ID: 1001062755

View in Genome Browser
Species Human (GRCh38)
Location 5:168507666-168507688
Sequence TGGAGCTCAAAGACCTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001062755 Original CRISPR TGGAGCTCAAAGACCTTGTT GGG Intronic
900599829 1:3498208-3498230 CGGAGCACTAAGACCCTGTTGGG - Intronic
900603162 1:3511814-3511836 TGGAGCTCCCAGGCCTTGTTGGG + Intronic
900824444 1:4914616-4914638 TGGTGCCCAAAGACCTTGGTGGG + Intergenic
901883095 1:12205333-12205355 TGCCGCTCCAAGACCTTGATGGG - Intronic
902246447 1:15124139-15124161 TGGAGCTGAAAGACCTGGTGGGG + Intergenic
902754022 1:18537390-18537412 TGGAGCTCACAGACCTGGTCAGG - Intergenic
905897040 1:41554984-41555006 CGGAGCTCAAACACCATGCTGGG + Intronic
906006064 1:42471622-42471644 TGATGCTCAAAGACCTTGTAGGG + Intronic
906843720 1:49167506-49167528 TAGAGCTCAAAGACCTAGGCAGG - Intronic
906965567 1:50453163-50453185 AAGAGCTCAAATACCTTATTAGG + Intronic
908175883 1:61554651-61554673 TAGAGGCCAAAGACCATGTTGGG - Intergenic
909457064 1:75861758-75861780 TGGGGCTCAAACACCATGCTGGG + Intronic
909509095 1:76430984-76431006 CTGAACTCAAAGACCTTTTTGGG + Intronic
910057903 1:83053612-83053634 TGGAGTTCAAAGACCTCCCTAGG - Intergenic
910956904 1:92716115-92716137 TAGAGCTCAAACACCATGATGGG - Intronic
911079654 1:93916114-93916136 CAGAGCTCAAACACCATGTTGGG + Intergenic
913443439 1:118924404-118924426 TGGAGCACAAGGACTTTGTCTGG + Intronic
919010604 1:191957073-191957095 TTGAGCTTAATGACCTTGTTAGG - Intergenic
923363362 1:233234912-233234934 CAGAGCTCACAGACCTTGTACGG + Intronic
923516531 1:234702451-234702473 TGAGGCTCAAGGGCCTTGTTAGG - Intergenic
1064348442 10:14554465-14554487 TGGGTGGCAAAGACCTTGTTGGG - Intronic
1065918597 10:30371936-30371958 AGGAGCACAAAGAGCTTGCTGGG - Intronic
1070706893 10:78646260-78646282 TGGAGCTCAAACACCTTCAATGG + Intergenic
1073613752 10:104971555-104971577 TGGAGCTCAAGGTGCTTGTGGGG + Intronic
1073927401 10:108533093-108533115 TAGAGCTCAAACACCGTGCTGGG - Intergenic
1076480764 10:130783925-130783947 AGGAGATAAAAGAGCTTGTTCGG - Intergenic
1078085204 11:8229740-8229762 TGGAGCTTCAAGACCTGGGTTGG - Intronic
1078519746 11:12053403-12053425 TGTAGCTCATAGACCTTGAAAGG + Intergenic
1078690039 11:13570471-13570493 CGGAGCTCAAACACCATGCTGGG - Intergenic
1081540880 11:44033742-44033764 TGAAGCAGGAAGACCTTGTTTGG + Intergenic
1082136872 11:48559087-48559109 TAGAGCTCAAACACCATGCTGGG + Intergenic
1082722473 11:56695195-56695217 AAGAGCCCAAAGCCCTTGTTGGG + Intergenic
1083684971 11:64370394-64370416 TGGAGGTCATAGACCATGGTTGG + Intronic
1083915440 11:65740225-65740247 TGAACCTCAAAGGCCTGGTTGGG + Intergenic
1086910889 11:92470598-92470620 TGGAACTCACAGAACTTCTTGGG + Intronic
1087691034 11:101320744-101320766 AGGGGCTCCAAGACCTTGCTTGG + Intergenic
1088564409 11:111152903-111152925 TCCAGCACAAAGACCTGGTTGGG - Intergenic
