ID: 1001068261

View in Genome Browser
Species Human (GRCh38)
Location 5:168558247-168558269
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001068261_1001068267 3 Left 1001068261 5:168558247-168558269 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1001068267 5:168558273-168558295 GCCTCAGCCTCCCGAGTCGCTGG 0: 190
1: 97400
2: 262362
3: 223506
4: 204959
1001068261_1001068271 12 Left 1001068261 5:168558247-168558269 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1001068271 5:168558282-168558304 TCCCGAGTCGCTGGGATTACAGG 0: 104
1: 45679
2: 211098
3: 270790
4: 503082
1001068261_1001068269 4 Left 1001068261 5:168558247-168558269 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1001068269 5:168558274-168558296 CCTCAGCCTCCCGAGTCGCTGGG 0: 196
1: 102700
2: 290140
3: 232571
4: 232633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001068261 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr