ID: 1001066303

View in Genome Browser
Species Human (GRCh38)
Location 5:168537649-168537671
Sequence CCGGGTGCGCCATTCCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001066303_1001066313 6 Left 1001066303 5:168537649-168537671 CCCCCGTGGAATGGCGCACCCGG No data
Right 1001066313 5:168537678-168537700 CCAAGTCGATCAGCCCAGTCAGG No data
1001066303_1001066317 25 Left 1001066303 5:168537649-168537671 CCCCCGTGGAATGGCGCACCCGG No data
Right 1001066317 5:168537697-168537719 CAGGGTTGTCTCAGTATTGAAGG No data
1001066303_1001066314 7 Left 1001066303 5:168537649-168537671 CCCCCGTGGAATGGCGCACCCGG No data
Right 1001066314 5:168537679-168537701 CAAGTCGATCAGCCCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001066303 Original CRISPR CCGGGTGCGCCATTCCACGG GGG (reversed) Intergenic
No off target data available for this crispr