1091044729 11:132315495-132315517 TCAAGCTCAAAGAACTTGATGGG - Intronic
1091628185 12:2138658-2138680 TGTGGCTGAAAGACCATGTTGGG - Intronic
1091679201 12:2514397-2514419 TGGAGCACAAAGGCCTCCTTAGG - Intronic
1091780795 12:3213478-3213500 TGGGGCTCAGAGGCCTGGTTGGG + Intronic
1091867297 12:3851764-3851786 TGGAGCTCAAACACTGTGCTGGG - Intronic
1093992850 12:25609833-25609855 TAGAGCTCAAACACCATGCTGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095530154 12:43177749-43177771 TGGAAATAAGAGACCTTGTTAGG + Intergenic
1095845296 12:46737608-46737630 CAGAGCTCAAACACCTTGCTGGG - Intergenic
1097992395 12:65849639-65849661 TAGAGCTTAATGACATTGTTTGG + Intronic
1098615871 12:72521402-72521424 TGGAGCTCAGAGACCCTGAGTGG + Intronic
1100375095 12:94007803-94007825 TGGAGCTCAAACGCCATGCTGGG + Intergenic
1100857335 12:98769052-98769074 TGGACCTTAAAGACCTTTTATGG - Intronic
1103411330 12:120713899-120713921 TGGAGTTCCCAGACCTAGTTTGG + Intronic
1104371961 12:128231353-128231375 AGGTGCTCAAGGACCTGGTTTGG - Intergenic
1106145562 13:27046939-27046961 TGGAGCTCAATTTCCTTGTTTGG - Intergenic
1113181216 13:107629326-107629348 TAGATCTCAAAGATTTTGTTTGG - Intronic
1114640130 14:24214053-24214075 TGGACCTCAAAGGCCCAGTTTGG + Exonic
1115779756 14:36756271-36756293 TGGAGCTGGAAGACGATGTTCGG + Intronic
1116481977 14:45402094-45402116 TGGAGATCAAAGAACTTCATGGG + Intergenic
1119692458 14:76686787-76686809 TGGAACTCTCAGACCTTGTAAGG - Intergenic
1119944988 14:78684151-78684173 TGGAGTTGAAAGACCTTGGAAGG + Intronic
1121995502 14:98599241-98599263 TGGAAATCAAAGACCTGTTTAGG + Intergenic
1125773898 15:42193167-42193189 AGGACCTCAAAGAACTTTTTTGG + Intronic
1126245302 15:46498190-46498212 TGGAGAGCAAAGACTTTGGTGGG + Intergenic
1127111469 15:55676652-55676674 TCGAACTCAAGGACCTTGTTTGG - Intronic
1127389950 15:58497401-58497423 CTGAGCCCAAAGACCTTCTTGGG + Intronic
1128696622 15:69769647-69769669 TAGAGCTCAAACACCGTGCTGGG - Intergenic
1128758530 15:70199098-70199120 TGGGGCTCAGAGGCCTTGTGTGG + Intergenic
1131859308 15:96635707-96635729 TGGAGCTCCAAGACACTGTTTGG + Intergenic
1132018689 15:98341202-98341224 TGGAGCACAAGGAGCCTGTTGGG - Intergenic
1133733139 16:8593083-8593105 TGAATCTCAAAGACATTGTAAGG - Intergenic
1135272985 16:21084978-21085000 TGCAGGTCAAAGTCCTAGTTAGG + Intronic
1136064022 16:27746780-27746802 TGGAGCTGAAAGATCATGGTGGG + Intronic
1136631750 16:31493034-31493056 TGCAGCTCAAAGACACTGTGGGG + Exonic
1139338399 16:66250020-66250042 TGCTGCTCAAAGACCTTCTGTGG - Intergenic
1139971593 16:70779561-70779583 TGGAGCACAAGGACTTTGTCTGG + Intronic
1140514246 16:75530712-75530734 TGGAGCTAAAAGGGCTTGATGGG + Exonic
1141190199 16:81819169-81819191 TGGAAGACAAAGACCTTGTTGGG + Intronic
1141962245 16:87416934-87416956 CAGAGCTCAAATACCTTGTATGG + Intronic
1142134561 16:88445721-88445743 TGGAACTCAATCACCATGTTGGG - Intergenic
