ID: 1001055573

View in Genome Browser
Species Human (GRCh38)
Location 5:168446991-168447013
Sequence TCTGGGATCCTGTTTCTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001055573 Original CRISPR TCTGGGATCCTGTTTCTGAC CGG Intronic
900485101 1:2918999-2919021 TCTCAGTTCCTGTTTCTGGCTGG - Intergenic
900555399 1:3277876-3277898 TCTGTGTTCCTGTTTGTGCCTGG - Intronic
902220631 1:14962321-14962343 TCTGGGGTCTTGTTTCTGGTGGG + Intronic
903465204 1:23547240-23547262 TCTGGGATTCTGTTTCTCCTTGG - Intergenic
903918684 1:26784037-26784059 CCTGGTCTCCAGTTTCTGACTGG + Intergenic
907309977 1:53533687-53533709 TCTGGGATGCTGGTCCTGATGGG - Intronic
908315724 1:62930411-62930433 TCTGGAATGCATTTTCTGACTGG - Intergenic
908318720 1:62960427-62960449 TCTTGTACCCTGTTTCTGAAAGG - Intergenic
909669865 1:78176480-78176502 TCTGGCACCCTGTTTCTGTGTGG + Intergenic
912197346 1:107413632-107413654 CGTGGTATCCTGTTTCTCACAGG + Intronic
914867247 1:151441728-151441750 TATGGGAACCTATTTTTGACTGG + Intronic
916414487 1:164579793-164579815 TCTGGGCTCCTGTTTCATACAGG - Intronic
918383959 1:183986172-183986194 TCTGGAATCCTTTTTCTGGGTGG + Intronic
920746842 1:208636996-208637018 ACTGGGATCCAGTTACTGAGTGG - Intergenic
924227514 1:241934002-241934024 TCTGGATTCCTGTTACTGGCTGG - Intergenic
1063549564 10:7017496-7017518 TCTGGGATTTAGTTTCTCACTGG + Intergenic
1064306574 10:14172759-14172781 GCTGGAATCCTGTTGCTTACAGG - Intronic
1067179072 10:43971464-43971486 TCTGGGATCAGGTTGCTGGCAGG - Intergenic
1071546433 10:86533442-86533464 GCTGGGATCTTGTTCCTAACTGG - Intergenic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1075073991 10:119338144-119338166 TCAGGGATCCTGATTCCCACCGG + Intronic
1076093173 10:127707042-127707064 TCAGAGCTCCTGTTTCTGAAAGG - Intergenic
1079238954 11:18708995-18709017 CCAGGGAGCCTGCTTCTGACTGG - Intronic
1083087879 11:60168926-60168948 TCTGGGTTTCTGTTTGTGCCTGG + Intergenic
1084794568 11:71496542-71496564 TCTGGGATCCAGATCCTGACAGG + Intronic
1087221163 11:95547702-95547724 TCTTGGAGCCTGTTTCTTGCAGG + Intergenic
1087440164 11:98173736-98173758 TCTGGGATTCAGTTTCTTCCTGG - Intergenic
1090763323 11:129855871-129855893 TCAGGGAACCTGGTTCTGGCAGG + Exonic
1091250747 11:134141797-134141819 GATGGCATCCTTTTTCTGACAGG + Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1095579568 12:43781379-43781401 GCTGGTATCCTGTTGCTCACAGG + Intronic
1097106897 12:56631007-56631029 TCTGGGAATTTTTTTCTGACAGG + Intronic
1098088152 12:66870678-66870700 ACTGGGTTCATGCTTCTGACAGG + Intergenic
1098181919 12:67856382-67856404 TCTGGGATCCTGCCTTTGATGGG - Intergenic
1099301431 12:80899679-80899701 TCTGGGATTCAGTTTCTTCCTGG + Intronic
1100938698 12:99700763-99700785 GCTAGGATCCTGTTCCTAACTGG + Intronic
1101323720 12:103696533-103696555 TTGTGGATCCTGTTTCTTACAGG - Intronic
1103873409 12:124107499-124107521 TCTGGGTGCATGTTTCTGTCAGG - Intronic
1104163064 12:126199352-126199374 TCTGGGAGCTTCTTTCTGTCTGG + Intergenic
1104610707 12:130225525-130225547 TCTTGGGTGCTGTTTCAGACAGG + Intergenic
1104744196 12:131200915-131200937 TCTGGGATCCTCCTCCTCACAGG + Intergenic
1104790183 12:131476308-131476330 TCTGGGATCCTCCTCCTCACAGG - Intergenic
