ID: 1001054178

View in Genome Browser
Species Human (GRCh38)
Location 5:168435706-168435728
Sequence GGGTGAAAAAAGTTTTAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001054178 Original CRISPR GGGTGAAAAAAGTTTTAGGT CGG (reversed) Intronic
903094138 1:20953350-20953372 GAGTGAAAAGAGTTTAAGGGAGG + Intronic
903557640 1:24205190-24205212 GGGTCAGAAAAGTTTAAGTTTGG - Intergenic
904821705 1:33249322-33249344 GGGGGAAAACAGTTCTAGTTGGG + Intergenic
904887892 1:33755235-33755257 AGGTGAAAGAAATTTAAGGTTGG - Intronic
905687309 1:39917802-39917824 AGGAGAAAAAAGATTTAGGGAGG + Intergenic
906412142 1:45587059-45587081 GTCTGCAAAAAGTCTTAGGTTGG + Intronic
908428568 1:64033016-64033038 AGATGAAAAAAGTTTTGGGATGG + Intronic
908965510 1:69757356-69757378 GGGAGAACCAAGTTTTAGTTGGG + Intronic
911770552 1:101735563-101735585 GGGGGAAAAATGTTCTAGGTAGG + Intergenic
915518735 1:156429197-156429219 GGCTGATAAAAGATTTAGGGGGG - Intronic
915537743 1:156547611-156547633 GAGTGAAATAAGATTTAGCTGGG - Intronic
915646388 1:157275785-157275807 GGTTGAATAAACTGTTAGGTTGG + Intergenic
916958975 1:169870046-169870068 TGGTGAAAAGAATTTTAAGTAGG - Intronic
917828018 1:178844304-178844326 GGGAGAAAAAACTATTAGTTTGG - Intronic
918355623 1:183704799-183704821 GGTTGAATAAACTGTTAGGTTGG + Intronic
919409067 1:197221305-197221327 GGGTGAGCAAAGATTTTGGTGGG + Intergenic
919463068 1:197902015-197902037 AGGAGATAATAGTTTTAGGTTGG + Intergenic
921575526 1:216830630-216830652 GGGTGAAAAAAGTCTGAGTGAGG - Intronic
922685697 1:227637377-227637399 GGTTGAATAAACTGTTAGGTTGG + Intronic
923918351 1:238534935-238534957 GGGAAAAAAAAGTATTAGGAGGG - Intergenic
924722817 1:246638991-246639013 GGTTGAATAAACTGTTAGGTTGG + Intronic
1063089194 10:2847019-2847041 GAGAGAAATACGTTTTAGGTTGG - Intergenic
1065649240 10:27870214-27870236 GGGAGAGAAAAGATTGAGGTTGG - Intronic
1065905860 10:30250552-30250574 TGGTGAAGAAAGTTTCAGGCGGG - Intergenic
1066071634 10:31820742-31820764 GGGTAAAAAAAATTTCAGTTTGG - Intronic
1066093441 10:32049450-32049472 GGGTGAAAAAGGTTTCGTGTAGG + Intronic
1067679680 10:48423361-48423383 GGGTTTAAAAAACTTTAGGTAGG + Intronic
1068062150 10:52081724-52081746 GGGTGAACAAGGTGGTAGGTTGG + Intronic
1069936672 10:71922191-71922213 GAGTGGAAATGGTTTTAGGTTGG + Intergenic
1074376483 10:112945061-112945083 AGGTGAAAAAAGTTTCATCTAGG - Intergenic
1075403775 10:122180311-122180333 GGGGGAAGAAAGTTTCAGGCAGG - Intronic
1075887119 10:125910287-125910309 GTGTAAAAAAAGTTATAGATGGG - Intronic
1079484427 11:20920180-20920202 GGGCGAAGAAAGAATTAGGTTGG + Intronic
1080147622 11:29006115-29006137 GGGTGAGAAAAGTTGGAGTTTGG + Intergenic
1081354689 11:42097927-42097949 GGGGGAAAAAAGATTTATTTGGG - Intergenic
1082722376 11:56694274-56694296 GGATGAAAAAAATTCTAGGCAGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085237903 11:75029667-75029689 GGGAGAAAAGAGTTTTAAGCAGG - Intergenic
1086177970 11:83915087-83915109 GTTTAAAAAAAGTTTTAGGAAGG + Intronic