1145861251 17:28212208-28212230 TGGAGCTCAAATGCCATGCTGGG - Intergenic
1151438245 17:74111807-74111829 TGGAGCTCAGAGGTCTTGTACGG + Intergenic
1158021625 18:52848837-52848859 TCGTGTTCAAATACCTTGTTTGG + Intronic
1163431025 19:17267707-17267729 AGGCGCTCAAAGACCATCTTGGG + Intronic
1165298554 19:34950042-34950064 TGGAGCTCATTGAGCTTCTTGGG - Intergenic
1166080681 19:40442475-40442497 TGGAGCACAGAGACCTGGATTGG + Intronic
925587227 2:5475812-5475834 GGGAGCTCAAACAACTTATTTGG - Intergenic
926366553 2:12138951-12138973 TGGAGCTCAAACGCCATGCTGGG + Intergenic
927319468 2:21725682-21725704 AGGAGCTCAAAGACCGTATCAGG + Intergenic
928275414 2:29896145-29896167 GGGAGCACAAAGCCCTTGTGTGG + Intronic
928386516 2:30872966-30872988 TGGAGCTCAGAGTCTTTGCTTGG + Intergenic
928676935 2:33659666-33659688 TTGAGCTCAAAGGCAATGTTGGG + Intergenic
930475816 2:51880530-51880552 AGGGGCTCAAAGAACTTGATAGG + Intergenic
930873720 2:56191558-56191580 TAGAGCTCCAAAGCCTTGTTTGG + Intronic
933880466 2:86664313-86664335 TAGAGCTCAAACACCATGCTGGG - Intronic
939125922 2:138177333-138177355 TGGAGTTAAAAGACCTGGGTTGG - Intergenic
941656578 2:168150998-168151020 TGGTGCTCAATGGCCTTGTTTGG + Intronic
942156879 2:173138672-173138694 TGGAGCTCTTACACCCTGTTAGG + Intronic
944940341 2:204618302-204618324 TGGATCACAAAGACCTGGATTGG + Intronic
945665627 2:212738030-212738052 TGGCGCTAAAAGAAATTGTTAGG - Intergenic
946389124 2:219404986-219405008 TGGAGCTCCAAGCCCTTTTCTGG + Intergenic
948431042 2:237919280-237919302 TGGAGCTCAAACACCATCCTTGG - Intergenic
1172565854 20:35929923-35929945 AGTAGCTCAAAGACCTTAATAGG + Intronic
1174180059 20:48668940-48668962 AGGAGCTCCAAGACCCTGTGGGG - Intronic
1175667657 20:60873833-60873855 GGAAGCTGAAAGTCCTTGTTTGG - Intergenic
949628585 3:5895964-5895986 TGAAGTTCAAAGTCCTGGTTGGG - Intergenic
951363848 3:21756499-21756521 TGGAGCTCAAAGGAGATGTTTGG + Intronic
953522898 3:43659730-43659752 TGGAGCTCGAACACCATGATGGG - Intronic
954384345 3:50236501-50236523 GGGAGGTCAAAGTCCTTGTCTGG - Intronic
954824178 3:53356881-53356903 TGGAGCTCAAAGTACTTCCTAGG + Intergenic
954856836 3:53651188-53651210 TGGAGATCCAAGACCGTGTTAGG - Intronic
955366726 3:58316931-58316953 TGGAGCTCTTTGACCCTGTTAGG + Exonic
956538695 3:70309174-70309196 TGGACCTCAAAGACCGAGGTTGG + Intergenic
958873521 3:99589497-99589519 CAGAGCTCAAACACCATGTTGGG - Intergenic
959186442 3:103052843-103052865 CAGAGCTCAAAGCCCTCGTTAGG - Intergenic
962645150 3:137431131-137431153 CAGAGCTCAAACACCATGTTGGG - Intergenic
965847422 3:172980479-172980501 TGGAGCTATAAGATCATGTTAGG + Intronic
966293676 3:178391285-178391307 TGAAGCTGTAAGACCTTTTTAGG + Intergenic
966351834 3:179039213-179039235 CAGAGCTCAAACACCATGTTGGG - Intronic
967174350 3:186849275-186849297 TGGAGCTCAAAGTTCTTCTCAGG + Intronic
