ID: 1001057706

View in Genome Browser
Species Human (GRCh38)
Location 5:168462953-168462975
Sequence ATGCTCTTCTAGGTTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001057706 Original CRISPR ATGCTCTTCTAGGTTGAACA TGG (reversed) Intronic
902939750 1:19792209-19792231 ATCCTCTTCTAGGTTAAGTATGG - Intronic
906460080 1:46030217-46030239 CTGCTCTCCAAGGTTCAACAAGG + Exonic
909712705 1:78670594-78670616 CAACTCTTCTAGCTTGAACAAGG - Intergenic
910142867 1:84045543-84045565 ATGATATTCTGGGTTGGACACGG - Intergenic
911377632 1:97070419-97070441 ATGCTCTCCTCTGCTGAACATGG - Intergenic
911454050 1:98100928-98100950 ATGCAGCTCTAGGTTCAACAAGG + Intergenic
913270333 1:117087007-117087029 ATGGTCTTCTAGGGTGTCCAGGG + Intronic
915142574 1:153776464-153776486 AGGCTCTTCTAGGTAGAGCCAGG + Intronic
916628542 1:166586649-166586671 CTGCTGTTATAGGTTGAAAATGG - Intergenic
918571523 1:185998646-185998668 ATGTTTTTCTAGGTGGAAAAGGG - Intronic
1066714245 10:38269330-38269352 ATGCAGTTCTATTTTGAACATGG + Intergenic
1068198991 10:53758325-53758347 AAGCTTTTATAGGCTGAACATGG - Intergenic
1068296634 10:55079952-55079974 AGGCTCTAGTAGGTAGAACAGGG + Intronic
1070855363 10:79604290-79604312 ATGCTCCTCTAGGTTGAAAGAGG + Intergenic
1071514302 10:86286986-86287008 ATGCTCTTATAGGCTGGTCAGGG + Intronic
1072651829 10:97302058-97302080 ATGCTCTTCAAGACTGACCACGG + Intergenic
1083780501 11:64915059-64915081 CTGCTCATCCAGGGTGAACATGG - Intronic
1084536407 11:69759888-69759910 AGGCATTTCTAGGTGGAACATGG + Intergenic
1086772182 11:90780201-90780223 AAGGTCTCTTAGGTTGAACATGG - Intergenic
1088092816 11:106063317-106063339 AAGCTTTTATAGGTTGAACATGG - Intronic
1088863170 11:113821169-113821191 ATGCTCTTCAAGATTGCTCATGG - Intronic
1088876162 11:113938227-113938249 AGACTCTACTAGGTTGAAGAGGG - Intronic
1094204146 12:27822861-27822883 ATGCTCTTCAAGTTACAACAAGG + Intergenic
1096845474 12:54404177-54404199 CCGCTCCTCTGGGTTGAACATGG + Exonic
1097969912 12:65622353-65622375 ATGCTTTTATAGGGTGAGCACGG + Intergenic
1101139973 12:101785142-101785164 GTACTCTTCTAGGTTGCAGATGG + Intronic
1104598496 12:130136451-130136473 CTGCTTTTCTAGTTTGACCAAGG + Intergenic
1107513699 13:41108732-41108754 ATGATTTTTTAAGTTGAACAAGG - Intergenic
1108105076 13:47000157-47000179 CTCCTATTCTAGGTTGAACATGG - Intergenic
1108559857 13:51632250-51632272 AAGCTCTCCTAGGATGAGCATGG + Intronic
1110794546 13:79621558-79621580 AGGCTTTTATAGGGTGAACATGG + Intergenic
1115299853 14:31872349-31872371 ATGCTCATCTAGTTTGAATAAGG - Intergenic
1116382982 14:44295701-44295723 ATGCTTATCTAGGTTGATCAAGG - Intergenic
1118158957 14:63269842-63269864 ATGCTCTTTTTGGGTGAAAATGG + Intronic
1120278341 14:82407331-82407353 CTTCTCTTCTAGGTTGCAGAGGG - Intergenic
1120442583 14:84559075-84559097 ATGCTCTTCTGGGTTGACAGAGG + Intergenic