1087048711 11:93865920-93865942 GGTTGAATAAACTGTTAGGTTGG + Intergenic
1087223353 11:95570103-95570125 GGGGGAAAAAGGTTTTAGGAAGG - Intergenic
1087378558 11:97375374-97375396 GTGTGAAAAGAATTTTAGGTTGG + Intergenic
1087666284 11:101052919-101052941 GGGAGAAAATAGTTTTGGATAGG + Intronic
1090238574 11:125166287-125166309 GTGTGAAAAAGCGTTTAGGTAGG + Intronic
1093818777 12:23585437-23585459 GAATGAAAAAAGTTGTAGTTTGG - Intronic
1094459963 12:30685594-30685616 GGGTGAAGAAAGAGTTGGGTGGG - Intronic
1096318878 12:50593553-50593575 GGGTGGAATAATTTTTAGGTTGG - Intronic
1097997069 12:65899335-65899357 GGGAGAAAAAAGTTAAATGTAGG - Intronic
1098786546 12:74765247-74765269 GGGTGAAATAAATTTTATTTAGG - Intergenic
1099200614 12:79672452-79672474 GGGGTAAAAATGTTCTAGGTAGG - Intronic
1099615920 12:84935544-84935566 TTGTGAAACAAGTTTCAGGTTGG + Intergenic
1099861823 12:88231675-88231697 GGTTGAATAAACTGTTAGGTTGG - Intergenic
1100432694 12:94544905-94544927 AGATGAAAAAAGTTCTAGGCTGG + Intergenic
1100861172 12:98808994-98809016 GGGTGAGGAAACTTTTAGCTAGG - Intronic
1106167755 13:27263829-27263851 GGGTGAAAAAATTTATAGTTAGG - Intergenic
1107397594 13:40033845-40033867 GGGTGGAAAACCTATTAGGTTGG - Intergenic
1107934464 13:45333863-45333885 AGGTGGAAAAAGTTTTAGGAAGG - Exonic
1109779463 13:67089032-67089054 GGGTGAAAAAATTTTGATGAAGG - Intronic
1112950662 13:104992175-104992197 GGGTAAAAATAGTAGTAGGTAGG - Intergenic
1114049199 14:18906842-18906864 GGATGAAAAAAGTTTTGGTTTGG + Intergenic
1114113365 14:19495089-19495111 GGATGAAAAAAGTTTTGGTTTGG - Intergenic
1114115068 14:19612843-19612865 GGATGAAAAAAGTTTTGGTTTGG - Intergenic
1114236972 14:20832445-20832467 GGTTGAACAAACTGTTAGGTTGG + Intergenic
1116700045 14:48229812-48229834 GGGCGAAGAAAGTTGAAGGTGGG - Intergenic
1118271825 14:64350612-64350634 GGGTTAAAAAAATTCTAGGCTGG + Intergenic
1118797461 14:69155798-69155820 TGGTAAAAAAAGTTTGTGGTAGG - Intergenic
1118942195 14:70348222-70348244 GGTTGAATAAACTGTTAGGTTGG - Intronic
1119415021 14:74464175-74464197 GAGTGAAAAAGGGTGTAGGTTGG + Intergenic
1120766104 14:88327414-88327436 GGGGGAAGAAAATTTTTGGTGGG - Intergenic
1202870996 14_GL000225v1_random:163691-163713 GTGTAAAAAAAGTTATAGATGGG + Intergenic
1124136650 15:27041479-27041501 AGGTTTAAAAAGGTTTAGGTTGG - Intronic
1127319321 15:57827076-57827098 GGATGAGAAAAGTATTAGGCGGG - Intergenic
1128714221 15:69895404-69895426 GGGTGGAGACAGTTTTGGGTAGG - Intergenic
1128955305 15:71935599-71935621 GGATGAAATCAGTTTTTGGTTGG - Intronic
1129011317 15:72420380-72420402 GGTTAAAAAACATTTTAGGTAGG + Intergenic
1131764598 15:95661805-95661827 GGGTGAAAGGATTTTTAGGTAGG + Intergenic
1131978085 15:97965808-97965830 TGGTTTAAAATGTTTTAGGTTGG - Intronic
1133100618 16:3477168-3477190 GGGTGAAAAAAATTTTACAAGGG + Intronic
1135109282 16:19678169-19678191 TTGGGAAAAAAGTATTAGGTTGG - Intronic
1135527719 16:23226855-23226877 GGGTGAAAGAAGTGGTATGTTGG - Intergenic