967625941 3:191683744-191683766 AGGAACTCAAAGCCCTTCTTGGG - Intergenic
967784923 3:193482611-193482633 TGCTGCTCATATACCTTGTTTGG - Intronic
969065780 4:4479564-4479586 TGGAGTTTAAATAACTTGTTTGG - Intronic
969543233 4:7807064-7807086 TGAAGCTCAGAGAGCTTGTATGG - Intronic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
971853987 4:32020341-32020363 TGGAGCACAGAGAACTTGTAAGG - Intergenic
972813737 4:42620606-42620628 TGGAGCCAAAATGCCTTGTTTGG + Intronic
974719923 4:65725325-65725347 TGGAGCTCAAACACCATGCTGGG - Intergenic
975364930 4:73518325-73518347 CAGAGCTCAAACACCATGTTGGG + Intergenic
975611385 4:76207092-76207114 GGGAGCCCGAAGACCTTCTTAGG + Intronic
975744600 4:77464089-77464111 CAGAGCTCAAACACCTTGTTGGG + Intergenic
978834010 4:113125792-113125814 AGGAGCTCATAGACCTCCTTGGG + Intronic
978901716 4:113958518-113958540 AGGGGTTCAAAGACCTTCTTTGG - Intronic
980803599 4:137784295-137784317 TGGAGCTCGAACACCGTGTTGGG - Intergenic
981175994 4:141684049-141684071 TGCAGGTGAAAGACCCTGTTGGG + Intronic
981445857 4:144837352-144837374 CAGAGCTCAAACACCATGTTAGG - Intergenic
982837999 4:160146990-160147012 AGGAGGTCAAAATCCTTGTTTGG + Intergenic
983408831 4:167370238-167370260 AGGAACTCCAGGACCTTGTTAGG - Intergenic
985515093 5:338773-338795 TGGAGCTCACTGAGCTTCTTGGG + Intronic
985941224 5:3137914-3137936 TGGGGCACAAAGAACTTTTTAGG + Intergenic
987295295 5:16545165-16545187 TGGAGCTGGAAGAGCTTGTAGGG - Intronic
990176203 5:53110773-53110795 TGGAGCTCACAGTCCTGGGTAGG + Intergenic
993984697 5:94583679-94583701 TGGAGCTCGAACACCATGCTGGG - Intronic
994758466 5:103823722-103823744 TGGGTCTCAAAGACTTTCTTAGG + Intergenic
996668292 5:126086611-126086633 CAGAGCTCAAACACCATGTTGGG - Intergenic
996812567 5:127534302-127534324 GGGAGGTCAAAGAATTTGTTGGG - Intronic
998918352 5:147040666-147040688 TGGCCCTGAATGACCTTGTTAGG + Intronic
999068809 5:148720561-148720583 TGAAGCTCAAAGCATTTGTTTGG - Intergenic
999888528 5:155950988-155951010 TGAAGTTCAAAGACTGTGTTTGG - Intronic
1001062755 5:168507666-168507688 TGGAGCTCAAAGACCTTGTTGGG + Intronic
1001797979 5:174518199-174518221 GGGAGCGCAAAGACCCTGTGGGG + Intergenic
1003021673 6:2515203-2515225 TGGAGGACAAAGTCCTTGTCTGG - Intergenic
1004836269 6:19535432-19535454 TGCAGCTCAGAGAGCTTGGTGGG - Intergenic
1005303616 6:24494047-24494069 AGGTGCTCAAATACCTTGGTTGG + Intronic
1009628702 6:66167126-66167148 CGGAGCTCAAACACCATGCTGGG - Intergenic
1010003020 6:70967274-70967296 CTGAGGTCAAAGACCTGGTTGGG - Intergenic
1010692545 6:78927405-78927427 AGGAGCTCAAACACCTTTATAGG - Intronic
1010978006 6:82338557-82338579 TGTCTCTCAAAGACCTTTTTAGG - Intergenic
1018797594 6:167199391-167199413 TGGAGCTCAAGCACTTTGCTTGG + Intergenic
1019980084 7:4615007-4615029 GGGAGCTCAAAGACCTGGGAAGG + Intergenic
1023311028 7:38886673-38886695 TGGAGCTCAAATGCCGTGCTGGG - Intronic
