGGAATCTCAGGG - Intronic
948114667 2:235485550-235485572 TGGTTCTGCTTGTCATCTCCAGG - Intergenic
1170290862 20:14766717-14766739 TAAATTAGTTTGTCATCTCAAGG + Intronic
1176894191 21:14356547-14356569 TTGTTCAGTCTGTCATCTCATGG + Intergenic
1176923706 21:14720970-14720992 TTCATCAGTTTTTCATTTCAGGG - Intergenic
1177542892 21:22518796-22518818 TTAAACAACTTGTCAACTCACGG + Intergenic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1179839460 21:44061820-44061842 TTGTTAACCTGGTCATCTCATGG - Intronic
953979600 3:47407024-47407046 CTGAGCTGCTTGTCATCTGATGG + Intronic
957379275 3:79404517-79404539 TTGCTATGCTTGTCGTCTCAGGG - Intronic
960875276 3:122289526-122289548 TTGCTGAGCTTTTCCTCTCAAGG - Intergenic
962394040 3:134999296-134999318 TTGATCAGCTTCATATCTTAAGG + Intronic
967413795 3:189195054-189195076 CTGAGCAGCTTTGCATCTCAGGG - Intronic
967480231 3:189964049-189964071 ATGATCAGCTTCTCATCTGGAGG - Exonic
968142449 3:196269793-196269815 TTGATCTTCGTATCATCTCATGG - Intronic
970630888 4:17943148-17943170 TTGATTCTCTTGTCATCTCAGGG - Intronic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
973195591 4:47436210-47436232 TTGCTCAGCTTCTTATCTCAAGG + Intergenic
975704225 4:77095922-77095944 TTGATCAGCTTGGTTTCTCTGGG - Intergenic
980008470 4:127568145-127568167 TTGATCAGTTTTTCCTTTCATGG - Intergenic
980655374 4:135776094-135776116 GTGATCAGTCTGGCATCTCATGG + Intergenic
981316590 4:143346370-143346392 TTCATCAGGTAGTCATCTCAGGG - Intronic
982999826 4:162400136-162400158 TTGCTAATCTTCTCATCTCAAGG + Intergenic
1202766091 4_GL000008v2_random:149641-149663 TTGAACAGCTTGTGTTCTTATGG - Intergenic
990264320 5:54059342-54059364 TTGATCACTTTGTATTCTCAAGG - Intronic
991404088 5:66284805-66284827 CAGATCACCTTGTCATCCCAGGG - Intergenic
991481701 5:67088206-67088228 TTGATCACGTTGTAATCTCCAGG + Intronic
993116952 5:83730483-83730505 TTGATCAGCTTTTAACCACAAGG - Intergenic
995949314 5:117690504-117690526 TTGCTCAGCTTGTTGTCTGATGG - Intergenic
998163404 5:139826406-139826428 GTGCTCTGCTTCTCATCTCAAGG - Intronic
998859041 5:146425174-146425196 CTGGTCAGTTTGTCAGCTCAAGG + Intergenic
1000367902 5:160507995-160508017 TTGCTCAGCTACTCATCCCAGGG + Intergenic
1001050966 5:168414213-168414235 TTGATCAGCTTGTCATCTCAAGG - Intronic
1002816337 6:684301-684323 ATGACCAGCTTGTTTTCTCAGGG - Intronic
1003432953 6:6056801-6056823 TTGATCTGCATCTCATCTCCTGG - Intergenic
1007313391 6:40964313-40964335 ATGATCATCTTGTCTTCTGATGG + Intergenic
1008606782 6:53147948-53147970 CTGATTAGCTTGTCATTTAATGG - Intronic
1010733288 6:79413170-79413192 TTGTTCTGTTTGTCCTCTCATGG + Intergenic
1015833350 6:137392931-137392953 TTCATCACCTTCTCATTTCACGG - Intergenic
1015942935 6:138470125-138470147 TAGATCTGAATGTCATCTCAAGG - Intronic
1016171206 6:141019241-141019263 TTTATCAGCTTTTCCTCTTATGG + Intergenic
1027825711 7:83112745-83112767 TTAATGAGCTTTTCCTCTCATGG - Intronic
1030790323 7:113718703-113718725 TGGATCAGCTTTTCATGTCTGGG - Intergenic
1033019521 7:137708683-137708705 TTGCTTAGCTTATGATCTCAGGG + Intronic
1033042898 7:137934494-137934516 TTCATCAGCTGTGCATCTCAGGG - Intronic
1041090789 8:54299400-54299422 ACGATCAGCTTGTCATGGCAAGG - Intergenic
1042305282 8:67324675-67324697 TTCAACAGCTTGTAATCTCTTGG - Intronic
1047471970 8:125183775-125183797 TTGTTTACCTGGTCATCTCATGG + Intronic
1051494139 9:17699789-17699811 TTATTCAGCCAGTCATCTCATGG + Intronic
1051501130 9:17779056-17779078 ATCATCAGCTTGCCAACTCAAGG + Intronic
1051850535 9:21502026-21502048 TTGTTTATCTTGTCTTCTCAAGG + Intergenic
1055904718 9:81279391-81279413 TTGCTCAGACTGTCATCTCCTGG - Intergenic
1058278332 9:103076564-103076586 TTGATGAGATTGTCAACACATGG - Intergenic
1059756188 9:117295914-117295936 GAGATCAGCTGGTCATCGCAGGG + Intronic
1203546838 Un_KI270743v1:134530-134552 TTGAACAGCTTGTGTTCTTATGG - Intergenic
1186367521 X:8910997-8911019 TTGATCAGCACTTCATCTCTAGG - Intergenic
1187013667 X:15305198-15305220 TGGAACAGATTGTCATCTGATGG + Intronic
1187653880 X:21446987-21447009 TTCATCAGCTTGCCTCCTCAAGG + Intronic
1189235724 X:39485502-39485524 TTTCTCAGCTTGGCATCTGAGGG + Intergenic
1194696903 X:97063811-97063833 TTGAACATCTTGTTATGTCAGGG + Intronic
1195109684 X:101634673-101634695 TTGATTATCTTTTCATCTAATGG + Intergenic
1196257933 X:113544700-113544722 TTGTCCAGGTTCTCATCTCAAGG + Intergenic
1196261373 X:113586204-113586226 TTCTTTAGCTTGTCATCTAAAGG + Intergenic
1196936040 X:120732089-120732111 TTTATAATTTTGTCATCTCAAGG - Intergenic