1106403618 13:29454289-29454311 CCTGGAATCATCTTTCTGACTGG - Intronic
1107022911 13:35769934-35769956 TCTGTGATCAAGTTTCTAACTGG - Intronic
1108591145 13:51913911-51913933 TCTGGCATTCTCTTTCTGCCGGG - Intergenic
1108609736 13:52072609-52072631 TCTGGGGACCTGCTTCTGAGTGG - Intronic
1113881184 13:113627507-113627529 TCTAGGATTCTGTGTCTGAGTGG + Intronic
1113922777 13:113923416-113923438 TCTTGGGTCCTGTTTGTAACTGG + Intergenic
1115241390 14:31253759-31253781 TCTGGGTCTCTGTTTCTTACAGG - Intergenic
1115407133 14:33029807-33029829 TCTGGGATGCTTTTTCTTAATGG - Intronic
1117157223 14:52952228-52952250 TCTGGTTTGCTGTTTCTGAAAGG - Intronic
1118461811 14:65994127-65994149 TCTGTGAGCTTGTTTCTGTCAGG - Intronic
1121079233 14:91094459-91094481 TCTGGGATCCTGTTTCCACATGG - Intronic
1121251804 14:92505299-92505321 TCTGGATTCCAGTTTCTGAAGGG + Intergenic
1121711237 14:96040143-96040165 ACTGGGAGCCTGTTTGTGTCGGG - Intronic
1121818150 14:96943980-96944002 TTTGGGTTCATGTTTCTAACAGG + Intergenic
1121966392 14:98310771-98310793 GCTGGAATCCTAGTTCTGACAGG - Intergenic
1122131602 14:99606980-99607002 TTTGGGATCCTGGTTCTGTTGGG - Intergenic
1125056796 15:35368836-35368858 TCTAGGTTCTTATTTCTGACTGG - Intronic
1126533651 15:49736715-49736737 TCTGTCATCATGTTTCTTACGGG - Intergenic
1128651650 15:69419577-69419599 TGTGGGGTGCTGTTTCTGATTGG - Intronic
1129855450 15:78821442-78821464 TCTGCCTTCCTGTTTCTGTCTGG - Intronic
1132474080 16:123966-123988 TGTGTGATCCTGTTTCTCAGCGG - Intronic
1132626288 16:893128-893150 CCTGGGAAGCTGTTTCTGTCGGG - Intronic
1133230763 16:4365495-4365517 TCTGGGCTCCTGGTCCTGGCAGG - Exonic
1135138763 16:19904150-19904172 TTTGGTTTTCTGTTTCTGACTGG + Intergenic
1138184722 16:54967676-54967698 TCTGGCTTCCTGTTGCTCACAGG + Intergenic
1145316043 17:21734797-21734819 TCTGGGCTACTGTTTCTGAAAGG - Intergenic
1151423553 17:74014814-74014836 TCTGAGATCCAGTCTCTGAGTGG - Intergenic
1151511169 17:74561087-74561109 TCTGGGAGCCAGTTCCTGCCTGG - Intergenic
1151593265 17:75060951-75060973 TCTGTCATCCTGGTTCTTACTGG + Intronic
1152916200 17:83037446-83037468 TCTGGGATCCTCTGGCTAACTGG - Intronic
1156395703 18:36697985-36698007 TCTGGTATCCTATTTCCAACTGG + Intronic
1157167391 18:45370548-45370570 TCTGGAACCCTGTGCCTGACAGG - Intronic
1157699608 18:49752722-49752744 GCTGGGAGCCTGTCTCTGATTGG - Intergenic
1159469440 18:68832613-68832635 TCTTAGTTTCTGTTTCTGACTGG - Intronic
1160242748 18:77134635-77134657 CCTGGGGTCCTTTTTCTAACCGG - Intergenic
1160701583 19:510067-510089 TCTGGGCTTCTCTTCCTGACTGG - Intronic
1160764520 19:801508-801530 TCTTGGACCCTGTCTTTGACTGG - Intronic
1161042391 19:2117029-2117051 TCTGGGATCTGGCTTCTGCCTGG - Intronic
1165950155 19:39469827-39469849 TCGGGGGTCCTGTGTCTGAGGGG + Intronic
1168619070 19:57862726-57862748 TCTGGGACACTGATACTGACAGG + Exonic
1168624615 19:57907574-57907596 TCTGGGACACTGATACTGACAGG - Exonic
926163286 2:10502729-10502751 CCTGGGATGCCGTTTCTGCCTGG + Intergenic
926598496 2:14816205-14816227 TCTGTGGTCCGGTTCCTGACAGG - Intergenic
928040076 2:27866246-27866268 ACTTGCATCTTGTTTCTGACAGG + Intronic
930682537 2:54272294-54272316 TCTGGGCTCCTGTGACTGGCAGG + Intronic
932213151 2:69948485-69948507 TTTTGGATCCTGGTTCTGTCAGG - Intergenic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