1136664733 16:31800072-31800094 GGGTGATAGAATTTTTAGGTTGG - Intergenic
1136870732 16:33805137-33805159 GGGTAGAATAAGTTTAAGGTTGG - Intergenic
1137071216 16:35906498-35906520 GGTTGAATAAACTGTTAGGTTGG + Intergenic
1140325878 16:74003016-74003038 GGGTGAAGAAAGTTTCTTGTAGG + Intergenic
1140552933 16:75887136-75887158 GGGTGAAGAAAATCCTAGGTGGG + Intergenic
1141938386 16:87257356-87257378 GGTAGAAAAAAGTTTTAAGAGGG + Intronic
1203101440 16_KI270728v1_random:1310921-1310943 GGGTAGAATAAGTTTAAGGTTGG + Intergenic
1146240996 17:31225766-31225788 GAATGAAAAAAGTTTTGGTTTGG - Intronic
1148643656 17:49206585-49206607 GGGAGAAAAGAGTTGAAGGTGGG + Exonic
1152700617 17:81817003-81817025 GGGAGAAAAAAGATCTAGGGAGG + Intergenic
1153153558 18:2123830-2123852 GGGAGAGAAAAGTTTAGGGTTGG - Intergenic
1153922024 18:9800292-9800314 GGCTGAAGAAAGTTTCAGGTTGG - Intronic
1155902004 18:31403143-31403165 GGGTGGAAAACATTTTAGGAAGG + Intronic
1156087206 18:33420307-33420329 GGATCAAAAAATTATTAGGTTGG + Intronic
1156165800 18:34419222-34419244 GGGACAAATAAGTTTTAGATTGG + Intergenic
1157235432 18:45960989-45961011 GGGTGGAACAGGTTTTAGGGGGG - Intronic
1158966736 18:62628844-62628866 GCAAGAAAAAAGTTTTAAGTAGG - Intergenic
1159141372 18:64399445-64399467 GAGTCAAAAAAGTTTAGGGTGGG - Intergenic
1160087380 18:75789368-75789390 GGGTGCAGAAAGTTCCAGGTTGG + Intergenic
1161634176 19:5376948-5376970 GGTGGAAAAAAGTGATAGGTTGG + Intergenic
1161843392 19:6695911-6695933 GGTTAAAAAAATTTTTAGGCCGG + Intronic
1163939066 19:20476421-20476443 GGTTGAATAAACTGTTAGGTTGG + Intergenic
925688159 2:6493984-6494006 AGAAGAAAAAAGATTTAGGTGGG - Intergenic
927070031 2:19518430-19518452 GTGAGAAAAAAATTTTAGGATGG - Intergenic
927388638 2:22566738-22566760 GTGTGAATAAAGTGTGAGGTAGG - Intergenic
933167831 2:79095054-79095076 GGTTGAATAAACTGTTAGGTTGG + Intergenic
934465530 2:94259794-94259816 GGGAGAAAAAAGATGTAGGCTGG - Intergenic
934493916 2:94781382-94781404 GGGAGAAAAAAGGGTTGGGTAGG - Intergenic
935306138 2:101738342-101738364 GGGGTAAAACAGTTTTAGGCAGG + Intronic
935344637 2:102094968-102094990 GCGTGAGAAAAATTTTAGGATGG + Intronic
937501677 2:122486039-122486061 AAGTGAAAAAGGTTTTATGTTGG + Intergenic
937937291 2:127256443-127256465 AGGAGAAGAAAGTATTAGGTTGG - Intergenic
937964081 2:127487848-127487870 AGGTTATAAAAGTTTAAGGTTGG - Intronic
939224199 2:139344639-139344661 GGGTTAAGAAAGTTTCAAGTAGG + Intergenic
939496460 2:142933085-142933107 GGTTGAATAAACTGTTAGGTTGG + Intronic
942310215 2:174649530-174649552 GGATGAAAACAGTTTAGGGTTGG - Intronic
942517102 2:176765915-176765937 GGGTGAAAATATTTATTGGTGGG - Intergenic
943377038 2:187090460-187090482 GGGTGAAAAAATTATTTTGTAGG + Intergenic
943475180 2:188345569-188345591 TGTTGAAAATAGTTTTAGCTGGG + Intronic
943836114 2:192516003-192516025 GGGTGTAAAAATTGTTGGGTTGG - Intergenic
944132070 2:196357569-196357591 TGGTGAATAAAGGTTTATGTAGG - Intronic