1023401197 7:39793763-39793785 CTGAGTCCAAAGACCTTGTTGGG - Intergenic
1024497981 7:50069903-50069925 TGGAGCACACAGACCATGCTAGG + Intronic
1024648950 7:51388991-51389013 CTGAGTCCAAAGACCTTGTTGGG + Intergenic
1027469237 7:78552928-78552950 TGGAGCTCACTGACCTTGGGGGG - Intronic
1028722218 7:94046601-94046623 TGTTGCTCAAAGACCATGTGAGG + Intergenic
1031406364 7:121392109-121392131 TGGAGCTCCCAGATCTGGTTTGG + Intronic
1031871009 7:127090280-127090302 TGAAGTTCCAAGAACTTGTTAGG - Intronic
1034153055 7:148931943-148931965 GGGAGCTCAGAGGCCTTTTTAGG - Intergenic
1034634217 7:152554385-152554407 AGGAGCTCAAAGGCCTCGTGTGG - Intergenic
1035995938 8:4547017-4547039 TGGAGCTCAAAGAAGATGTCTGG - Intronic
1037702134 8:21284861-21284883 TGGGGCTCAGAGACCTTCCTTGG - Intergenic
1038381156 8:27095708-27095730 TAGTGCTCAAAGAACTGGTTAGG - Intergenic
1039671923 8:39611353-39611375 TGGAGCTCAAAGCACTTCTTGGG + Intronic
1041458954 8:58090794-58090816 CTGAGCTCAAAGGCCTTGTGGGG - Intronic
1042833503 8:73056407-73056429 CAGAGCTCAAACACCATGTTGGG - Intergenic
1044050655 8:87499272-87499294 TGAAGCTAAAAGACCATATTAGG - Intronic
1044521564 8:93205216-93205238 CAGAGCTCAAACACCTTGCTTGG + Intergenic
1048456515 8:134583473-134583495 TGGAGCTCAAGGATCTTGAGGGG - Intronic
1050128345 9:2382986-2383008 TGGAGTTCAAAGAACTTTTTTGG - Intergenic
1051521579 9:17995126-17995148 TGTAGCTAAAAGACATTGCTGGG - Intergenic
1052138428 9:24945181-24945203 AGCTTCTCAAAGACCTTGTTGGG - Intergenic
1058614360 9:106809812-106809834 CAGAGCTCAAACACCTTGCTGGG - Intergenic
1058819287 9:108714107-108714129 CAGAGCTCAAACACCATGTTGGG - Intergenic
1059334563 9:113560697-113560719 TGGGGCTCACAGCCCTGGTTTGG - Intronic
1059864631 9:118501004-118501026 CAGAGCTCAAACACCATGTTGGG + Intergenic
1060301694 9:122377862-122377884 TGGAGGTCAGAGACCATGCTAGG - Intronic
1062234672 9:135502175-135502197 TGGCGCTCACAGCCCTTGATAGG + Intronic
1186006243 X:5075779-5075801 TGGAGCTCAAAATTCTTTTTCGG + Intergenic
1187296170 X:18002931-18002953 GGCAGCTTAAAGAGCTTGTTGGG - Intergenic
1190683379 X:52849043-52849065 CAGAGCTCAAACACCTTGCTGGG + Intergenic
1191886518 X:65894150-65894172 TGGAGCTCAAACGCCATGCTGGG + Intergenic
1191947807 X:66554420-66554442 TGGAGCTCAAAGACTGTGCTGGG - Intergenic
1193411967 X:81175928-81175950 CAGAGCTCAAACACCATGTTGGG - Intronic
1193419871 X:81270718-81270740 TGGAGCTCGAACACCATGTCGGG + Intronic
1194697891 X:97078333-97078355 TGGAGTTCAAAGCCCTCTTTGGG + Intronic
1195558294 X:106252697-106252719 AGGAGCTCAAACACCTCTTTAGG - Intergenic
1196049482 X:111289894-111289916 ATGATCTCAAAGACCTTCTTGGG + Intergenic
1196159055 X:112462452-112462474 TGGAGCTCAAATGCCCTGCTGGG - Intergenic
1198572395 X:137971619-137971641 TGGAGCTCAAATGCCATGCTGGG - Intergenic
1202054870 Y:20819110-20819132 TAGAGCTCAAACACCATGCTGGG - Intergenic