1121076665 14:91074780-91074802 TTGCTCTTCTTGGCTGGACATGG + Intronic
1127619844 15:60723276-60723298 ATGCGCATATAGGTTGAAAAAGG + Intronic
1127708813 15:61574808-61574830 ATGCACTGATAGGTTGAGCAAGG + Intergenic
1127781080 15:62316689-62316711 ATGCATCTCTAGGTTGTACATGG + Intergenic
1128891773 15:71338003-71338025 ATTCTTTTCTAGGTACAACAAGG - Intronic
1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG + Intronic
1132249923 15:100328117-100328139 ATGCTCTTCCTGGCTGAACATGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139877289 16:70156542-70156564 ATGGTCGTCCAGGATGAACATGG - Exonic
1148977056 17:51538876-51538898 TTCCTCTTCTAGGTTGCACATGG + Intergenic
1150182125 17:63134030-63134052 GTGCTCTTGTATGTTTAACAGGG - Intronic
1151338880 17:73457055-73457077 ATGCTCCTCACAGTTGAACATGG - Intronic
1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG + Intergenic
1158792154 18:60794546-60794568 ATATTCCTCTAGGTTGTACAAGG + Intergenic
1159096022 18:63902986-63903008 ATGCTCTTCTAATTTGAACTGGG - Exonic
1163626704 19:18394258-18394280 AAGCTTTTCTAGGTTGGAAAAGG - Intronic
1166007963 19:39920021-39920043 GTGCTCTTCCAGGTTGCAGATGG - Intronic
1167516534 19:49926565-49926587 AAGATCTTCTAGATTGTACATGG - Intronic
925699615 2:6622306-6622328 ACTCTCTTCTGGGTTGAAGACGG - Intergenic
925877495 2:8325552-8325574 ATTCTCTTCTAGGTTGAGCTTGG - Intergenic
928016278 2:27660909-27660931 ATGCTATTATAGGCTTAACAGGG + Intronic
930407602 2:50980035-50980057 ATGCAAATCTAGGTTAAACACGG - Intronic
932504729 2:72217607-72217629 ATCCTCTTCTACCTTGAACAAGG - Intronic
932671782 2:73743539-73743561 ATGCTCTTCTAGGCTGGGCATGG - Intergenic
937159821 2:119749631-119749653 ATGCGCTTCCAGGATTAACAAGG + Intergenic
938665433 2:133530638-133530660 ATGCTCTTCTAGCTTAAGGATGG + Intronic
940433531 2:153622946-153622968 AAGCTCTTCTATTTTCAACAAGG - Intergenic
941913561 2:170791219-170791241 ATTCTTGTCTAGGTTAAACATGG - Intronic
1169731860 20:8794738-8794760 ATGATTTTCTAAGTTGATCAAGG - Intronic
1169739636 20:8878199-8878221 GTTCTCTTATAGGTTGAACTGGG - Intronic
1173088878 20:39951406-39951428 ATGCTTTTCCAGGTTGAAAGTGG + Intergenic
1175594438 20:60219604-60219626 ATGATCTTCTAGGTGAAAGATGG + Intergenic
1175857559 20:62130635-62130657 AAGCTCCTCTCGGTTGAACTGGG - Exonic
1178623461 21:34196585-34196607 ATGCTCTTCTAGGTTGACTTGGG + Intergenic
1182193941 22:28494577-28494599 AGGCTTTTATAGGATGAACAAGG - Intronic
949903818 3:8841803-8841825 ATTCTCTTCTGTGTTTAACATGG - Intronic
950031287 3:9855541-9855563 GTCCTCTTCTGGGTTGGACAGGG - Intergenic
956019573 3:64919810-64919832 AAGCTTTTATAGGATGAACATGG - Intergenic
956498949 3:69860819-69860841 AAGCCCTTCAAGGTTGAAAAGGG - Intronic
957945203 3:87054788-87054810 ATAGTATTCTAGGTTGAAAACGG + Intergenic