933625544 2:84594036-84594058 TCTGGGATTCTTTCTCTGAATGG + Exonic
935574467 2:104694596-104694618 GTTGGGATCCTGATTCAGACAGG - Intergenic
936016145 2:108960416-108960438 TCTGGTATCCTGTTTTTGGGGGG - Intronic
938866417 2:135426131-135426153 TCAGGGATCCAGTTTCTCCCTGG - Intronic
941508350 2:166375808-166375830 TCTGGGCTCCTGTTGCTCAGGGG + Exonic
942462795 2:176180055-176180077 TCAGGGATGCTGTGTCTGATTGG + Intergenic
944852266 2:203732128-203732150 TCTGAGATCCTATTTTTGGCTGG + Intronic
945531607 2:210960564-210960586 TCTTTGATCCTGCTTCTGAGTGG - Intergenic
946255007 2:218435738-218435760 TCTGGCATCTTGTTACTGAAAGG - Intronic
947739453 2:232478531-232478553 TCTGGGATCCTGGTTGGAACTGG - Intergenic
1169635334 20:7684829-7684851 TCTGGTATCCACTTTCTGAGAGG + Intergenic
1170495792 20:16923861-16923883 TCATGGATCCTGCTTCTGAGAGG - Intergenic
1170946224 20:20893316-20893338 TCTTGAATCCTGTTTCTAGCTGG - Intergenic
1171211448 20:23320329-23320351 TCTGGGATCTTGTTTCCAGCTGG - Intergenic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1176239428 20:64069092-64069114 TCTGGGATCCTGTTCCCACCTGG + Intronic
1182268329 22:29136696-29136718 TCTGGACTCCTGTTTTTGATAGG - Intronic
1183648018 22:39137883-39137905 TCTAAGATTCTGTTTCTGGCTGG + Intronic
1184371803 22:44087192-44087214 TCTTTGATCCTGGTTCAGACGGG + Intronic
1184865012 22:47197426-47197448 TCCGGGATCCTGCTCCTGCCTGG + Intergenic
1185256128 22:49833090-49833112 TCTGATATTCTGTTTCTGGCAGG + Intergenic
950556725 3:13700512-13700534 TCAAGGATCCTGTTACTGTCGGG + Intergenic
953777099 3:45829210-45829232 TCCTGGATCTTGTTTTTGACTGG + Intronic
955198525 3:56828737-56828759 TGTGGGAGCCTGTTTCTCAGTGG + Intronic
955958400 3:64313825-64313847 ACTGGGTTCCTGGTGCTGACTGG - Intronic
956463149 3:69492261-69492283 TCTGAGGGCCTGTTTCTCACTGG + Intronic
961048414 3:123725775-123725797 ACTGGGATCCTGCTCCCGACTGG - Intronic
962910926 3:139848803-139848825 TCTTGGTTACTGTTTCTCACCGG + Intergenic
963124239 3:141800115-141800137 TCTTGGGTCCTGCTTCTGTCTGG - Intronic
965304858 3:167051648-167051670 CCTGCGCTCCTGTATCTGACAGG - Intergenic
965316243 3:167194384-167194406 TCTAGCATCCTGTCTATGACTGG + Intergenic
966343635 3:178953054-178953076 GCTGGGATCCTGATTTTGAGGGG + Intergenic
966494613 3:180565866-180565888 TCTGGGACCCTGCTTCAGAATGG + Intergenic
969614196 4:8242728-8242750 CCTGGGATCCTGTTCCTCTCGGG + Intergenic
969866466 4:10079739-10079761 TCTGGGCTTCTGTTTCTGCGTGG + Intronic
969948264 4:10806955-10806977 TGTTGGCTCCTGTTTCTGAGGGG - Intergenic
971435141 4:26613453-26613475 TCTTAGTTTCTGTTTCTGACTGG - Intronic
972616481 4:40703407-40703429 TCTGTGTTCCTGTTTCTCAGCGG - Intergenic
976759574 4:88533591-88533613 TTTGGCATGCTGTTTCTCACCGG - Intronic
979358924 4:119738768-119738790 TCTCTGAACCTGTTTCTAACAGG + Intergenic
981470719 4:145131528-145131550 CCTGGGATCCAGTTTCTTAAAGG - Intronic
984034804 4:174651890-174651912 GTTGAGATCCTGTTTCTGAAAGG - Intronic
986075720 5:4336257-4336279 TCTGCTATACTTTTTCTGACGGG - Intergenic
987940425 5:24528578-24528600 TCTGGGATCCTTATACTGCCTGG - Intronic
989221641 5:38971908-38971930 TCTGGGATCCAGTCTCTAATAGG - Exonic
989736564 5:44714923-44714945 TCTGAGTTCCTGGTCCTGACAGG + Intergenic
