ID: 1001052453

View in Genome Browser
Species Human (GRCh38)
Location 5:168424010-168424032
Sequence CGCCCAGGAAAGATACCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001052446_1001052453 22 Left 1001052446 5:168423965-168423987 CCCGGAGCTGAGTGCCACTCTTT 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1001052447_1001052453 21 Left 1001052447 5:168423966-168423988 CCGGAGCTGAGTGCCACTCTTTG 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1001052448_1001052453 8 Left 1001052448 5:168423979-168424001 CCACTCTTTGTGAACTGAGCCTT 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001052453 Original CRISPR CGCCCAGGAAAGATACCGGC TGG Exonic
900937183 1:5773799-5773821 GGCCCAGGACAGAGAGCGGCCGG - Intergenic
901954380 1:12773385-12773407 CCCCCAGCAAAGATACCTTCAGG + Intergenic
903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG + Exonic
912457786 1:109809235-109809257 CTCCCAGGAAAGGCACCAGCGGG + Intergenic
919770674 1:201156304-201156326 AGCCGAGGAAAGATACAGGCAGG - Intronic
922751984 1:228074337-228074359 TGCCCAGGAAAGGAACCTGCAGG + Exonic
1076014692 10:127018309-127018331 CTCCCAGGAAAGACAAAGGCAGG - Intronic
1076571850 10:131438383-131438405 CCCCTGGGAAAGATTCCGGCAGG - Intergenic
1091131498 11:133150725-133150747 TCCCCAGGAAAGAAACCTGCAGG + Intronic
1102675620 12:114656506-114656528 CGACCAGGAAAGAAGCTGGCTGG + Intergenic
1103847673 12:123911837-123911859 CGCCCAGGACAGATGCCCCCAGG - Intronic
1104771916 12:131369034-131369056 TGGCCAGGAAAGATGCCTGCAGG + Intergenic
1118463245 14:66006204-66006226 AGCCCAGAGAAGATACCAGCAGG - Intergenic
1130737876 15:86569746-86569768 ATCCCAGGAAAGATCCCTGCTGG - Intronic
1132689732 16:1177106-1177128 CGCCCAGGACAGACACCTGAAGG - Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1137071795 16:35910229-35910251 CTCCCAGGAAACATACCAGTAGG + Intergenic
1141664072 16:85456862-85456884 CTCACAGGAGAGACACCGGCAGG + Intergenic
1141699557 16:85636170-85636192 CCCCCAGGAAAGATGCCCCCGGG + Intronic
1147647629 17:42043348-42043370 CCCCCAGGGAAGAAACCAGCGGG - Intronic
1152557766 17:81062977-81062999 ACCACAGGAAAGATATCGGCAGG - Intronic
1153917450 18:9758478-9758500 AGCCCAGCAAAGAGACAGGCAGG - Intronic
1157177248 18:45463051-45463073 AGCCCAGGAAGTATACAGGCAGG + Intronic
1162672005 19:12265652-12265674 TGCCAAGGAAAGATACTGGGAGG + Intronic
1164120572 19:22261807-22261829 CGCCCACGAAAGCCACTGGCAGG - Intergenic
1168553699 19:57320777-57320799 CGCCCAGGACAGAGAAGGGCTGG + Exonic
928953405 2:36835545-36835567 CTTCCAGGAAAGAAACTGGCTGG - Intergenic
933775485 2:85768893-85768915 CGCCCAGCAGAGAGACGGGCGGG + Intronic
936255098 2:110904444-110904466 CACCCAGGAAAGACAGAGGCAGG - Intronic
937672438 2:124552480-124552502 AGCCCAGGAATGAGACCAGCTGG - Intronic
940719047 2:157261407-157261429 AGCCCAGGAAAGTTACAGTCAGG + Intronic
943687015 2:190829416-190829438 TGCCCAGGAAAGGACCCGGCAGG + Intergenic
1169773407 20:9225975-9225997 CTCCCAGGAGAGGAACCGGCCGG + Intronic
1172023643 20:31933619-31933641 CAGCCAGGAAAGATGCAGGCAGG + Intronic
1173882403 20:46425959-46425981 CTCCCAGGAAAGATGCCCACGGG + Intronic
968620019 4:1599843-1599865 CTCCCAGGAAAGAAAACGGCAGG + Intergenic
981301102 4:143185996-143186018 CACCCAGGAAAGAGAGCTGCGGG + Exonic
982282974 4:153704796-153704818 AGCCCAGGAAAGCTCCCAGCAGG + Exonic
1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG + Exonic
1006512471 6:34529092-34529114 TCCCCAGGAAAGATACCAGCAGG + Intronic
1024588169 7:50858854-50858876 TGCCTAGGAGAGATACTGGCTGG - Intergenic
1032523023 7:132560757-132560779 TGCCCAGGCAAGACACCTGCAGG + Intronic
1042219595 8:66460459-66460481 GCCCCAGGTAAGAGACCGGCAGG + Exonic
1062128693 9:134880863-134880885 TGCCCAGGAAAGAGAGCAGCAGG - Exonic
1187333691 X:18363557-18363579 AGCCCAGGAAAGACACAGGCTGG - Intergenic
1200256223 X:154584730-154584752 CGCCCAGGACAGACCCCGGGGGG - Intergenic
1200261546 X:154619673-154619695 CGCCCAGGACAGACCCCGGGGGG + Intergenic
1200267528 X:154653970-154653992 CGCCCAGGACAGACCCCGGGGGG + Intergenic