958517424 3:95135792-95135814 ATTCTATTCTTGTTTGAACATGG + Intergenic
959827081 3:110810756-110810778 ATTCTCTTCTGGATAGAACAGGG + Intergenic
961837294 3:129673313-129673335 AATGTCTTCTAGGTTGCACAGGG + Intronic
965091792 3:164172953-164172975 ATGTTCTTCTAGGTTATATAAGG + Intergenic
965538797 3:169851973-169851995 TTGCTCTTCTAGCCTGAAAAGGG - Intronic
969938229 4:10704581-10704603 CTGCTCCTCTAGGTTGGGCAGGG + Intergenic
971795459 4:31221180-31221202 AAGCTTTTATAGGCTGAACATGG + Intergenic
974253244 4:59416830-59416852 AACCTCTTCTAGTTTGGACAAGG - Intergenic
974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG + Intergenic
979958503 4:126987021-126987043 AGGTTTTTTTAGGTTGAACATGG + Intergenic
980528597 4:134021005-134021027 TTGTTCTTCTAAGTTGAACTAGG + Intergenic
981260715 4:142715503-142715525 ATGCTATTCTTGGATGAAAATGG - Intronic
981574409 4:146189281-146189303 ATGCTTTTCAGGGCTGAACACGG - Intronic
984086037 4:175312137-175312159 ATGCTCATTTAGCTGGAACATGG + Intergenic
984548705 4:181135760-181135782 TTTCTCTTCAAGGATGAACACGG - Intergenic
990695738 5:58414981-58415003 ATTCTCTTCTCAGTAGAACATGG - Intergenic
990802178 5:59617217-59617239 GAGCTCTTCAAGGTTGAAGATGG - Intronic
992107734 5:73463854-73463876 ATGTTCTTCTCGGTTGCAGATGG - Intergenic
992423796 5:76634595-76634617 ATGCTCTTCTTTCTAGAACAGGG - Intronic
993802329 5:92357846-92357868 ATGGTCACCTAGGTTGACCATGG + Intergenic
997611384 5:135218135-135218157 CTCCTCTTCTAGGGTAAACAAGG + Intronic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1001201253 5:169719163-169719185 TGGCTCTTGTAGGTTGTACATGG + Intronic
1003104715 6:3206504-3206526 GCGCTCTTCTAGGTTGCAGATGG - Intergenic
1008941354 6:57049074-57049096 TTGATCTTCTATTTTGAACAGGG - Intronic
1010933950 6:81837752-81837774 ATGCTCTTGTAAGTAGAAAATGG + Intergenic
1016578999 6:145607068-145607090 AGGCTTTTATAGGGTGAACATGG - Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1033478163 7:141710981-141711003 AGGCTCTTCTTTGTTCAACAGGG - Intronic
1037141144 8:15521848-15521870 CTGCTCTTTAAGGTTGTACATGG + Intronic
1037192746 8:16147086-16147108 AAGTTCTACTATGTTGAACAAGG + Intronic
1045821845 8:106347568-106347590 AAACTCTACTAGGTTGTACAGGG + Intronic
1047163824 8:122413731-122413753 TTTCTCTTCTTTGTTGAACAGGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1059620332 9:115997748-115997770 ATGCCCTTCTAGTTTAAAAAAGG - Intergenic
1059941070 9:119360494-119360516 TTGCTCTTCTAGGTTTATCTTGG + Intronic
1203485624 Un_GL000224v1:51415-51437 ATGATCTTCAAGCTAGAACAAGG + Intergenic
1187237842 X:17484863-17484885 CAGCTCCTCTAGGGTGAACAAGG + Intronic
1189848738 X:45158605-45158627 ATGCTCTTCTTTGTTCAGCATGG - Intronic
1193016568 X:76740461-76740483 AAACTATTCTAGGTTAAACATGG - Intergenic
1193424641 X:81327587-81327609 ATGGTTTTCTAGGATGAACCTGG + Intergenic