992489026 5:77222890-77222912 TCTTGGATCCTATTTATGTCTGG - Intronic
994227578 5:97271073-97271095 TCAGGGATTCAGTTTCTTACTGG + Intergenic
995838317 5:116420321-116420343 TCAGGGACCCTGTGTCAGACCGG + Intergenic
996000986 5:118363210-118363232 TTTGGGATTCTCTTTCTGAAGGG - Intergenic
997346671 5:133197155-133197177 TCAGAGATCCTTTTTCTGTCAGG + Exonic
997362169 5:133302085-133302107 CTTGGGATCCTGATTTTGACTGG - Intronic
998789752 5:145753339-145753361 TGTGGGATCCTTTTTCTGCAAGG + Intronic
998952705 5:147407733-147407755 TCAGGGATGCTGTATGTGACTGG + Intronic
999197700 5:149793686-149793708 GCTTGGGTCCTGTTTCTGATCGG - Intronic
1001055573 5:168446991-168447013 TCTGGGATCCTGTTTCTGACCGG + Intronic
1001080242 5:168662271-168662293 TCTGGGATCTTGAGTCTGAGGGG + Intronic
1001097984 5:168790566-168790588 TCTGGGATCCTGTCACTGGAAGG + Intronic
1001412470 5:171520787-171520809 CCTGGGATGCTCTTTCTGGCTGG + Intergenic
1004929842 6:20452249-20452271 TCAGGGATTCTGTTTCTTTCTGG + Intronic
1006793447 6:36717963-36717985 TCTGGGAGCCTGCTGCTGGCAGG - Intronic
1007599513 6:43073075-43073097 TCTGGGAGCCAGTTTTTGACAGG + Intronic
1015844581 6:137506771-137506793 TTTTGGATCCAGTTTCTTACTGG + Intergenic
1016550086 6:145269831-145269853 ACTGGGACCCTGTATCTGAGGGG + Intergenic
1023469444 7:40498681-40498703 TCTGAGATACTGTTTATGAAGGG + Intronic
1027933273 7:84567849-84567871 TCTGAGATCAAGTTTTTGACAGG - Intergenic
1028029101 7:85886830-85886852 CCTGGAATCCTGGTTCTGATTGG + Intergenic
1030402427 7:109068867-109068889 TCTGGGAGACTGTTTCTTTCTGG + Intergenic
1032053377 7:128664169-128664191 AATTGGTTCCTGTTTCTGACTGG - Intergenic
1032656617 7:133937253-133937275 GCTGGGATCCTTTTACTGACTGG - Intronic
1032745891 7:134785655-134785677 TCTGGGCTCATTTTTCTGAAAGG + Intronic
1033366325 7:140674589-140674611 TCACGGTTCCTCTTTCTGACAGG + Exonic
1034366557 7:150554580-150554602 TCAGGGATCCTGTTTCTTCCCGG - Intergenic
1034587115 7:152103607-152103629 TGTGGATTCCTGGTTCTGACAGG - Intronic
1037087334 8:14868885-14868907 TCTGGGATCCAGCTTCTTCCTGG - Intronic
1038244242 8:25839787-25839809 TCTGGGCTATTGTTTATGACTGG - Intergenic
1039790499 8:40872247-40872269 TGTGGGATACTGTTTCTGCCTGG - Intronic
1043496103 8:80802121-80802143 TCAGGGATTCTGTTTCTTCCTGG - Intronic
1044556075 8:93563400-93563422 TCTGGGAGGTTGTTTCTGAAAGG - Intergenic
1044790302 8:95840174-95840196 TCTGGGATGCTCTTTTTGTCTGG + Intergenic
1045670217 8:104542662-104542684 TCTAGGAGCCTATTGCTGACTGG + Intronic
1048807262 8:138252406-138252428 CTTGGGAACCTGTGTCTGACTGG - Intronic
1051818218 9:21134253-21134275 TCTGGGACCATGTTTCTTTCAGG + Intergenic
1052645865 9:31232381-31232403 TCAGGGATCCTGTTTACCACAGG - Intergenic
1057216164 9:93230078-93230100 GCTGGGGTTCTGTTTCTGCCTGG + Intronic
1059690827 9:116684713-116684735 TCTGGGTTCTTCTTGCTGACAGG - Intronic
1062569006 9:137175911-137175933 TCTGGGAGCCCCTTTCTCACTGG - Intronic
1191832041 X:65426155-65426177 TCTGGGATTCAGTTTCTTCCTGG + Intronic
1192579355 X:72268067-72268089 AATGGGATCCTGTTTAAGACAGG - Intronic
1195527877 X:105913796-105913818 TCTGGAATGCAGTTTGTGACAGG + Intronic
1197356232 X:125439720-125439742 TTGGAGATCCTGTTGCTGACAGG + Intergenic