944345327 2:198658341-198658363 AGGTTAAAAAAGTTTATGGTGGG - Intergenic
944433095 2:199657868-199657890 GGGTGGAAAAAGTTGGAGTTGGG + Intergenic
946477975 2:220027415-220027437 TGGTGAAAAGAGTTTTGGATTGG - Intergenic
947983654 2:234430364-234430386 GAGTGAAAAAAGATTAATGTGGG - Intergenic
948146669 2:235713318-235713340 GGGTAAAAAAAGATGTACGTCGG + Intronic
948392645 2:237624114-237624136 TGGTGAAAGAGGTTTGAGGTAGG + Intergenic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1174386117 20:50189568-50189590 GGGTGAAAAAAGTTGAACCTCGG + Intergenic
1175294140 20:57896972-57896994 GGGTGCAGATAGTTTTAGGAAGG - Intergenic
1177615440 21:23511624-23511646 GGGGGAAAAAAGTGTTCTGTGGG + Intergenic
1178062179 21:28864224-28864246 GGGTGGTTAAAGTTCTAGGTTGG - Intergenic
1178786594 21:35659428-35659450 AAGTCAAATAAGTTTTAGGTTGG - Intronic
1180467678 22:15629216-15629238 GGATGAAAAAAGTTTTGGTTTGG + Intergenic
1180924693 22:19545418-19545440 AGGTGAAATATGTTTTAGCTGGG + Intergenic
1182835324 22:33337189-33337211 GGGTGAAGACAGTGTTAGGTAGG - Intronic
1183765878 22:39874283-39874305 GGGTAAAAATAGTTTTAAGTTGG - Intronic
1184821561 22:46913034-46913056 GGTTGAACAGTGTTTTAGGTTGG + Intronic
951521305 3:23612925-23612947 GAGTGAAAAATGTTTTGTGTAGG + Intergenic
952009356 3:28882551-28882573 GGCATTAAAAAGTTTTAGGTTGG + Intergenic
952375392 3:32762956-32762978 ATGAGAAGAAAGTTTTAGGTTGG + Intronic
953567493 3:44045164-44045186 GGGTGCAGAAAGGTTTCGGTGGG - Intergenic
953578727 3:44134436-44134458 GGGTGCAAAAAGTTTTCTGTGGG + Intergenic
955604513 3:60686428-60686450 GGGTCATAAAAATATTAGGTTGG - Intronic
957234775 3:77572555-77572577 GGGTGAGAAAGCTTTCAGGTGGG + Intronic
959516739 3:107275841-107275863 TGATGAAAAAAGTGTTAGGCCGG + Intergenic
961177900 3:124851033-124851055 GGATAAAATAAGTTGTAGGTGGG - Intronic
962112376 3:132466777-132466799 CCATGAAAAAAGTTATAGGTAGG + Intronic
962141329 3:132793738-132793760 TGGAGAAAAAAGTTTTATTTTGG + Intergenic
963350537 3:144146025-144146047 GGGTGAAATAAGTATTATGTTGG + Intergenic
964528943 3:157646222-157646244 GGAGGAAAAATGTTTCAGGTAGG + Intronic
964850060 3:161086430-161086452 GGGTGAAAAAAAGTCTTGGTGGG - Exonic
965789833 3:172375433-172375455 GGGTGAAACAAGTATAAGGTGGG - Intronic
965872540 3:173278881-173278903 GGTTGAATAAACTGTTAGGTTGG - Intergenic
967640384 3:191855754-191855776 GGAAGAAATAAGTTTTAGGAAGG - Intergenic
970069618 4:12142757-12142779 TGGAGAAATAAGTTTAAGGTGGG + Intergenic
970794076 4:19891306-19891328 GGTTGAATAAACTGTTAGGTTGG - Intergenic
971626720 4:28930178-28930200 TAGTGAAAAAAGTTTCAGCTTGG - Intergenic
974950672 4:68580471-68580493 GGTTGAATAAACTGTTAGGTTGG - Intronic
974959067 4:68675990-68676012 GGTTGAATAAACTGTTAGGTTGG - Intergenic
976299737 4:83506583-83506605 GGTTGAATAAACTGTTAGGTTGG + Intronic
977705343 4:100064492-100064514 GAGTGAATAAAGTGTTAGGTTGG + Intergenic
980219985 4:129901783-129901805 GGGAGAAAAAGGTTCCAGGTAGG - Intergenic
982894935 4:160908176-160908198 TGGTGAAAAAAGTTTGTGGCCGG - Intergenic
983322731 4:166213956-166213978 GGAGGAAAAAATTGTTAGGTGGG - Intergenic
986126299 5:4885313-4885335 GAGTGAAAAAGGTTGAAGGTGGG + Intergenic
986161098 5:5229897-5229919 GGCTGCTAAAAGTATTAGGTGGG + Intronic
986393573 5:7306353-7306375 GGCTGACAAAAGATTTTGGTTGG + Intergenic
986591047 5:9370836-9370858 GGGTGAGTAAAGTTTTAATTAGG - Intronic
993111882 5:83667619-83667641 AGTTTAAATAAGTTTTAGGTGGG + Intronic
993484628 5:88467770-88467792 GGGAGAAACAAGTTGGAGGTAGG - Intergenic
994457091 5:100024759-100024781 AGGTGAATAAAATTTTATGTAGG + Intergenic
995240312 5:109877948-109877970 GGGGGAAAAAAGTTTTAAACAGG + Intergenic
995719579 5:115116529-115116551 GTGTGAAAAAGATTTTAGGCTGG - Intergenic
996840254 5:127840291-127840313 AAGTGAAGAAAGTTTGAGGTTGG + Intergenic
997117399 5:131139823-131139845 GGGTGACACTAGTTTGAGGTTGG - Intergenic
998549184 5:143060438-143060460 GGGGAAAAAAAGTATTGGGTGGG + Intronic
998576866 5:143325934-143325956 GACTGAAAAAAGTTTTCAGTAGG + Intronic
998598547 5:143560316-143560338 GGGTGATAAATGTTGTAGTTTGG - Intergenic
999491560 5:152056318-152056340 GGGTGAAGATACTTTTAAGTTGG + Intergenic
1000644746 5:163747678-163747700 GGGAAAAAAAAATTTAAGGTAGG - Intergenic
1001054178 5:168435706-168435728 GGGTGAAAAAAGTTTTAGGTCGG - Intronic
1002120829 5:177003333-177003355 GGCTGAAAAAAGTTGTATGGAGG + Intronic
1004934883 6:20497438-20497460 GGGAGAAACGAGTTTTAGCTAGG + Intergenic
1009235448 6:61117991-61118013 GGTTGAAATCAGTTTTAGTTAGG + Intergenic
1010547596 6:77176932-77176954 GAGTGAAAAAGGTTTAAGGTAGG + Intergenic
1010666246 6:78633322-78633344 GGGTGAAAACAGTTTGGGGGTGG - Intergenic
1013217732 6:108044981-108045003 GGTAGAAAAAAGTTTTAATTAGG - Intronic
1014669928 6:124289760-124289782 GAGTGCAAAAATTTTTAGGGAGG - Intronic
1015187808 6:130438241-130438263 GGATTAAAATAGTTTTATGTTGG - Exonic
1015723977 6:136280038-136280060 AGGTGAAAACAGTTTTAGTCAGG - Intronic
1015776621 6:136821387-136821409 CGGTGAAAAAAATATTGGGTGGG - Intergenic
1016292602 6:142540733-142540755 GGTTGAATAAACTGTTAGGTTGG - Intergenic
1017014247 6:150087415-150087437 GAGTGAATATAGTTTTAGGGAGG + Intergenic
1017505749 6:155067273-155067295 GGGTGAGAAAGGTTCTAGGTAGG - Intronic
1023231472 7:38034745-38034767 GGGAGAAAAATATTTGAGGTTGG - Intergenic
1023487219 7:40699979-40700001 AGGGGAAAAAAGTTTCAGGAAGG - Intronic
1023609598 7:41959380-41959402 GGGTGAGAAAAGTTGTAGAATGG + Intergenic
1024342386 7:48280582-48280604 GGGTGAAAATACTGTTAGGGTGG + Intronic
1024858771 7:53813388-53813410 GGGTTAAAGAAGTTGTAAGTTGG - Intergenic
1026412662 7:70141117-70141139 GGGTGGAACAAGTTTGAGGCAGG + Intronic
1026480119 7:70771507-70771529 GGGGGAAAAAAGATTTTAGTAGG - Intronic
1027916321 7:84327367-84327389 GGGTGAAAAAAATGCTAGGAAGG + Intronic
1029680313 7:102103962-102103984 TGATTAATAAAGTTTTAGGTGGG - Intronic
1030769867 7:113461212-113461234 TGGTGATCAAAATTTTAGGTAGG - Intergenic
1032119533 7:129145762-129145784 GGGTGGAAAAAGTATTGGGCTGG + Intronic
1032293079 7:130607745-130607767 TGGTCAAAACAGTTTGAGGTTGG - Intronic
1032597356 7:133254943-133254965 TAGTAAAAAAAGCTTTAGGTTGG - Intronic
1035019211 7:155790390-155790412 GGGTGAAAAAAGGACTAGGTGGG - Intergenic
1038643576 8:29346333-29346355 GGCTGAGGGAAGTTTTAGGTAGG + Intronic
1042158331 8:65867413-65867435 GGTTGAATAAACTGTTAGGTTGG - Intergenic
1042235674 8:66611612-66611634 GGCTGAAAACAGTTTTAGAGGGG + Intronic
1042909655 8:73813521-73813543 GGTTGCTAAAAGTTTTAGGGTGG - Intronic
1043424119 8:80131820-80131842 GGGTGGAAAAGGTTTTGGTTTGG + Intronic
1043780085 8:84322336-84322358 GGCAGAAAAAAATTATAGGTAGG + Intronic
1043971128 8:86529783-86529805 GACTGAAGAAAGTTTTAGGAGGG + Intronic
1044449970 8:92323315-92323337 AGAGGAAAAAAGTTTGAGGTGGG + Intergenic
1044547667 8:93477579-93477601 GGGTGGAGAAAGTTTTGGGGGGG - Intergenic
1044603640 8:94030545-94030567 AGGTGAAAAAAGTGGTAGGAAGG + Intergenic
1044603643 8:94030565-94030587 AGGTGAAAAAAGTGGTAGGAAGG + Intergenic
1045085414 8:98677638-98677660 GGGAGAAAATAGTTTTAAGGAGG - Intronic
1046902910 8:119541904-119541926 GGGTGAAAAGAGAATCAGGTTGG + Intergenic
1048717565 8:137285553-137285575 GGTTGAATAAACTGTTAGGTTGG - Intergenic
1049176912 8:141198514-141198536 GCATGAAAAAAGTTTTAGGCTGG + Intergenic
1052442024 9:28510243-28510265 GGGAGTGAAAAGTTTTATGTGGG - Intronic
1053607462 9:39675486-39675508 GGGTGTAAAAAGTGGGAGGTGGG - Intergenic
1054246073 9:62666923-62666945 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1054560195 9:66701456-66701478 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1056298628 9:85219283-85219305 AGGTTTAAAAAATTTTAGGTTGG + Intergenic
1056300235 9:85232756-85232778 GGGAGAAGAAACTTTTAGCTTGG + Intergenic
1056347792 9:85716889-85716911 GACTGAGAAAAGTTGTAGGTAGG - Intronic
1057766238 9:97921993-97922015 GGGAGAAAATAGTTTTAAATTGG - Intronic
1060305462 9:122406751-122406773 GGTTAAAAAAAGTTCAAGGTAGG - Intergenic
1203733456 Un_GL000216v2:112894-112916 GTGTAAAAAAAGTTATAGATGGG - Intergenic
1186043991 X:5514099-5514121 GGTAGAAAAAAGTTTTATGGAGG + Intergenic
1187056014 X:15742050-15742072 GGGAGAAACAGGTTTTGGGTGGG - Intronic
1187822026 X:23297974-23297996 GTGTGATGAGAGTTTTAGGTAGG - Intergenic
1188698459 X:33227965-33227987 GGATAAAAAAAGTTTTATATTGG + Intronic
1189231970 X:39459777-39459799 TGGTGAAAACTGTCTTAGGTTGG + Intergenic
1190463786 X:50705663-50705685 GGTTGGAAAAAGTTTGAGGGAGG - Intronic
1191151251 X:57222564-57222586 GGTTGAATAAACTGTTAGGTTGG - Intergenic
1192282280 X:69699513-69699535 GGTTGAATAAACTGTTAGGTTGG + Intronic
1192829360 X:74734927-74734949 GGGAGAAAAAAATTTTAGTTGGG - Exonic
1192945945 X:75965764-75965786 GGTTGAATAAACTGTTAGGTTGG + Intergenic
1197307284 X:124859242-124859264 GTGTTAAAAATGTTTGAGGTTGG + Intronic
1202627552 Y:56875523-56875545 GTGTAAAAAAAGTTATAGATGGG + Intergenic